Evaluating the prevalence and risk factors for macrolide resistance in Mycoplasma genitalium using a newly developed qPCR assay.

Mycoplasma genitalium (MG) is a sexually transmitted bacterium in which macrolide resistance is rapidly increasing, limiting treatment options. We validated a new assay to detect the presence of macrolide resistance-associated mutations in MG (MG-MRAM). In 2018, symptomatic and asymptomatic clients visiting sexually transmitted infections (STI) clinics in Amsterdam or The Hague were tested for MG using transcription mediated amplification (TMA) assays. The sensitivity to detect MG of the newly developed MG-MRAM qPCR was compared to the MgPa qPCR, both in relation to the TMA assay. For the sensitivity and specificity to detect relevant mutations the MG-MRAM qPCR was compared to 23SrRNA sequencing analysis. The qPCR was subsequently used to determine the presence of MG-MRAM at different anatomical locations and to identify risk factors for MG-MRAM. MG-positive clients (402) providing 493 MG-positive samples were included. In total 309/493 (62.7%) samples from 291 (72.4%) clients were successfully typed with the MG-MRAM qPCR. The MG-MRAM qPCR had a sensitivity of 98.6% (95%CI 91.1%-99.9%) and specificity of 94.1% (95%CI 78.9%-99.0%) to detect MG-MRAM compared to sequencing analysis. Infection with MG-MRAM was detected in 193/291 (66.3%) clients: in 129/178 (72.5%) men and 64/113 (56.6%) women (p = 0.005). Prevalence of MG-MRAM was significantly higher in men, clients with a higher education, HIV-positive clients and clients with >10 sexual partners in the previous six months, but in multivariable analysis no factor was significantly associated with MG-MRAM presence. Since MG-MRAM prevalence was very high, testing for MG-MRAM is essential if treatment for MG is considered, and can be performed with this sensitive and specific qPCR test in routine diagnostics.

Introduction

Mycoplasma genitalium (MG) is a sexually transmitted organism which infects 3.1–4.5% of Dutch clients undergoing screening for sexually transmitted infections (STI) [1, 2]. Among men, the most common clinical manifestation of MG infection is non-gonococcal urethritis (NGU). A meta-analysis from 2011 showed that MG was strongly associated with NGU (pooled OR 5.5 [95% CI: 4.4–7.0]) [3]. In women MG has been associated with an increased risk of cervicitis, pelvic inflammatory disease, preterm birth, and spontaneous abortion [4].

According to European guidelines, uncomplicated MG infections should be treated with azithromycin 500 mg PO on day one followed by 250 mg on days 2–5 [5]. However, single dose treatment (1000 mg) with azithromycin is often the preferred treatment of NGU in many countries, including the Netherlands [6]. Chlamydia trachomatis (CT) infections are also treated with 1000 mg azithromycin, but often without excluding co-infection with MG [6].

A meta-analysis indicated that a single dose of azithromycin facilitates macrolide resistance in MG [7], but this was not confirmed in a more recent extensive retrospective study in Australia [8]. Macrolide resistance is rapidly increasing worldwide and may be found in up to 89% of clients with urethritis [9]. In the Netherlands, macrolide resistance ranges between 20.9–44.4% [10-12]. Macrolide resistant MG can be treated with moxifloxacin 400 mg PO for 7–10 days [5].

Dutch STI guidelines do not recommend routine testing for MG [6, 13]. In the recent revision, screening for MG in men with NGU is mentioned, but not explicitly advised. Previously several qPCRs have been described with high sensitivity and specificity to detect MRAM [14-18]. Also commercial (CE-IVD cleared) diagnostic tests for macrolide resistance-associated mutations (MRAM) have become available [17]. These tests detect several mutations that are associated with macrolide resistance in the V-region of the 23S rRNA gene: A2058G, A2058T, A2058C, A2059G, and A2059C (Escherichia coli numbering) [10, 19]. However, the RealAccurate TVMGres (Pathofinder) assay does not detect the rare A2059C mutation [17]. Since resistance is rapidly increasing, identifying clients with MG-MRAM using routine diagnostic testing might help targeted treatment. As CE-IVD cleared assays mostly have limited systems and specimen types included in their CE-IVD accreditation, these assays cannot be used in all routine diagnostic settings, without extra investments. Therefore we set up and validated a new assay, which uses locked nucleic acids (LNA) in the probes for the specific detection of mutations in the 23SrRNA gene to detect MRAM in MG (MG-MRAM). Using this test, we determined the prevalence of MG-MRAM at different anatomical locations of persons who visited two Dutch sexually transmitted infections (STI) clinics, and we analyzed risk factors for MG-MRAM.

Methods

Sample selection

In this study we used a subset of a large cross-sectional MG prevalence study of two STI outpatient clinics in The Netherlands. In the large cross-sectional study all clients–symptomatic and asymptomatic–at the STI outpatient clinic in Amsterdam in February and March 2018 and in May and June 2018 in The Hague were eligible to be included. A full description of the study is provided by Hetem et al., 2020 (in preparation). Briefly, first-void urine was collected from all males and anal swabs were collected from men who have sex with men (MSM). Cervico-vaginal swabs were taken from all female clients. Anal samples were taken from all females attending the STI clinic in The Hague, whereas in Amsterdam anal samples were taken only from females if they reported anal sex or anal symptoms, were notified for an STI, or reported to perform sex work–both according to the local STI clinic policy. All samples were collected in Aptima sample collection medium and routinely tested for Neisseria gonorrhoeae (NG) and CT and additionally for MG for the present study. Only clients of whom at least one sample tested positive for MG were included in the analyses presented here. Socio-demographic data, sexual behavior and the presence of clinical symptoms–including urogenital discharge, dysuria, ulcers, blood loss and pain–were extracted from electronic patient files at the STI clinics. Only results from the initial STI screening were included.

Detection of MG, CT and NG

The MG-transcription mediated amplification (TMA) assay (Hologic Inc, San Diego, USA) was used for the detection of MG and the Aptima Combo 2 (AC2) TMA was used for the detection of CT and NG on the Panther system according to the manufacturer's instructions. Samples with equivocal results were retested by using the Aptima CT single assay (Hologic) for CT, and an NG qPCR targeting the opa genes for NG [20].

Deoxyribonucleic acid extraction

Next, deoxyribonucleic acid (DNA) was extracted from all samples that tested positive for MG in the MG-TMA assay. From the original Aptima tubes 200 μL sample was used for DNA isolation by isopropanol precipitation [21]. The DNA pellet was dissolved in 50 μL of 10 mM Tris/HCl pH 7 and stored at -20°C until used for DNA amplification.

MG-MRAM testing

DNA isolates were tested for MRAM using a newly designed multiplex qPCR to detect the mutations in the 23S rRNA gene at nucleotide positions 2058 and 2059 (E. coli numbering) associated with macrolide resistance. LNA probes have previously been designed to be able to detect point mutations [22]. Therefore, we used LNA probes to obtain a high specificity to detect the most prevalent mutations in the 23S rRNA gene. Primer and probe sequences are shown in Table 1. The assay consists of two multiplex qPCRs which use the same forward and reverse primers, 250 nM of each primer and three probes of 125nM each. The wild type (WT) probe contains a FAM label and all mutation probes contain a HEX label. Multiplex mix 1 contained the probes to detect WT, and mutations A2058G and A2059G. Mix 2 contained probes to detect mutations A2058C, A2058T and A2059C. Each multiplex qPCR was performed using 2 μL input of the DNA solution, 18 μL mix solution containing 10 μL Platinum Q Supermix (Invitrogen, Nieuwerkerk a/d IJssel, Netherlands) and primers and probes as indicated. Amplification was performed on a RotorGene (Qiagen, Hilden, Germany) with the following cycling profile: 2 min 50°C, denaturation at 95°C for 2 min, followed by 45 amplification cycles consisting of 95°C for 15 sec, and annealing and extension at 60°C for 45 sec. Samples with a cycle value of Ct<37 were considered positive. If the Ct value was between 37 and 45 the test was repeated and deemed positive if Ct<45 with a good S-curve. The performance of the MG-MRAM qPCR was determined by comparing to the TMA assay test results.

Table 1

Primers and probes for 23S rRNA sequencing, and MG-MRAM and MgPa qPCR.

	Name	Target/ Mutation	Fluorophore	5’→3’ sequence	Quencher	Mix
Primers	MG 23S For	23S rRNA		GGT GAA GAC ACC CGT TAG G		1,2
	MG 23S Rev	23S rRNA		CCT ATT CTC TAC ATG GTG GTG TT		1,2
	MG 23S Seq For	23S rRNA		TGTAAAACGACGGCCAGT GAAGGTTAAAGAAGGAGGTTAGCAAT		Sequencing
	MG 23S Seq Rev	23S rRNA		CAGGAAACAGCTATGACC CTACCTATTCTCTACATGGTGGTGTTT		Sequencing
	MgPa For	MgPa		GAG AAA TAC CTT GAT GGT CAG CAA		MgPa
	MgPa Rev	MgPa		GTT AAT ATC ATA TAA AGC TCT ACC GTT GTT ATC		MgPa
Probes	23S WT LNA	Wild type	FAM	ACG GAAAGA CCC	IABkFQ	1
	23S GA LNA	A2058G	HEX	ACG GGA AGA CC	IABkFQ	1
	23S AG LNA	A2059G	HEX	CG GAGAGACC	IABkFQ	1
	23S CA LNA	A2058C	HEX	ACG GCAAGA CC	IABkFQ	2
	23S TA LNA	A2058T	HEX	ACG GTAAGA CCC	IABkFQ	2
	23S AC LNA	A2059C	HEX	ACG GACAGA CC	IABkFQ	2
	MgPa		FAM	ACT TTG CAA TCA GAA GGT	MGBNFQ	MgPa

LNA (locked nucleic acid) nucleotides are shown in bold and underlined. M13 tag in sequencing primers are shown in bold and italic. MG-MRAM: Mycoplasma genitalium with macrolide resistance-associated mutations; FAM: green fluorescent label, HEX: yellow fluorescent label; MGBNFQ: Taqman minor groove binder non-fluorescent quencher; IABkFQ: Iowa Black® quencher. Multiplex mix 1 contained the probes to detect WT, and mutations A2058G and A2059G. Mix 2 contained probes to detect mutations A2058C, A2058T and A2059C.

MgPa qPCR testing

The MG-MRAM qPCR was compared for sensitivity with the MgPa qPCR [23]–both in relation to the TMA assay. The MgPa qPCR was performed using 2 μl input of the DNA isolate, in a total volume of 20 μl mix solution containing 10 μl Platinum Q Supermix (Invitrogen, Nieuwerkerk a/d IJssel, Netherlands) and 625 nM of each primer and 75 nM of the FAM-labeled probe (based on Jensen et al., 2004 [23]). Amplification was performed on a Rotorgene with the MG-MRAM qPCR cycling program and the same criteria were used to consider a sample as MG positive. Positive results in the MG-MRAM qPCR in samples that were negative in the MgPa qPCR, as well as positive MgPa qPCR results in samples not reactive in the MG-MRAM qPCR were considered as valid since all samples had tested positive in the MG-TMA assay.

Sequencing analysis of 23SrRNA gene

To confirm the mutation qPCR test results, a subset of 126 of the 309 samples (40.8%) that were typable with the MG-MRAM qPCR were used to perform sequencing analysis (Fig 1). In addition, also a subset of 33 MG-positive samples out of the total of 184 samples (17.9%) in which no MG was detected with the MG-MRAM qPCR was used for sequencing analysis (Fig 1), totaling 159 samples for sequencing analysis. For both subsets we selected samples that tested positive with the MgPa qPCR and had a Ct value of <36. The 23SrRNA forward and reverse primers were tagged with an M13 sequence for the sequencing qPCR reaction (Table 1). Sequencing reactions were performed using 3nM of each primer. Sequences were analyzed using software packages MEGA (version M6.0.6) and Bionumerics (version 7.6.3). Sensitivity and specificity to detect MG-MRAM was determined by comparing the MG-MRAM qPCR to sequencing analysis.

Fig 1

Flow diagram summarizing the number of clients and samples included in this study and which tests were performed on which samples.

Statistical analysis

Data were analyzed using SPSS v 20.0 (IBM Corp, Armonk, NY, USA) and significance was assessed two-sided for all variables, with p<0.05. The variable ‘Education’ was categorized into low (no education, primary school, lower secondary vocational education and intermediate secondary general education), mid (higher secondary general education, senior secondary vocational education and pre-university secondary education) and high (higher professional or university education). A client was considered to be infected by macrolide susceptible MG when the MG-MRAM qPCR only detected WT variants in all the available samples of that client. If in one of the available samples MG-MRAM was found, the client was considered to be infected by a resistant strain. Univariable analysis was performed using the Chi-square test or Fischer exact test to compare the proportion positive MG-MRAM between sexual risk groups for different anatomical locations. MG-MRAM prevalence was calculated as percentage of typeable samples. Cohen’s Kappa was calculated to assess agreement between the MgPa qPCR and MG-MRAM qPCR. Generalized Estimating Equations logistic regression was used to compare the MG-positivity between anatomical locations. Factors associated with MG-MRAM were examined using univariable and multivariable logistic regression analysis on client level.

Ethics statement

Clients of the STI outpatient clinics were informed of the “opt-out” system regarding research on remnants of client material. Material from clients was only included in this study if clients did not opt-out. All data were fully anonymized before assessment. Results of MG testing were not disclosed to healthcare professionals or clients. The study protocol was evaluated by the Institutional review board which is the Medical Ethics Committee of the Academic Medical Center in Amsterdam (letter reference no. W18.013#18.024) and deemed not to require a full review of the board and informed consent was not deemed to be required.

Results

Detection of MG by the MgPa qPCR

During the study period 445/3225 (13.8%) tested clients were positive for MG with the MG-TMA assay, of whom 1031 were MSM, 927 heterosexual men, 1249 women, 17 transgender people and the sexual orientation of 2 patients was unknown. Information on all clients enrolled during the study period is described by Hetem et al. 2020, (manuscript in preparation). From 402/445 clients positive for MG–of whom 182 were MSM, 66 heterosexual men and 154 women–samples were available for MgPa and MG-MRAM testing, including 136 vaginal, 120 urine and 237 anal samples, totaling 493 samples (Fig 1). MG was detected in 99/136 (72.8%), 72/120 (60.0%), and 134/237 (56.5%) of the vaginal, urine and anal samples respectively with the MgPa assay (S1 Table). The MgPa assay detected significantly less often MG in anal samples compared to vaginal samples (p = 0.002) and had a sensitivity of 61.9% (305/493) compared to the TMA assay.

Detection of MG by the MG-MRAM qPCR

Presence of MG-MRAM or MG-WT could be assessed in 91/136 (66.9%), 72/120 (60.0%) and 146/237 (61.6%) of the vaginal, urine and anal samples respectively by the MG-MRAM qPCR. The MG-MRAM qPCR was negative in 184/493 (37.3%) of the samples that tested positive for MG in the TMA assay (S1 Table). There was no significant difference in detection of MG in vaginal and anal samples (p = 0.307) or vaginal and urine samples (p = 0.253). The MG-MRAM qPCR detected MG in 62.7% (95%CI 58.2%-67.0%) and the MgPa qPCR in 61.9% (95%CI 57.4%-66.1%) of all samples that were positive according to the TMA assay. The overall Cohen’s kappa for agreement of the MgPa qPCR and MG-MRAM qPCR for detecting MG was 0.646; stratified per anatomical location kappa was 0.617 for vaginal samples, 0.715 for urine samples and 0.615 for anal samples.

Sequencing analysis

Sequences were successfully obtained for 103/126 (81.7%) samples that were typed with the MG-MRAM qPCR. One of the 126 typed samples was a mixture of WT and MG-MRAM according to the MG-MRAM qPCR, and thus classified as MG-MRAM. With sequencing analysis that sample was identified as WT. Furthermore, one typed sample was identified as MG-MRAM with MG-MRAM qPCR, but with sequencing as WT; and one sample as WT with MG-MRAM qPCR, but with sequencing analysis as MG-MRAM. The sensitivity of the MG-MRAM qPCR to detect MG-MRAM was 98.6% (95%CI 91.1%-99.9%) and the specificity was 94.1% (95%CI 78.9%-99.0%) (S2 Table). From the 167 MG-positive samples that were not successfully typed with the MG-MRAM qPCR, a subset of 33 were used for sequencing analysis and of those sequences were obtained from 19/33 (57.6%) samples (Fig 1 and Table 2). In these sequenced samples a relative high proportion of A2058T (47.4%) and A2059C (15.8%) was found compared to samples that were sequenced and typed (1.9% and 0%, respectively), but absolute numbers were low for these mutations. Taken together, sequences of 122 MG samples were available in this study with a total of 30.3% wild type and thus 69.7% MG-MRAM types (Table 2). According to sequence analysis the most prevalent mutation was A2059G (32.0%), followed by A2058G (26.2%), A2058T (9.0%) and A2059 C (2.5%) (Table 2).

Table 2

Type of 23SrRNA mutations in samples from different anatomical locations that were MG positive in the MG-TMA.

Successfully typed and sequenced per anatomical location							Sequenced samples that were not typed with	Total successfully sequenced samples1
Sequence	Vagina	Urine hetero-sexual male	Urine MSM	Anus female	Anus MSM	Total	MG-MRAM qPCR
Wild type	12 (11.7%)	8 (7.8%)	3 (2.9%)	2 (1.9%)	9 (8.7%)	34 (33.0%)	3 (15.8%)	37 (30.3%)
A2059G	9 (8.7%)	3 (2.9%)	6 (5.8%)	3 (2.9%)	17 (16.5%)	38 (36.9%)	1 (5.3%)	39 (32.0%)
A2058G	9 (8.7%)	9 (8.7%)	4 (3.9%)	3 (2.9%)	4 (3.9%)	29 (28.2%)	3 (15.8%)	32 (26.2%)
A2058T	1 (1.0%)				1 (1.0%)	2 (1.9%)	9 (47.4%)	11 (9.0%)
A2059C							3 (15.8%)	3 (2.5%)
Total	31 (30.1%)	20 (19.4%)	13 (12.6%)	8 (7.8%)	31 (30.1%)	103 (100%)	19 (100%)	122 (100%)

1 In total 159/493 (32.2%) of the samples were subjected to sequence analysis. Of these 159, 122 (103 +19) yielded useful sequences.

In the left part of the table samples are shown that were typed with the MG-MRAM qPCR and successfully sequenced. In the middle column results are shown of 19/33 successfully sequenced samples that were not typed with the MG-MRAM qPCR. Right column is showing the total number of successfully sequenced samples in this study.

Prevalence of MG-MRAM in urogenital and anal samples

MG-MRAM was detected in 65.3% (213/326) of the samples and MG-WT in 34.7% (113/326) of the samples using MG-MRAM qPCR or sequencing analysis (Table 3). Two of 326 typed samples contained both MG-WT and MG-MRAM and were classified as MG-MRAM. The prevalence of MG-MRAM in anal samples was significantly higher in MSM than in women (75.5% vs. 59.2%, p = 0.04) (Table 3). No difference between prevalence of MG-MRAM in MSM (67.6%) and heterosexual males (68.2%) in urine samples was observed (Table 3). From 91 clients samples from two anatomical sites were available of whom 34 (39.5%) MG-MRAM or MG-WT could be successfully typed in both samples. In 31/34 (91.1%) clients the same MG resistance type was found, but in 3/34 (8.8%) clients MG-WT was found at one location and MG-MRAM at the other location. Specifically, one of these clients had anal MG-WT and vaginal MG-MRAM; another had anal MG-MRAM and vaginal MG-WT; and the last one had anal MG-MRAM and urine MG-WT.

Table 3

Prevalence of MG with Macrolide Resistance-Associated Mutations (MG-MRAM) in samples derived from different anatomical locations typed by MG-MRAM qPCR and/or by sequencing analysis.

Location		Total (MG-TMA positive)	Typeable2 (% of total)	MG-MRAM (% of typeable)	P- value
Vagina	Women	136	97 (71.3%)	54 (55.7%)
Urine	Total	120	78 (65.0%)	53 (67.9%)
	MSM	54	34 (63.0%)	23 (67.6%)	0.960
	Heterosexual male	66	44 (66.7%)	30 (68.2%)
Anus	Total	237	151 (63.7%)	106 (70.2%)
	MSM	147	102 (69.4%)	77 (75.5%)	0.040
	Women	90	49 (54.4%)	29 (59.2%)
Total1		493	326 (66.1%)	213 (65.3%)

MSM: men who have sex with men.

1From 91 clients samples from two different anatomical locations were available.

2Typeable included data from the MG-MRAM qPCR combined with sequencing data; 17/326 (5.2%) samples could only be typed using sequencing analysis, but not with the MG-MRAM qPCR.

Prevalence of MG-MRAM was defined as proportion of typeable samples.

Risk factors for MG-MRAM infection

The study included 402 clients who provided 493 samples. For 291/402 clients (72.4%) one or more of the samples were typeable using the MG-MRAM qPCR or sequencing analysis. If in one of the available samples MG-MRAM was found, the client was considered to be infected by a resistant strain. MG-MRAM was detected in at least one of the samples from 193/291 (66.3%) clients (Table 4). MG-MRAM was more common in men (72.5%, p = 0.005), in clients with higher education (72.6%, p = 0.029), in clients with >10 sexual partners in the preceding six months (77.5%, p = 0.016) and in HIV-positive clients (82.8%, p = 0.047). All HIV-positive clients were MSM. No association was found between MG-MRAM and co-infections or recent azithromycin treatment. Only 105/402 (26.1%) clients reported symptoms, discharge (63/402, 15.7%) was most frequently reported, followed by dysuria (54/402, 13.4%). There was no significant difference in the proportion reporting symptoms between clients infected with MG-MRAM and clients infected with MG-WT. In multivariable logistic regression none of the included variables was significantly associated with MG-MRAM infections (Table 4). When risk factors were analyzed separately for men and women, the only observed significant association was between MG-MRAM positivity and number of sexual partners in previous 6 months in men (S3 Table).

Table 4

Prevalence of MG-MRAM among clients of the STI outpatient clinic in Amsterdam and The Hague according to different client characteristics, and results of logistic regression analysis for association of characteristics with presence of MG-MRAM.

		Total clients	Typeable (% of total)	MG-MRAM (% of typeable)	P-value2	OR	95%CI	AOR3	95%CI
Overall1		402	291 (72.4%)	193 (66.3%)
Sex	Women	154	113 (73.4%)	64 (56.6%)	0.005	1
	Men	248	178 (71.8%)	129 (72.5%)		2.02	1.23–3.31
Sexual risk group	Women	154	113 (73.4%)	64 (56.6%)	0.016	1		1
	Heterosexual male	66	44 (66.7%)	30 (68.2%)		1.64	0.79–3.42	1.38	0.73–2.60
	MSM	182	134 (73.6%)	99 (73.9%)		2.17	1.27–3.70	1.66	0.77–3.61
Age in years	<25	160	115 (71.8%)	69 (60.0%)	0.199	1
	25–34	132	93 (70.5%)	63 (67.7%)		1.40	0.79–2.48
	35–44	61	44 (72.1%)	34 (77.3%)		2.27	1.02–5.03
	> = 45	49	39 (79.6%)	27 (69.2%)		1.50	0.69–3.26
Ethnicity	Dutch	216	159 (73.6%)	103 (64.8%)	0.493	1
	Other European	47	37 (78.7%)	29 (78.4%)		1.97	0.84–4.60
	African	35	20 (57.1%)	12 (60.0%)		0.82	0.32–2.11
	Mid/South American	65	46 (70.7%)	29 (63.0%)		0.93	0.47–1.83
	Asian	30	22 (73.3%)	14 (63.6%)		0.95	0.38–2.41
	Other	9	7 (77.8%)	6 (85.7%)		3.26	0.38–27.78
Educational level	Low	44	30 (68.2%)	16 (53.3%)	0.029	1		1
	Mid	116	88 (75.9%)	52 (59.1%)		1.26	0.55–2.91	1.15	0.49–2.72
	High	216	157 (72.7%)	114 (72.6%)		2.32	1.04–5.16	2.14	0.92–4.96
HIV	Negative	366	261 (71.3%)	168 (64.4%)	0.047	1		1
	Positive	35	29 (82.9%)	24 (82.8%)		2.66	0.98–7.20	2.13	0.66–6.85
Chlamydia	Negative	346	253 (73.1%)	168 (66.4%)	0.941	1
	Positive	56	38 (67.8%)	25 (65.8%)		0.97	0.47–2.00
Gonorrhea	Negative	362	265 (73.2%)	172 (64.9%)	0.102	1
	Positive	40	26 (65.0%)	21 (80.8%)		2.27	0.83–6.22
Reported having done sex	No	373	271 (72.7%)	180 (66.4%)	0.983	1
work in preceding 6 months	Yes	27	18 (66.7%)	12 (66.7%)		1.01	0.37–2.78
Azithromycin in previous 3	No	393	285 (72.5%)	188 (66.0%)	0.373	1
months	Yes	9	6 (66.7%)	5 (83.3%)		2.58	0.30–22.39
No. of sexual partners in	0–2	112	76 (67.9%)	44 (57.9%)	0.040	1		1
previous 6 months	3–10	187	143 (76.5%)	93 (65.0%)		1.35	0.77–2.39	1.09	0.59–2.02
	>10	102	71 (69.6%)	55 (77.5%)		2.50	1.22–5.13	1.91	0.81–4.51
Any symptom	No	297	214 (72.1%)	138 (64.5%)	0.269	1
	Yes	105	77 (73.3%)	55 (71.4%)		1.38	0.78–2.43
Urogenital discharge	No	339	244 (72.0%)	161 (66.0%)	0.780	1
	Yes	63	47 (74.6%)	32 (68.1%)		1.10	0.56–2.15
Dysuria	No	348	252 (72.4%)	167 (66.3%)	0.962	1
	Yes	54	39 (72.2%)	26 (66.7%)		1.02	0.50–2.08
Ulcers	No	396	287 (72.5%)	190 (66.2%)	0.712	1
	Yes	6	4 (66.7%)	3 (75.0%)		1.53	0.16–14.93
Blood loss	No	394	284 (72.1%)	189 (66.5%)	0.603	1
	Yes	8	7 (87.5%)	4 (57.1%)		0.67	0.15–3.06
Pain	No	398	288 (72.4%)	191 (66.3%)	0.990	1
	Yes	4	3 (75.0%)	2 (66.7%)		1.02	0.09–11.36

MSM: men who have sex with men, OR: Odds ratio, AOR: adjusted odds ratio. P-values, OR and 95%CI are based on clients of whom the samples were typeable.

1A patient was considered to be infected with MG-MRAM if in at least one of the samples a mutation was detected. 2Overall p-value determined with chi-square test. 3The multivariable logistic regression model contained the variables Sexual risk group, Educational level, HIV and No. of sexual partners in previous 6 months.

Discussion

Here we describe a new qPCR assay with LNA probes to specifically detect MG-WT and MG-MRAM for the most commonly occurring mutations in the 23SrRNA gene of MG. This assay shows a high sensitivity (98.6%) and specificity (94.1%) compared to sequencing analysis. Thus the qPCR with LNA probes can be used as a quick technique to specifically detect MRAM in MG. The MG-MRAM qPCR was able to detect MG in MG-positive samples with comparable frequency as the MgPa PCR, which is often used in routine diagnostics to detect MG [23]. With this new qPCR we found that two-third of the study population was infected with MG-MRAM, thereby likely compromising treatment with azithromycin. Prevalence of MG-MRAM was significantly higher in men, in clients with a higher education, in HIV-positive clients and in clients with >10 sexual partners in the previous six months, but in multivariable analysis no factor was significantly associated with MG-MRAM presence.

The MG-MRAM qPCR was able to detect MG in MG-positive samples as frequently as the MgPa qPCR and there was a good overall agreement between the MgPa qPCR and the MG-MRAM qPCR with a Cohen’s kappa of 0.646. However, a substantial portion (37.3%) of the samples that tested positive for MG in the MG-TMA assay could not be typed by the MG-MRAM qPCR. Some samples were positive in the MgPa qPCR whereas they were not typeable with the MG-MRAM qPCR and the other way around. We considered all these samples as correctly detected or typed, since all samples had previously been tested positive with the highly sensitive MG-TMA assay. In most cases, either both assays were able to detect MG or both were not able to detect MG. That a substantial portion of MG positive samples was negative in both qPCR assays can be explained by the superior sensitivity of the MG-TMA assay. In TMA assays RNA molecules are detected, which are present in multiple copies per bacterium. Detection of multiple RNA copies increases the sensitivity compared to detection of the single-copy 23S rRNA gene DNA target in the MG-MRAM qPCR. Earlier studies found between 17.5–40.3% more MG-positives with TMA compared to qPCR [24, 25]. In most studies qPCR is used to detect MG, potentially underestimating the prevalence of MG [1, 11]. Another explanation for the lower detection rates of MG by MG-MRAM qPCR could be that some samples had been stored for more than a year before being tested, while the TMA assay, the MgPa qPCR and sequencing analysis were all performed directly after arrival in the laboratory.

Previously other qPCRs have been described with high sensitivity and specificity that detect MRAM in MG [14–16, 18]. Some of the commercial available qPCRs do not detect MG-WT and can therefore result in incorrectly identified MG-WT when no signal is obtained by the mutation detecting probes [17]. Subsequently, the patient would be treated with a macrolide which, most probably, would lead to treatment failure. Moreover, the RealAccurate TVMGres (Pathofinder) assay does not detect the A2059C mutation which was present in 2.5% of the MG-positive samples in our study according to sequence analysis. Our newly designed MG-MRAM qPCR detects both MG-WT and MG-MRAM directly and it is a sensitive and specific qPCR for versatile platforms such as the RotorGene which is easy to interpret in routine diagnostics, since there will be only two signals–one for WT and one for MG-MRAM–that need to be analysed.

The MG-MRAM qPCR detected less often the A2058T and A2059C mutations compared to sequencing analysis although this concerned small numbers of samples. This can be explained since the test with the MG-MRAM qPCR mix 2 –containing probes for A2058T, A2058C and A2059C –was often performed more than one year after sequencing analysis, whereas the MG-MRAM qPCR with mix 1 –containing probes for WT, A2058G and A2059G –which was used mostly concomitantly to the sequencing analysis. DNA might possibly already have degraded in these samples. However, our study shows that the most prevalent mutations A2058G and A2059G (Table 2) were detected. Proportions of the mutations were similar to those reported in previous Dutch studies [10, 12]. However, the proportion A2058T seems to be lower in our study population.

We found a very high prevalence of MG-MRAM (66.3%), especially among men, clients with a higher education level, HIV-positive clients and clients with >10 recent sexual partners. In multivariable logistic regression none of these risk factors were significantly associated with MG-MRAM infections. This might be explained by the fact that MSM in this population report a higher education level, are more often HIV-positive and more often have >10 recent sexual partners. The observed prevalence of MG-MRAM is higher than previously reported in the Netherlands (20.9%-44.4%) [10-12]. However, those studies included mainly hospital and primary care clients who were sampled some years ago, whereas our population consisted of clients visiting the STI clinic in urbanized regions in the Netherlands in 2018. In our population we had a relatively large group of MSM and HIV-positives and these groups had a relatively high prevalence of MG-MRAM. Thus treatment with azithromycin is possibly compromised in a majority of MG cases.

This study has some limitations. First of all, we did not sequence all MG positive samples, but only a subset. Second, in our study we only included first test results and client information that was available from that STI clinic visit. We did not have access to information of previous general practitioner or hospital visits, but asked clients if they received antibiotic treatment in the preceding three months. The actual number of clients that received azithromycin in the preceding three months is therefore probably higher. No association between azithromycin treatment in the preceding three months and MG-MRAM was found (Table 4). This might be explained by the low number of clients that reported azithromycin treatment (n = 9).

We found that 8.8% of the clients with a double infection had MG-WT on one anatomical location, and MG-MRAM on the other location. Two of 326 typed samples–from 291 clients–were typed to contain both MG-WT and MG-MRAM, and we classified them as MG-MRAM, since it is to be expected that treatment with azithromycin would not be effective to clear MG in these clients. Infection with both MG-WT and MG-MRAM could be due to infections by different strains, or with the same strain that acquired MRAM on one of the locations. Others reported that MG gains de novo resistance mutations–a change from antibiotic-susceptible before treatment to antibiotic-resistant after treatment–in approximately 12% of the cases [26]. If this is true, it is important to test for MG-MRAM in clients at various anatomical locations in order to prescribe the correct treatment if treatment would aim at eliminating MG at possible infection sites, including the anus. However, more research is needed into the spread of azithromycin resistant MG and into the additional value of treating anal infections.

In our view testing solely for the presence of MG is not sufficient to prescribe proper treatment and an additional test for MRAM should be performed. This will help to guide therapy for the individual symptomatic client and prevent further spread of resistant MG. Our newly developed MG-MRAM qPCR can contribute to this due to its high specificity and sensitivity, and can be used for routine diagnostics.

Mycoplasma Genitalium (MG) detection by different molecular techniques and according to anatomical location.

(DOCX)

Click here for additional data file.

Comparison of MG-MRAM qPCR and sequencing analysis to detect MRAM in MG.

(DOCX)

Click here for additional data file.

Prevalence of mutant MG (MG-MRAM) as percentage of typeable samples according to different client characteristics separately for men and women.

(DOCX)

Click here for additional data file.

7 Aug 2020

PONE-D-20-21812

Evaluating the prevalence of and risk factors for macrolide resistance in Mycoplasma genitalium using a newly developed qPCR assay

PLOS ONE

Dear Dr. Braam,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Sep 21 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Prof Remco PH Peters, MD, PhD,

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Please provide additional details regarding participant consent. In the ethics statement in the Methods and online submission information, please ensure that you have specified (1) whether consent was informed and (2) what type you obtained (for instance, written or verbal, and if verbal, how it was documented and witnessed). If your study included minors, state whether you obtained consent from parents or guardians. If the need for consent was waived by the ethics committee, please include this information.

If you are reporting a retrospective study of medical records or archived samples, please ensure that you have discussed whether all data were fully anonymized before you accessed them and/or whether the IRB or ethics committee waived the requirement for informed consent. If patients provided informed written consent to have data from their medical records used in research, please include this information

3. Thank you for including your funding statement; "For this research we received part of the diagnostic tests to detect MG from Hologic Inc, San Diego, USA."

Please confirm that this does not alter your adherence to all PLOS ONE policies on sharing data and materials, by including the following statement: "This does not alter our adherence to  PLOS ONE policies on sharing data and materials.” (as detailed online in our guide for authors http://journals.plos.org/plosone/s/competing-interests).  If there are restrictions on sharing of data and/or materials, please state these. Please note that we cannot proceed with consideration of your article until this information has been declared.

Please include your updated Competing Interests statement in your cover letter; we will change the online submission form on your behalf.

Please know it is PLOS ONE policy for corresponding authors to declare, on behalf of all authors, all potential competing interests for the purposes of transparency. PLOS defines a competing interest as anything that interferes with, or could reasonably be perceived as interfering with, the full and objective presentation, peer review, editorial decision-making, or publication of research or non-research articles submitted to one of the journals. Competing interests can be financial or non-financial, professional, or personal. Competing interests can arise in relationship to an organization or another person. Please follow this link to our website for more details on competing interests: http://journals.plos.org/plosone/s/competing-interests

4. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The manuscript reports on the prevalence and risk factors for macrolide resistance in Mycoplasma genitalium using a newly developed qPCR in the Netherlands. Using the new qPCR assay, high rates of MG-MRAM (66.3%) were detected. The manuscript also describes an important new diagnostic PCR assay to detect MG-MRAM in patients.

Major comments

1. The manuscript reports the MG-MRAM qPCR assay has a sensitivity of 98.6% and specificity of 94.1% to detect MG-MRAM compared to sequencing analysis. However, the authors only sequenced a convenience set of 126/309 (41%) MG-MRAM detected by qPCR which is problematic. It would be better if the authors had performed sequencing analysis on all the samples typable with MG-MRAM qPCR instead of the convenience sample set to give a more accurate sensitivity and specify of the new MG-MRAM qPCR assay.

2. The characteristics of the study population including the inclusion/exclusion criteria must be included. This would help clarify the following statements:

• Line 91-92: why anal samples where not collected from all female participants?

• Line 187: how many males and females were recruited?

• Line 190: how many heterosexual males and men who have sex with men were recruited?

3. Table 2: It would be useful to provide a breakdown of the following specimens; urines (MSM and heterosexual males) and anal samples (MSM and women).

4. Limitations of the present study should be indicated.

5.Mentioning Mycoplasma genitalium macrolide resistance associated mutations (MG-MRAM) instead of "mutant MG" throughout the manuscript will help eliminate the confusion since only macrolide resistance associated mutations were investigated in the present study. “Mutant MG” could also suggest other mutations e.g. quinolone resistance associated mutations in MG.

Minor comments

Line 1: Delete “of” the title should read “Evaluating the prevalence and risk factors for macrolide resistance in Mycoplasma genitalium using a newly developed qPCR assay”

Line 73: specify E.coli numbering for nucleotide positions

Line 121: correct to “each primer”

Line 156: correct to “MEGA (version M6.0.6)”

Table 2: column “Hetero male” should read “Heterosexual male”

References: “Mycoplasma genitalium”, “Trichomonas vaginalis”, “Chlamydia trachomatis” and “Neisseria gonorrhoeae” should be in italics

Reviewer #2: The authors described a new qPCR method for detection of macrolide resistant M. genitalium (MG) and used this method to investigate the prevalence and possible risk factors for mutant MG. The new method was validated against the sequencing data and MgPa PCR. Considering the rapidly increasing macrolide resistance in MG, this study provided another new tool to detect the mutant strains and would assist to improve the treatment of MG infections.

The study was based on a big starting sample size (3225). However, the new method was only applied to the “known” positive samples by Hologic MG-TMA assay. If this method is to be used as a “secondary” test just for detection mutations after the Hologic-TMA assay, it is probably fine. If it will be used for MG detection and simultaneous mutant identification, then additional validation on MG negative samples is needed.

Some minor comments:

1. “Clients” was used in most places in this manuscript, while “patients” was also appeared. Whether this is a cultural difference or not, it’s better to keep consistent.

2. Line 108. Please specify the nucleic acid was DNA.

3. Line 151. How to define the “convenience set of 126 samples”? Does it mean random selection?

4. Line 295-299. “That a …MG-MRAM qPCR”. Please rephrase this sentence.

5. Line 330-333. Please discuss/explain the non-significance of the factors after the multivariable logistic regression analysis.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

1 Oct 2020

Amsterdam, September 16th 2020

Re.: Revision PONE-D-20-21812

Dear Professor Peters,

Please find our revised manuscript entitled ‘Evaluating the prevalence and risk factors for macrolide resistance in Mycoplasma genitalium using a newly developed qPCR assay’ by Joyce F. Braam, David J. Hetem, Clarissa E. Vergunst, Sophie Kuizenga Wessel, Martijn S. van Rooijen, Roel H.T. Nijhuis, Maarten F. Schim van der Loeff, Alje P. van Dam and Sylvia M. Bruisten for publication in PLOS ONE.

We have revised the manuscript in accordance with your comments and those of the reviewers. For convenience we have added a version of our revised manuscript with all changes marked (labelled: Revised Manuscript with Track Changes) as well as a clean version (labelled: Manuscript). Please find below a point-by-point reply to all suggestions. The line-numbers are according to the Revised Manuscript with Track Changes.

On behalf of all authors I would like to thank the reviewers for their critical comments and suggestions and we hope that the revised version of our manuscript is acceptable for publication in PLOS ONE.

Yours Sincerely,

Joyce F. Braam

Public Health Service Amsterdam

Nieuwe Achtergracht 100

1018 WT Amsterdam

The Netherlands

E-mail: jbraam@ggd.amsterdam.nl

Point-by-point reply to the Journal Requirements:

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf

and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

Response: We indeed used PLOS ONE’s style requirements for the revised manuscript.

2. Please provide additional details regarding participant consent. In the ethics statement in the Methods and online submission information, please ensure that you have specified (1) whether consent was informed and (2) what type you obtained (for instance, written or verbal, and if verbal, how it was documented and witnessed). If your study included minors, state whether you obtained consent from parents or guardians. If the need for consent was waived by the ethics committee, please include this information.

If you are reporting a retrospective study of medical records or archived samples, please ensure that you have discussed whether all data were fully anonymized before you accessed them and/or whether the IRB or ethics committee waived the requirement for informed consent. If patients provided informed written consent to have data from their medical records used in research, please include this information.

Response: All data were fully anonymized by the clinics’ data managers prior to release to the researchers. The samples that were provided for diagnostic testing could be used for this study; none of these clients had opted out of having their samples stored and possibly re-used after anonymization for research purposes. The Medical Ethics Committee of the Academic Medical Center in Amsterdam (letter reference no. W18.013#18.024) therefore waived the requirement for informed consent of the patients.

This is now also stated more clearly in the manuscript in the paragraph ‘Ethics statement’ (page 12).

3. Thank you for including your funding statement; "For this research we received part of the diagnostic tests to detect MG from Hologic Inc, San Diego, USA."

Please confirm that this does not alter your adherence to all PLOS ONE policies on sharing data and materials, by including the following statement: "This does not alter our adherence to PLOS ONE policies on sharing data and materials.” (as detailed online in our guide for authors http://journals.plos.org/plosone/s/competing-interests). If there are restrictions on sharing of data and/or materials, please state these. Please note that we cannot proceed with consideration of your article until this information has been declared.

Response: There are no restrictions on sharing of data or materials and we have added the statement to our revised article. See ‘Funding’, page 26.

Please include your updated Competing Interests statement in your cover letter; we will change the online submission form on your behalf.

Response: We added the statement also in the cover letter.

Please know it is PLOS ONE policy for corresponding authors to declare, on behalf of all authors, all potential competing interests for the purposes of transparency. PLOS defines a competing interest as anything that interferes with, or could reasonably be perceived as interfering with, the full and objective presentation, peer review, editorial decision-making, or publication of research or non-research articles submitted to one of the journals. Competing interests can be financial or non-financial, professional, or personal. Competing interests can arise in relationship to an organization or another person. Please follow this link to our website for more details on competing interests: http://journals.plos.org/plosone/s/competing-interests

Response: There are no competing interests for any of the authors. This was already stated in the Transparency declaration on page 25.

4. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.

Response: The data that we meant is not a core part of the research being presented in our study, therefore we have now removed the phrase that refers to these data.

Point-by-point reply to the comments of reviewer 1

Major comments

The manuscript reports on the prevalence and risk factors for macrolide resistance in Mycoplasma genitalium using a newly developed qPCR in the Netherlands. Using the new qPCR assay, high rates of MG-MRAM (66.3%) were detected. The manuscript also describes an important new diagnostic PCR assay to detect MG-MRAM in patients.

1. The manuscript reports the MG-MRAM qPCR assay has a sensitivity of 98.6% and specificity of 94.1% to detect MG-MRAM compared to sequencing analysis. However, the authors only sequenced a convenience set of 126/309 (41%) MG-MRAM detected by qPCR which is problematic. It would be better if the authors had performed sequencing analysis on all the samples typable with MG-MRAM qPCR instead of the convenience sample set to give a more accurate sensitivity and specify of the new MG-MRAM qPCR assay.

Response: We agree with the reviewer that it would have been better if we would have sequenced all MG-MRAM detected by qPCR. However, since we did not make a specific selection of this subset, other than that they were positive in the MG PCR or MG-TMA, we hold that performing sequencing analysis on the remaining samples will not change our results: it would probably only lead to more narrow 95%CIs. Nevertheless, we now added a more specific description on how the set of samples for sequencing analysis was obtained.

Page 10, paragraph ’Sequencing analysis of 23SrRNA gene’:

“To confirm the mutation qPCR test results, a subset of 126 of the 309 samples (40.8%) that were typable with the MG-MRAM qPCR were used to perform sequencing analysis (Fig 1). In addition, also a subset of 33 MG-positive samples out of the total of 184 samples (17.9%) in which no MG was detected with the MG-MRAM qPCR was used for sequencing analysis (Fig 1), totaling 159 samples for sequencing analysis. For both subsets we selected samples that tested positive with the MgPa qPCR and had a Ct value of <36.”

Furthermore, we have now added the 95%CIs also in the abstract for clarification (lines 39-40).

2. The characteristics of the study population including the inclusion/exclusion criteria must be included. This would help clarify the following statements:

• Line 91-92: why anal samples where not collected from all female participants?

Response: The routine policy of the STI clinics in The Hague and in Amsterdam are different on collecting anal samples from females and we adhered to these local policies. In The Hague it is standard policy to test all women both vaginal and anal for STI. In Amsterdam women are only tested anally if they are categorized as being at risk for an anal STI (which is defined as: reported anal sex or anal symptoms, were notified for an STI, or reported to perform sex work). For clarification, we rephrased the text as follows:

Lines 95-98:

“Anal samples were taken from all females attending the STI clinic in The Hague, whereas in Amsterdam anal samples were taken only from females if they reported anal sex or anal symptoms, were notified for an STI, or reported to perform sex work – both according to the local STI clinic policy”.

• Line 187: how many males and females were recruited?

• Line 190: how many heterosexual males and men who have sex with men were recruited?

Response: We agree that the study population was not defined as clearly as possible and we added the following (lines 196-198):

“During the study period 445/3225 (13.8%) tested clients were positive for MG with the MG-TMA assay, of whom 1031 were MSM, 927 heterosexual men, 1249 women, 17 transgender people and the sexual orientation of 2 patients was unknown.”

(lines 199-202)

“From 402/445 clients positive for MG - of whom 182 were MSM, 66 heterosexual men and 154 women - samples were available for MgPa and MG-MRAM testingThe samples included 136 vaginal, 120 urine and 237 anal samples, totaling 493 samples (Fig 1).”

3. Table 2: It would be useful to provide a breakdown of the following specimens; urines (MSM and heterosexual males) and anal samples (MSM and women).

Response: We agree with the reviewer that it is more informative to further specify the specimens according to anatomical locations within hosts and we therefore changed Table 2 as suggested (see page 15).

4. Limitations of the present study should be indicated.

Response: We agree with the reviewer that the limitations could have been stated more clearly and we have changed the text accordingly. We also added the limitation concerning not sequencing all MgPa positive samples.

Page 24, last paragraph:

“This study has some limitations. First of all, we did not sequence all MG positive samples, but only a subset. Second, in our study we only included first test results and client information that was available from that STI clinic visit.”

5. Mentioning Mycoplasma genitalium macrolide resistance associated mutations (MG-MRAM) instead of "mutant MG" throughout the manuscript will help eliminate the confusion since only macrolide resistance associated mutations were investigated in the present study. “Mutant MG” could also suggest other mutations e.g. quinolone resistance associated mutations in MG.

Response: We agree with the reviewer and consistently replaced ‘mutant MG’ by ‘MG-MRAM’ throughout the manuscript.

Minor comments

Line 1: Delete “of” the title should read “Evaluating the prevalence and risk factors for macrolide resistance in Mycoplasma genitalium using a newly developed qPCR assay”

Response: Thank you for the suggestion, we changed the title accordingly.

Line 73: specify E. coli numbering for nucleotide positions

Response: We added Escherichia coli numbering to line 73-75 and the sentence now reads (page 5, line 73-75):

“These tests detect several mutations that are associated with macrolide resistance in the V-region of the 23S rRNA gene: A2058G, A2058T, A2058C, A2059G, and A2059C (Escherichia coli numbering) (10, 19).”

Line 121: correct to “each primer”

Response: We added ‘primer’ to line 124-127 and the sentence now reads:

“The assay consists of two multiplex qPCRs which use the same forward and reverse primers, 250 nM of each primer and three probes of 125nM each.”

Line 156: correct to “MEGA (version M6.0.6)”

Response: We agree with the reviewer that MEGA should be in capital letters and changed the text accordingly (page 10, line 164) .

Table 2: column “Hetero male” should read “Heterosexual male”

Response: Table 2 did not contain ‘hetero male’; but tables 3 and 4 did contain this term. We changed in both tables 3 and 4 ‘hetero male’ into ‘heterosexual male’

References: “Mycoplasma genitalium”, “Trichomonas vaginalis”, “Chlamydia trachomatis” and “Neisseria gonorrhoeae” should be in italics

Response: Indeed, as suggested by the reviewer, these species names in the references section are now noted in italics.

Point-by-point reply to the comments of reviewer 2

The authors described a new qPCR method for detection of macrolide resistant M. genitalium (MG) and used this method to investigate the prevalence and possible risk factors for mutant MG. The new method was validated against the sequencing data and MgPa PCR. Considering the rapidly increasing macrolide resistance in MG, this study provided another new tool to detect the mutant strains and would assist to improve the treatment of MG infections.

The study was based on a big starting sample size (3225). However, the new method was only applied to the “known” positive samples by Hologic MG-TMA assay. If this method is to be used as a “secondary” test just for detection mutations after the Hologic-TMA assay, it is probably fine. If it will be used for MG detection and simultaneous mutant identification, then additional validation on MG negative samples is needed.

Response: We thank the reviewer for these kind words. Indeed, the MG-MRAM qPCR is intended to be used after a sample tests positive for Mycoplasma genitalium (MG) in the Hologic MG-TMA assay but it could also be used in combination with any other assay that detects MG with sufficient sensitivity and specificity.

Minor comments

1. “Clients” was used in most places in this manuscript, while “patients” was also appeared. Whether this is a cultural difference or not, it’s better to keep consistent.

Response: We agree with the reviewer that consistency is important, and accordingly have replaced ‘patients’ by ‘clients’ throughout the manuscript.

2. Line 108. Please specify the nucleic acid was DNA.

Response: We have now specified in line 113 that the nucleic acid was deoxyribonucleic acid and also clarified in lines 114 till 117.

3. Line 151. How to define the “convenience set of 126 samples”? Does it mean random selection?

Response: The sample sets that we used for sequencing analysis have now been described more precisely:

Page 10, paragraph ’Sequencing analysis of 23SrRNA gene’:

“To confirm the mutation qPCR test results, a subset of 126 of the 309 samples (40.8%) that were typable with the MG-MRAM qPCR were used to perform sequencing analysis (Fig 1). In addition, also a subset of 33 MG-positive samples out of the total of 184 samples (17.9%) in which no MG was detected with the MG-MRAM qPCR was used for sequencing analysis (Fig 1), totaling 159 samples for sequencing analysis. For both subsets we selected samples that tested positive with the MgPa qPCR and had a Ct value of <36.”

4. Line 295-299. “That a …MG-MRAM qPCR”. Please rephrase this sentence.

Response: We agree with the reviewer that lines 295-299 were not clear and replaced the sentences as follows:

“That a substantial portion of MG positive samples was negative in both qPCR assays can be explained by the superior sensitivity of the MG-TMA assay. In TMA assays RNA molecules are detected, which are present in multiple copies per bacterium.” (line 308-311)

5. Line 330-333. Please discuss/explain the non-significance of the factors after the multivariable logistic regression analysis.

Response: We added an explanation of the non-significance of the factors in multivariable logistic regression analysis (page 24):

“We found a very high prevalence of MG-MRAM (66.3%), especially among men, clients with a higher education level, HIV-positive clients and clients with >10 recent sexual partners. In multivariable logistic regression none of these risk factors were significantly associated with MG-MRAM infections. This might be explained by the fact that MSM in this population report a higher education level, are more often HIV-positive and more often have >10 recent sexual partners. The observed prevalence of MG-MRAM is higher than previously reported in the Netherlands (20.9%-44.4%) (10-12). However, those studies included mainly hospital and primary care clients who were sampled some years ago, whereas our population consisted of clients visiting the STI clinic in urbanized regions in the Netherlands in 2018. In our population we had a relatively large group of MSM and HIV-positives and these groups had a relatively high prevalence of MG-MRAM. Thus treatment with azithromycin is possibly compromised in a majority of MG cases.”

Submitted filename: Response to Reviewers PLOS ONE - PONE-D-20-21812.docx

Click here for additional data file.

5 Oct 2020

Evaluating the prevalence and risk factors for macrolide resistance in Mycoplasma genitalium using a newly developed qPCR assay

PONE-D-20-21812R1

Dear Dr. Braam,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Remco PH Peters, MD, PhD

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

7 Oct 2020

PONE-D-20-21812R1

Evaluating the prevalence and risk factors for macrolide resistance in Mycoplasma genitalium using a newly developed qPCR assay

Dear Dr. Braam:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Prof Remco PH Peters

Academic Editor

PLOS ONE