Literature DB >> 33062701

Platelet-Rich Plasma Combined with Alendronate Reduces Pain and Inflammation in Induced Osteoarthritis in Rats by Inhibiting the Nuclear Factor-Kappa B Signaling Pathway.

Feng Xin1, Haihong Wang2, Feng Yuan3, Yunzhi Ding1.   

Abstract

PURPOSE: Osteoarthritis (OA) is one of the common degenerative diseases of the joint in the world. This study was designed to explore the effect of platelet-rich plasma (PRP) combined with alendronate (ALN) on OA.
METHODS: We induced OA model by anterior cruciate ligament transection (ACLT) method in rats and treating chondrocytes by IL-1β in vitro. PRP and/or ALN were used to treat induced rats and chondrocytes. Hematoxylin and eosin (H&E) and Safranin O staining were used to observe the structures of cartilage. The mRNA expression of Collagen II, MMP-13, and inflammatory factors (IL-18, IL-1β, and TNF-α) in the cartilage and chondrocytes of rats was determined by qRT-PCR. The expression of NF-κB pathway-related proteins (p-p65, p65, IκBα, and p-IκBα) in the cartilage and chondrocytes of rats was determined by Western blot. The proliferation of chondrocytes was detected by MTT assay.
RESULTS: Treatment with PRP, ALN, or PRP combined with ALN decreased the degree of cartilage destruction, the mRNA expression of MMP-13 and inflammatory factors (IL-18, IL-1β, and TNF-α), and the protein expression of p-IκBα/IκBα and p-p65/p65, increased Collagen II expression, and the threshold of tender and thermal pain in OA rats. Meanwhile, ALN, PRP, or ALN combined with PRP reversed the inhibiting effect of phorbol myristate acetate (PMA, an NF-κB agonist) on cell proliferation and cartilage matrix metabolism. Among them, the effects of ALN combined with PRP were most obvious.
CONCLUSION: PRP combined with ALN delayed OA progression by inhibiting the NF-κB signaling pathway.
Copyright © 2020 Feng Xin et al.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 33062701      PMCID: PMC7539111          DOI: 10.1155/2020/8070295

Source DB:  PubMed          Journal:  Biomed Res Int            Impact factor:   3.411


1. Introduction

Osteoarthritis (OA) is a kind of chronic joint disease that usually occurs in older people [1]. It is characterized by joint stiffness, persistent pain, and even disability, accompanied by varying degrees of inflammation and defects in articular cartilage [2]. The occurrence of OA is related to many factors such as aging, obesity, joint instability, and joint inflammation [3]. A research points out that more than 1/4 of the adult population is affected by OA, and the disease is the main cause of morbidity in people over 40 years old by the year 2020 [4]. At present, it mainly relieves symptoms by injecting lubricating supplements into the joint cavity or using topical nonsteroidal anti-inflammatory drugs, steroids, physical treatments, and so on [5]. However, current treatments can only alleviate pain and control inflammation but cannot reduce the degradation and destruction of articular cartilage [6]. Therefore, new treatment methods are urgently needed. Alendronate (ALN) has the effect of antibone resorption [7]. It is widely used in the treatment of osteoporosis, especially in postmenopausal osteoporosis in older women [8]. Shirai et al. [9] have found that ALN can improve the bone loss in subchondral bone; inhibit the expression of Matrix metallopeptidase 13 (MMP-13), Interleukin-1β (IL-1β), and vascular endothelial growth factor (VEGF) in cartilage; and prevent the degeneration of articular cartilage in rabbit model of OA. Platelet-rich plasmas (PRP) contain a lot of growth factors such as platelet-derived growth factor (PDGF), transforming growth factor-β (TGF-β), and epidermal growth factor (EGF) [10], and it is considered an option for the intra-articular treatment of OA [11]. Khatab et al. [12] have confirmed that multiple PRP injections reduce pain and synovial thickness in mice model of OA. In addition, Chen et al. [13] have found that hyaluronic acid (HA) combined with PRP can promote cartilage regeneration and inhibit inflammation in mice model of OA. However, the potential effects of PRP combined with ALN in OA are still unclear. A large number of studies have confirmed that the development of OA is regulated by multiple signaling pathways such as Wnt/β-catenin [14], PI3K/AKT [15], and Nuclear factor-kappa B (NF-κB) signaling pathways [16]. Several studies have shown that the abnormal and continuous activation of NF-κB signaling pathway is related to osteoarthritis. For example, Hu et al. [17] found that the expression of the NF-κB signaling pathway-related proteins (IKKα, IKKβ, IκBα, NF-κB p65) were upregulated in the joint cartilage tissues of rats with OA. A study by Piao et al. [18] has indicated that Protectin DX suppresses inflammation in chondrocytes and ameliorates osteoarthritis progression through the AMPK/NF-κB signaling pathway in a rat model of OA. However, the specific regulatory relationship between PRP combined with ALN and NF-κB signaling pathway remains undefined in OA. The aim of the present work is to study the effects of PRP combined with ALN on the pathology, inflammation, and matrix metabolism in rat model of OA in vivo, and on the proliferation and matrix metabolism of IL-1β-induced chondrocytes in vitro. In addition, the possible action mechanism of PRP combined with ALN involving the NF-κB signaling pathway was also analyzed. Our findings may provide a theoretical basis of PRP combined with ALN in the treatment of OA.

2. Methods

2.1. Preparation of Platelet-Rich Plasma

PRP was separated from rat blood. Briefly, Sprague-Dawley (SD) rats (n = 10, Shanghai SLAC Laboratory Animal Co., Ltd, Shanghai, China) were anesthetized with 3% pentobarbital sodium (30 mg/Kg); then, intracardiac whole blood sample (7-8 ml) was collected from every rat by sterile syringe with acid-citrate dextrose solution. Subsequently, the blood samples were centrifuged at 150 g for 10 min at room temperature. After the first centrifugation, the supernatant and platelet layer cells were centrifuged at 1500 g for 10 min. After the second centrifugation, the supernatant of the 3/4 upper of the centrifuge tube was discarded, and the remaining liquid was shaken evenly to obtain PRP. The number of platelets in the isolated PRP was about 1.0 × 109-2.0 × 109/mL. The PRP samples were stored in a refrigerator at -80°C.

2.2. Induction of Rat Models of OA

A total of 25 SD rats were randomly divided into Control (without any treatment), OA (osteoarthritis model), PRP (osteoarthritis induced rats were injected with 50 μl PRP), ALN (osteoarthritis induced rats were injected with ALN (2.4 μg/kg, Sigma-Aldrich, St. Louis, MO, USA)), and PRP + ALN (osteoarthritis induced rats were injected with 50 μl PRP and 2.4 μg/kg ALN) groups (N = 5 each group). Rat models of OA were induced using the method of anterior cruciate ligament transection (ACLT) as previous study described [19, 20]. One month after modeling, PRP, ALN, and PRP combined with ALN were injected into the knee of rats once a week for 4 weeks. Twenty-four hours after the last administration, all rats were killed after intraperitoneal injection of pentobarbital sodium, and then, the knee joints of rats were collected for the subsequent tests. All animal experiments were approved by the Animal Care and Use Committee of our hospital.

2.3. The Measurement of Tenderness Threshold in Rats

Four weeks after administration, the tenderness threshold of rats was measured by electronic tenderness instrument (YLS-3E, Huaibei Zhenghua biological instrument equipment Co., Ltd, Huaibei, China). During the measurement, the rats were put into a fixed barrel to keep them in a comfortable and fixed state. The flat head of the tenderness instrument was used to press the back of both hind feet of the rats. When the rats whined or struggled due to the pain, the pressure value displayed was the tenderness threshold (pressure: g).

2.4. The Measurement of Thermal Pain Threshold in Rats

Six hours after the measurement of the tenderness threshold, the threshold of tender thermal pain in rats was measured by the plantar test instrument (Ugo Basile 37370, Italy). The rats were placed in a transparent plexiglass box at room temperature. After the rats were quiet (stop combing and exploratory activities), the infrared light irradiated the hind foot of rats through glass plate. When the rats raised their legs to avoid heat, the time was the thermal pain threshold (time: second). Each rat was measured 3 times, with an interval of 5-6 min, and the average value was taken.

2.5. Histological Analysis

Articular cartilages of rats were fixed in 4% paraformaldehyde for 48 h and decalcified in 10% ethylene diamine tetraacetic acid (EDTA) solution for 4 weeks, then dehydrated by ethanol solution. Next, the tissues were embedded in paraffin and cut into sections (5 μm). After that, the sections were stained with hematoxylin and eosin (H&E) or safranin-O and fast green for histological assessment. The images of stained sections were taken under a microscope (Model IX71 Olympus, Tokyo, Japan). Based on safranin-O staining, Osteoarthritis Research Society International (OARSI) [21] and Mankin scoring systems [22] were used to determine the extent of cartilage degeneration as described previously.

2.6. Quantitative Real-Time Polymerase Chain Reaction (PCR) (RT-qPCR) Analysis

The total RNA of rat cartilage was extracted by Trizol reagent (Invitrogen, USA). According to the manufacturer's protocol of PrimeScript RT Master Mix (Takara Biotechnology Co., Ltd, Japan), total RNA was used to synthesize cDNA. Subsequently, we used ABI7500 real-time PCR instrument (Applied Biosystems, Waltham, MA, USA) to carry out qRT-PCR experiment. The reaction conditions were as follows: 95°C for 10 min (predenaturation), 40 cycles of 95°C for 15 s (denaturation), and 60°C for 30 s (annealing). The primers (Table 1) of qRT-PCR were synthesized by Invitrogen. The relative mRNA expression was analyzed by 2- method, and β-actin was the reference gene.
Table 1

The sequences of primers.

PrimersSequences(5′-3′)
IL-1β-FCTTCAGGCAGGCAGTATCACTC
IL-1β-RTGCAGTTGTCTAATGGGAACGT
IL-18-FGCCTCAAACCTTCCAAATCA
IL-18-RTGGATCCATTTCCTCAAAGG
TNF-α-FCGAGTGACAAGCCTGTAGCCC
TNF-α-RGTCTTTGAGAT CCATGCCGTTG
MMP-13-FTCCTCTTCTTGAGCTGGACTC
MMP-13-RGTTCCAGCCACGCATAGTCAT
Collagen II-FGCACCCATGGACATTGGAGG
Collagen II-RAGCCCCGCACGGTCTTGCTT
β-Actin-FGTATGCCTCGGTCGTACCA
β-Actin-RCTTCTG CATCCTGTCAGCAA

2.7. Western Blot Analysis

According to the instructions of ProteoPrep® Total Extraction Sample Kit (Thermo Fisher Scientific, Waltham, MA, USA), the total protein in cells and cartilages of rats was extracted. The protein concentration was determined by BCA Kit (Wuhan Boster Biotechnology Co., Ltd., Wuhan, China). Protein samples (30 μg) were separated by 10% sodium dodecyl sulfate-Polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred into polyvinylidene fluoride (PVDF) membrane (Thermo Fisher Scientific). The membranes were incubated with blocking buffer (5% skim milk) for 2 h at room temperature and then incubated with the primary antibody (p-p65, 3033; p65, 8242; IκBα, 4814; p-IκBα, 2859; GAPDH, 5174; 1 : 1000, Cell Signaling Technology, USA; GAPDH as internal control) overnight at 4°C. Subsequently, the membranes were incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit (1: 4000; Shanghai MiaoTong Biotechnology Co., Ltd, Shanghai, China) for 2 h. Protein bands were visualized according to the instructions of efficient chemiluminescence (ECL) kit (Thermo Fisher Scientific) and analyzed with the Image LabTM Software (Bio-Rad, USA).

2.8. Chondrocyte Isolation and Culture

SD rats were killed after intraperitoneal injection of pentobarbital sodium, and then, the articular cartilage tissues were collected from knees of rats. The cartilage tissues were washed with PBS for 2 times and cut into sections (4 mm). Then, the sections were treated with 0.2% collagenase II for 4 h. The isolated chondrocytes were cultured in Dulbecco's modified eagle media (DMEM) containing 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin in an incubator at 37°C under 5% CO2. All experiments were performed on the second passage of chondrocytes.

2.9. Grouping and Treatment of Chondrocytes

The chondrocytes were starved with serum-free DMEM/F12 medium for 12 hours to synchronize the cells. The chondrocytes were divided into Control (chondrocytes without any treatment), IL-1β (chondrocytes were treated with 10 ng/ml IL-1β), IL-1β + ALN (chondrocytes were treated with 10 ng/ml IL-1β and 1 μg/ml ALN), IL-1β + PRP (chondrocytes were treated with 10 ng/ml IL-1β and 10% volume/total volume of PRP), IL-1β + ALN + PRP (chondrocytes were treated with 10 ng/ml IL-1β, 1 μg/ml ALN and 10% volume/total volume of PRP), IL-1β + PMA (chondrocytes were treated with 10 ng/ml IL-1β and 50 μM phorbol myristate acetate (PMA, an NF-κB agonist)), IL-1β + ALN + PMA (chondrocytes were treated with 10 ng/ml IL-1β, 1 μg/ml ALN and 50 μM PMA), IL-1β + PRP + PMA (chondrocytes were treated with 10 ng/ml IL-1β, 10% volume/total volume of PRP and 50 μM PMA), and IL-1β + ALN + PRP + PMA (chondrocytes were treated with 10 ng/ml IL-1β, 1 μg/ml ALN, 10% volume/total volume of PRP and 50 μM PMA). After treatment for 24 h, chondrocytes were used for subsequent experiments.

2.10. Cell Viability Assay

The proliferation of chondrocytes was detected by MTT assay. Briefly, chondrocytes (6 × 103) were seeded into 96-well plates. After treatment for 24 h, chondrocytes were incubated with 20 μl MTT solution (5 mg/ml, Sigma) for 4 h in the incubator. Next, chondrocytes were incubated with 150 μl dimethylsulfoxide (DMSO) for 10 min. The absorbance value of chondrocytes was measured at 450 nm by the microplate reader (Molecular Devices, CA, USA).

2.11. Statistical Analysis

The data were expressed as mean ± standard deviation. The SPSS 23.0 statistical software (SPSS, Inc., Chicago, IL, USA) was used for statistical analysis. One-way analysis of variance (ANOVA) with Tukey posttest was used for comparison between multiple groups. P < 0.05 suggested that the difference was statistically significant.

3. Results

3.1. PRP Combined with ALN Delays the Progression of OA Rats

In order to investigate the effects of platelet rich-plasma and alendronate in OA progression, we established the OA model by ACLT surgical process in rat. H&E and Safranin O staining were used to observe the morphology of cartilage. As shown in Figure 1(a), the degree of cartilage destruction and surface loss in the OA group were more serious than that of the Control group, while treatment of PRP or ALN (ALN, PRP group) decreased the degree of cartilage destruction and surface loss compared with the OA group. Notably, cartilage surface was obviously recovered in ALN + PRP group compared with the ALN and PRP group. In addition, the results of Mankin and OARSIS score (Figures 1(b) and 1(c)) showed that the Mankin and OARSIS score of the OA group were higher than that of the Control group (P < 0.01), while the Mankin and OARSIS score of the ALN and PRP group were decreased compared with the OA group (P < 0.05). Upon treatment with ALN and PRP (ALN + PRP group), the Mankin and OARSIS score were lower than that of the ALN and PRP group (P < 0.05). We also examined the threshold of tender and thermal pain in rats. The results (Figures 1(d) and 1(e)) showed that the threshold of tender and thermal pain in the OA group was lower than that of the Control group (P < 0.05), while the threshold of tender and thermal pain in the ALN and PRP group was increased compared with the OA group (P < 0.01). Moreover, the threshold of tender and thermal pain in the ALN + PRP group was higher than that of the ALN and PRP group (P < 0.05).
Figure 1

Platelet-rich plasma (PRP) combined with alendronate (ALN) delayed the progression of osteoarthritis (OA) in rat. (a) Representative histologic pictures of hematoxylin and eosin (H&E) and Safranin O staining (Scale bar, 200 mm). (b) The Mankin score of rat cartilages. (c) The OARIS score of rat cartilages. (d) The tender threshold of rats. (e) The thermal pain threshold of rats. Control, rats without any treatment. ∗∗P < 0.01 compared with the Control group. #P < 0.05 and ##P < 0.01 compared with the OA group. &&P < 0.01 compared with the ALN group. $P < 0.05, $$P < 0.01 compared with the PRP group.

3.2. PRP Combined with ALN Inhibits the Expression of Inflammatory Factors and Improves Cartilage Matrix Metabolism in OA Rats

The mRNA expression of Collagen II, MMP-13, and inflammatory factors (IL-18, IL-1β, and TNF-α) in the cartilage of rats was determined by qRT-PCR. As shown in Figures 2(a)–2(e), compared with the Control group, the mRNA expression of MMP-13 and inflammatory factors (IL-18, IL-1β, and TNF-α) in OA group was upregulated (P < 0.01), while the mRNA expression of Collagen II was downregulated (P < 0.01). Compared with the OA group, the mRNA expression of MMP-13 and inflammatory factors (IL-18, IL-1β, and TNF-α) in the ALN and PRP group was decreased (P < 0.01), while the mRNA expression of Collagen II was increased (P < 0.01). Notably, the mRNA expression of MMP-13 and inflammatory factors (IL-18, IL-1β, and TNF-α) in the ALN + PRP group was lower than that of the ALN and PRP group, and the mRNA expression of Collagen II showed the opposite trend.
Figure 2

PRP combined with ALN inhibited the expression of inflammatory factors and improved cartilage matrix metabolism in osteoarthritis (OA) rats. The mRNA expression of IL-1β (a), IL-18 (b), TNF-α (c), Collagen II (d), and MMP-13 (e) in cartilage of rats was determined by qRT-PCR. ∗∗P < 0.01 compared with the Control group. #P < 0.05 and ##P < 0.05 compared with the OA group. &&P < 0.01 compared with the ALN group. $P < 0.05 and $$P < 0.01 compared with the PRP group.

3.3. PRP Combined with ALN Inhibits NF-κB Signaling Pathway in OA Rats

The protein expression of NF-κB signaling pathway-related proteins (p-p65, p65, IκBα, and p-IκBα) in the cartilage of rats was determined by Western blot. As shown in Figure 3, compared with the Control group, the protein expression of p-IκBα/IκBα and p-p65/p65 in OA group was increased (P < 0.01). Compared with the OA group, the protein expression of p-IκBα/IκBα and p-p65/p65 in the ALN and PRP group was decreased (P < 0.01). Notably, the protein expression of p-IκBα/IκBα and p-p65/p65 in the ALN + PRP group was lower than that of the ALN and PRP group (P < 0.01).
Figure 3

PRP combined with ALN inhibited inhibits NF-κB signaling pathway in osteoarthritis (OA) rats. The protein expression of NF-κB signaling pathway-related proteins (p-p65, p65, IκBα, and p-IκBα) in the cartilage of rats was determined by Western blot. ∗∗P < 0.01 compared with the Control group. ##P < 0.05 compared with the OA group. &&P < 0.01 compared with the ALN group. $$P < 0.01 compared with the PRP group.

3.4. PRP Combined with ALN Promotes Cell Proliferation, Improves Cartilage Matrix Metabolism, and Inhibits NF-κB Signaling Pathway in Rat Chondrocytes

After assessing the protective effects of PRP and ALN on OA rats, we further investigated the effects of PRP and ALN on chondrocytes in vitro. The proliferation of rat chondrocytes was detected by MTT assay. The results (Figure 4(a)) showed that IL-1β treatment decreased the chondrocyte viability compared with the Control group (P < 0.01), but ALN or PRP treatment enhanced the chondrocyte viability compared with the IL-1β group (P < 0.05). Notably, the chondrocyte viability in the ALN + PRP group was higher than that of the ALN and PRP group (P < 0.05). In addition, the mRNA expression of Collagen II and MMP-13 in the rat chondrocytes was determined by qRT-PCR. As presented in Figure 4(b) and 4(c), compared with the Control group, the mRNA expression of MMP-13 was increased, and Collagen II was decreased in the IL-1β group (P < 0.01), while ALN or PRP treatment could decrease MMP-13 expression and increase Collagen II expression compared with the IL-1β group (P < 0.05). In addition, the mRNA expression of MMP-13 in the IL-1β + ALN + PRP group was lower than that of the IL-1β + ALN and IL-1β + PRP group (P < 0.01), and Collagen II showed the opposite trend. The protein expression of NF-κB signaling pathway-related proteins (p-p65, p65, IκBα, and p-IκBα) in the rat chondrocytes was determined by Western blot. As seen in Figure 4(d), compared with the Control group, the protein expression of p-IκBα/IκBα and p-p65/p65 in the IL-1β group was increased (P < 0.01). Compared with the IL-1β group, the protein expression of p-IκBα/IκBα and p-p65/p65 in the IL-1β + ALN and IL-1β + PRP group was decreased (P < 0.05). Notably, the protein expression of p-IκBα/IκBα and p-p65/p65 in the IL-1β + ALN + PRP group was lower than that of the IL-1β + ALN and IL-1β +PRP group (P < 0.01).
Figure 4

PRP combined with ALN promoted cell proliferation, improved cartilage matrix metabolism, and inhibited NF-κB signaling pathway in rat chondrocytes. (a) The proliferation of rat chondrocytes was detected by MTT assay. (b, c) The mRNA expression of Collagen II and MMP-13 in the rat chondrocytes was determined by qRT-PCR. (d) The protein expression of NF-κB signaling pathway-related proteins (p-p65, p65, IκBα, and p-IκBα) in the rat chondrocytes was determined by Western blot. ∗P < 0.05 and ∗∗P < 0.01 compared with the Control group. ##P < 0.05 and #P < 0.01 compared with the OA group. &&P < 0.01 compared with the ALN group. $P < 0.05 and $$P < 0.01 compared with the PRP group.

3.5. PRP Combined with ALN Promotes Cell Proliferation and Improves Cartilage Matrix Metabolism via NF-κB Signaling Pathway

In the light of the above results, rat chondrocytes in the IL-1β group were treated with PMA (an NF-κB agonist) to detect whether PRP and ALN affects cell proliferation and cartilage matrix metabolism through NF-κB pathway in chondrocytes. As shown in Figure 5(a), the protein expression of p-IκBα/IκBα and p-p65/p65 in the IL-1β + PMA group was significantly increased compared with the IL-1β (P < 0.01), but treatment with PRP, ALN, or PRP combined with ALN reversed the protein expression of p-IκBα/IκBα and p-p65/p65 induced by PMA. Among them, the reverse effect of PRP combined with ALN was the most obvious. Moreover, treatment with PRP combined with ALN also significantly reversed the inhibiting effect of PMA on cell proliferation and cartilage matrix metabolism (Figures 5(b)–5(d)).
Figure 5

PRP combined with ALN promoted cell proliferation, inhibited apoptosis, and improved cartilage matrix metabolism via NF-κB signaling pathway in rat chondrocytes. (a) The protein expression of NF-κB signaling pathway-related proteins (p-p65, p65, IκBα, and p-IκBα) in rat chondrocytes was determined by Western blot. (b) The proliferation of rat chondrocytes was detected by MTT assay. (c, d) The mRNA expression of Collagen II and MMP-13 in the rat chondrocytes was determined by qRT-PCR. ∗P < 0.05 and ∗∗P < 0.01 compared with the IL-1β group. ##P < 0.05 and #P < 0.01 compared with the IL-1β + PMA group. &P < 0.05 and &&P < 0.01 compared with the IL-1β + ALN + PMA group. $P < 0.05 and $$P < 0.01 compared with the IL-1β + PRP + PMA group.

4. Discussion

Osteoarthritis (OA) is a common degenerative disease of the joint that is characterized by the destruction of articular cartilage [23]. The platelets and growth factors in PRP are the basis of PRP for cartilage regeneration [24]. ALN can protect cartilage by inhibiting the expression of matrix metalloproteinase and the reconstruction of subchondral bone [25]. In the present study, we found that PRP combined with ALN delayed the progression of OA in rats through inhibiting inflammation and improving cartilage matrix metabolism. In addition, PRP combined with ALN promoted cell proliferation and improved cartilage matrix metabolism via inhibiting NF-κB signaling pathway in rat chondrocytes. In animal model and patients with OA, the abnormal expression of inflammatory cytokines (such as IL-18, IL-1β, and TNF-α) can always be observed [17, 26]. A prior study has confirmed that PRP reduces the levels of inflammatory cytokines (IL-1β and TNF-α) and the severity of degenerative changes in cartilage of rabbit with OA [27]. Mankin score is a well-recognized authoritative method to evaluate the degree of cartilage injury [22]. Acar et al. [28] have shown that ALN injection decreased the Mankin score in an ovariectomized mouse model of OA, suggesting ALN treatment has a chondroprotective effect on articular cartilage. In addition, Khatab et al. [12] have suggested that PRP injection relieved pain in a mouse model of OA. In this study, treatment with ALN, PRP, or ALN combined with PRP reduced the Mankin and OARSIS scores, decreased the thresholds of tender and thermal pain, and downregulated the mRNA expression of inflammatory factors (IL-18, IL-1β, and TNF-α) in the cartilage of rats. All the above findings suggested that PRP combined with ALN inhibited the inflammation and delayed the progression of OA in rats. Collagen II and MMPs are potential targets for the treatment of OA. Inhibition of Collagen II degradation reduces the pathological changes of OA [29]. Inhibition of MMP-13 activity maintains the extracellular matrix structure of cartilage and reduces morphological damage [30]. Zhu et al. [31] have found that the expression of MMP-9 and MMP-13 in rat cartilage and subchondral bone was inhibited by ALN treatment. Yin et al. [24] have confirmed that pure PRP treatment increased the mRNA expression of Collagen II in human articular chondrocytes. In agreement with the previous studies, we found that treatment with ALN, PRP, or ALN combined with PRP decreased MMP-13 expression and increased Collagen II expression in the cartilage tissue and chondrocytes of rats. Briefly, these findings indicated that PRP combined with ALN improved cartilage matrix metabolism in OA. NF-κB signaling pathway plays an important regulatory role in the occurrence and development of OA through maintaining the chondrocyte phenotype and balancing cartilage matrix metabolism [1, 32, 33]. Xue et al. [34] have confirmed that LDC067 exerted protective effects in OA by inhibiting the NF-κB signaling pathway. Wu et al. [35] have reported that sinomenine inhibited the IL-1β-induced inflammatory response and cartilage destruction in mouse chondrocytes through inhibiting the NF-κB signaling pathway. Wang et al. [36] have found that curcumin regulated the expression of collagen II and MMP-13 and cell proliferation in IL-1β-induced chondrocytes by suppressing the NF-κB signaling pathway. In the present study, treatment with ALN, PRP, or ALN combined with PRP reduced the protein expression of p-IκBα/IκBα and p-p65/p65 in the cartilage and chondrocytes of rats and reversed the inhibiting effects of PMA on cell proliferation and cartilage matrix metabolism. The above findings indicated that PRP combined with ALN might inhibit NF-κB signaling pathway to regulate cell proliferation and cartilage matrix metabolism in OA.

5. Conclusions

In conclusion, PRP combined with ALN inhibited inflammatory factors and NF-κB signaling pathway, improved cartilage matrix metabolism, and delayed the progression of OA in rats. Moreover, PRP combined with ALN promoted cell proliferation and improved cartilage matrix metabolism via inhibiting NF-κB signaling pathway in rat chondrocytes. PRP combined with ALN may be a useful candidate for OA treatment.
  36 in total

1.  The reliability of the Mankin score for osteoarthritis.

Authors:  J A van der Sluijs; R G Geesink; A J van der Linden; S K Bulstra; R Kuyer; J Drukker
Journal:  J Orthop Res       Date:  1992-01       Impact factor: 3.494

2.  Controlling joint instability delays the degeneration of articular cartilage in a rat model.

Authors:  K Murata; N Kanemura; T Kokubun; T Fujino; Y Morishita; K Onitsuka; S Fujiwara; A Nakajima; D Shimizu; K Takayanagi
Journal:  Osteoarthritis Cartilage       Date:  2016-10-15       Impact factor: 6.576

3.  Intra-articular Injections of Platelet-Rich Plasma Releasate Reduce Pain and Synovial Inflammation in a Mouse Model of Osteoarthritis.

Authors:  Sohrab Khatab; Gerben M van Buul; Nicole Kops; Yvonne M Bastiaansen-Jenniskens; P Koen Bos; Jan A Verhaar; Gerjo J van Osch
Journal:  Am J Sports Med       Date:  2018-01-26       Impact factor: 6.202

4.  The burden of osteoarthritis: clinical and quality-of-life issues.

Authors:  Roland W Moskowitz
Journal:  Am J Manag Care       Date:  2009-09       Impact factor: 2.229

5.  Protectin DX attenuates IL-1β-induced inflammation via the AMPK/NF-κB pathway in chondrocytes and ameliorates osteoarthritis progression in a rat model.

Authors:  Shang Piao; Wei Du; Yingliang Wei; Yue Yang; Xinyuan Feng; Lunhao Bai
Journal:  Int Immunopharmacol       Date:  2019-12-11       Impact factor: 4.932

6.  Regulation of type II collagen, matrix metalloproteinase-13 and cell proliferation by interleukin-1β is mediated by curcumin via inhibition of NF-κB signaling in rat chondrocytes.

Authors:  Jian Wang; Jie Ma; Jian-Hua Gu; Fu-Yong Wang; Xiu-Shuai Shang; Hai-Rong Tao; Xiang Wang
Journal:  Mol Med Rep       Date:  2017-06-14       Impact factor: 2.952

7.  Comparative evaluation of the effects of platelet‑rich plasma formulations on extracellular matrix formation and the NF‑κB signaling pathway in human articular chondrocytes.

Authors:  Wenjing Yin; Haitao Xu; Jiagen Sheng; Zhengliang Xu; Xuetao Xie; Changqing Zhang
Journal:  Mol Med Rep       Date:  2017-03-23       Impact factor: 2.952

8.  Therapeutic efficacy of intra-articular hyaluronan derivative and platelet-rich plasma in mice following axial tibial loading.

Authors:  Xin Duan; Linda J Sandell; Nobuaki Chinzei; Nilsson Holguin; Matthew J Silva; Antonella Schiavinato; Muhammad Farooq Rai
Journal:  PLoS One       Date:  2017-04-13       Impact factor: 3.240

9.  Culture-expanded allogenic adipose tissue-derived stem cells attenuate cartilage degeneration in an experimental rat osteoarthritis model.

Authors:  Li Mei; Bojiang Shen; Peixue Ling; Shaoying Liu; Jiajun Xue; Fuyan Liu; Huarong Shao; Jianying Chen; Aibin Ma; Xia Liu
Journal:  PLoS One       Date:  2017-04-18       Impact factor: 3.240

10.  STAT3 speeds up progression of osteoarthritis through NF-κB signaling pathway.

Authors:  Feida Wang; Zhenye Guo; Yinpeng Yuan
Journal:  Exp Ther Med       Date:  2019-12-02       Impact factor: 2.447

View more
  6 in total

Review 1.  Platelet-rich plasma injections induce disease-modifying effects in the treatment of osteoarthritis in animal models.

Authors:  Angelo Boffa; Manuela Salerno; Giulia Merli; Laura De Girolamo; Lior Laver; Jérémy Magalon; Mikel Sánchez; Thomas Tischer; Giuseppe Filardo
Journal:  Knee Surg Sports Traumatol Arthrosc       Date:  2021-08-02       Impact factor: 4.342

Review 2.  Experimental Therapeutics for the Treatment of Osteoarthritis.

Authors:  Gundula Schulze-Tanzil
Journal:  J Exp Pharmacol       Date:  2021-02-11

Review 3.  Effects of Platelet-Rich Plasma on Clinical Outcomes After Anterior Cruciate Ligament Reconstruction: A Systematic Review and Meta-analysis.

Authors:  Ting Zhu; Jingbin Zhou; Jooyeon Hwang; Xin Xu
Journal:  Orthop J Sports Med       Date:  2022-01-31

4.  Attenuation of osteoarthritis progression through intra-articular injection of a combination of synovial membrane-derived MSCs (SMMSCs), platelet-rich plasma (PRP) and conditioned medium (secretome).

Authors:  Sara Sadat Nabavizadeh; Tahereh Talaei-Khozani; Moein Zarei; Shahrokh Zare; Omid Koohi Hosseinabadi; Nader Tanideh; Sajad Daneshi
Journal:  J Orthop Surg Res       Date:  2022-02-17       Impact factor: 2.359

5.  ROCK2 knockdown alleviates LPS-induced inflammatory injury and apoptosis of renal tubular epithelial cells via the NF-κB/NLRP3 signaling pathway.

Authors:  Xinfeng Qian; Linjun Yang
Journal:  Exp Ther Med       Date:  2022-07-28       Impact factor: 2.751

Review 6.  Platelet Rich Plasma in the Repair of Articular Cartilage Injury: A Narrative Review.

Authors:  Yinru Liang; Juan Li; Yuhui Wang; Junchu He; Liji Chen; Jiaqi Chu; Hongfu Wu
Journal:  Cartilage       Date:  2022 Jul-Sep       Impact factor: 3.117

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.