The Modulation of Trehalose Metabolism by 20-Hydroxyecdysone in Antheraea pernyi (Lepidoptera: Saturniidae) During its Diapause Termination and Post-Termination Period.

Trehalose plays a crucial role in the diapause process of many insects, serving as an energy source and a stress protectant. Trehalose accumulation has been reported in diapause pupae of Antheraea pernyi; however, trehalose metabolic regulatory mechanisms associated with diapause termination remain unclear. Here, we showed that the enhanced trehalose catabolism was associated with an increase in endogenous 20-hydroxyecdysone (20E) in hemolymph of A. pernyi pupae during their diapause termination and posttermination period. Injection of 20E increased the mRNA level of trehalase 1A (ApTre-1A) and trehalase 2 (ApTre-2) of A. pernyi diapause pupae in a dose-dependent manner but did not affect the mRNA level of trehalase 1B (ApTre-1B). Meanwhile, exogenous 20E increased the enzyme activities of soluble and membrane-bound trehalase, leading to a decline in hemolymph trehalose. Conversely, the expression of ApTre-1A and ApTre-2 were down-regulated after the ecdysone receptor gene (ApEcRB1) was silenced by RNA interference or by injection of an ecdysone receptor antagonist cucurbitacin B (CucB), which inhibits the 20E pathway. Moreover, CucB treatment delayed adult emergence, which suggests that ApEcRB1 might be involved in regulating pupal-adult development of A. pernyi by mediating ApTre-1A and ApTre-2 expressions. This study provides an overview of the changes in the expression and activity of different trehalase enzymes in A. pernyi in response to 20E, confirming the important role of 20E in controlling trehalose catabolism during A. pernyi diapause termination and posttermination period.

Trehalose, a nonreducing disaccharide, is the main component of insect hemolymph sugar. Its concentration can vary between 5 and 100 mM depending on environmental conditions, nutrition levels, and physiological states (Thompson 2003). Trehalose serves as an energy source and protectant against extreme environments. Trehalose accumulation increases insects’ survival chances under serious environmental stress, including stress caused by dehydration, heat, freezing, oxidation, and starvation (Crowe et al. 1984, Elbein et al. 2003).

In insects, trehalose synthesis mainly occurs in the fat body and is catalyzed by trehalose-6-phosphate synthase (TPS, EC 2.4.1.15) and trehalose-6-phosphate phosphatase (TPP, EC 3.1.3.12). Trehalose is then released into hemolymph and transported to other tissues by a trehalose transporter (Crowe et al. 1984, Becker et al. 1996, Asano 2003, Tang et al. 2008). Tissues and cells absorb trehalose, hydrolyzing it using trehalase (TRE, EC 3.2.1.28) to form two glucose molecules (Vandercammen et al. 1989, Mitsumasu et al. 2010). Insect TRE has been found in almost all insect tissues and exists in two forms: soluble trehalase (TRE1) and membrane-bound trehalase (TRE2) (Takiguchi et al. 1992, Mitsumasu et al. 2005).

Trehalase is putatively regulated by several types of hormones, including diapause hormone (DH), juvenile hormone (JH), and 20-hydroxyecdysone (20E) (Shukla et al. 2015). In Bombyx mori (Lepidoptera: Bombycidae), DH led to increased trehalase activity in the ovary mainly by increasing the levels of TRE2 protein (Kamei et al. 2011). In diapause larvae of Omphisa fuscidentalis (Lepidoptera: Pyralidae), the TRE1 mRNA level in the midgut increased after exposure to juvenile hormone analog (JHA) and 20E injection (Tatun et al. 2008). Similarly, exogenous 20E led to the induction of TRE-1 expression in Spodoptera exigua (Lepidoptera: Noctuidae) (Yao et al. 2010). In addition, treatment with 20E upregulated TRE-1 expression, but not TRE-2 expression in the second instar nymph of Apolygus lucorum (Hemiptera: Miridae) (Tan et al. 2014). Injection with 20E also increased TPS expression in Bactrocera minax (Diptera: Tephritidae) (Xiong et al. 2016). The regulation of TPS and TRE by 20E implies that 20E may play a vital role in controlling trehalose metabolism.

The Chinese oak silk moth Antheraea pernyi has high economic value; it lives in the wild and has developed a strong ability to adapt itself to changing environment. When A. pernyi larvae are reared under short daylength and a low temperature, they enter a facultative pupal diapause, a state of arrested development in insects. During this stage, trehalose is accumulated due to low metabolic activity (Williams and Adkisson 1964a). Exogenous 20E application is a strategy for hormonal manipulation that initiates diapause termination, which is followed by elevated metabolic respiration. Additionally, a recent study has shown that 20E-mediated diapause termination is closely related to enhanced energy metabolism in B. minax, indicating that the energy metabolism is involved in the response of diapause transition (Dong et al. 2019). Trehalase is the only enzyme that functions in trehalose hydrolysis, and variations in trehalase activity directly affect energy metabolism (Kamei et al. 2011). Thus, trehalase may play an important role in diapause termination, as well as in subsequent developmental processes. Genes encoding trehalose-6-phosphate and trehalase in A. pernyi including ApTPS, ApTre-1A, ApTre-1B, and ApTre-2 have been identified and cloned (Huang et al. 2016, Wang et al. 2018). However, there is little information on the role of 20E on trehalose metabolism during the diapause termination and posttermination period.

20E triggers the expression of 20E-responsive genes by binding to its nuclear receptor complex, which is composed of ecdysone receptor (EcR) and ultraspiracle protein (USP). Previous studies have demonstrated that the mutation of EcR leads to abnormal expression of most 20E-responsive genes in Drosophila melanogaster (Diptera: Drosophilidae) (Beckstead et al. 2005). Knockout of EcRB1 by RNAi also reduces the expression of a set of 20E-responsive genes in Helicoverpa armigera (Lepidoptera: Noctuidae) (Zheng et al. 2010), suggesting that EcR plays a vital role in controlling the transcription of 20E-responsive genes. Thus, we hypothesized that 20E may participate in regulation of expression of trehalase-related gene through its ecdysone receptor (ApEcRB1) during the diapause termination and posttermination period in A. pernyi pupae.

To test our hypothesis, we examined the expression profiles of genes involved in trehalose metabolism (ApTPS, ApTre-1A, ApTre-1B, and ApTre-2) and the changes in their corresponding enzymatic activities during the diapause termination and posttermination period. The effects of exogenous 20E treatment and RNA interference on the ecdysone signaling in trehalose metabolism were determined. Our results revealed that 20E upregulated ApTre-1A and ApTre2 genes through ApEcRB1 and increased the activities of soluble and membrane trehalase, leading to a decline in hemolymph trehalose during diapause termination and posttermination phase in A. pernyi pupae. These results are useful for understanding the regulatory mechanism of 20E on trehalose metabolism in A. pernyi pupae during the diapause termination and posttermination period.

Materials and Methods

Insects

The bivoltine strain Qing No. 6 of A. pernyi was obtained from Liaoning Provincial Sericulture Institute. Diapause pupae were maintained at the diapause stage under a short-day photoperiod 12:12 (L:D) h at 25°C for 2 wk before they were used in the experiment. To break diapause, pupae were exposed to a long-day photoperiod 17:7 (L:D) h at 25°C. When the pupae are in their diapause state, their epicranium remains transparent and their brain can be easily seen. The epicranium gradually loses its transparency during the diapause termination, becomes milky white after the diapause termination, and turns red or completely opaque thereafter (Williams and Adkisson 1964b, Liu et al. 2015). Based on the changes of epicranium, pupae were collected on days 0, 15, 20, 25, 30, and 35 after the long-day photoperiod treatment, and diapause pupae (day 0) were used as the control. The developmental stage, which was stimulated by the long-day photoperiod treatment, was further divided into two phases: the diapause termination phase which continued until day 20 of the treatment, and the posttermination phase which started on day 25 and ended on day 35 of treatment (Fig. 1A).

Fig. 1.

Expression profiles of genes involved in trehalose metabolism and relative physiological indices in A. pernyi pupae during the diapause termination and posttermination period. (A) Changes in the transparency of the epicranium after A. pernyi diapause pupae were induced to break diapause by long-day photoperiod 17:7 (L:D) h treatment. Based on the transparency of the epicranium, the pupae were collected after they were induced to break diapause during the diapause termination phase (days 0–20) and the posttermination phase (days 25–35); and diapause pupae (day 0) were used as a control group. (B) Relative expression levels of ApTPS, ApTre-1A, ApTre-1B, and ApTre-2. (C) Variations in activity of enzymes involved in trehalose metabolism. (D) Changes in trehalose content in hemolymph, and glycogen content in the fat body. TPS: trehalose-6-phosphate synthase, Tre-1: soluble trehalase, and Tre-2: membrane-bound trehalase. The mRNA levels were normalized to reference genes β-actin and RP49. Data are means of three independent experiments, and error bars are SEs. Different letters above the error bars indicate significant differences at P < 0.05.

Total RNA Extraction and cDNA Synthesis

After the puparium was removed, the whole body of A. pernyi pupa was ground in liquid nitrogen. Total RNA was extracted from 100 mg of homogenized sample using RNAiso Plus reagent (Takara, Japan) according to the instruction manual. First-strand cDNA was synthesized from 500 ng of total RNA using Prime Script RT Master Mix (Takara, Japan) and the following amplification program: 37°C for 15 min, and 85°C for 5 s.

Quantitative Real-Time PCR

Quantitative real-time PCR (qRT-PCR) was performed on a light Cycler 96 (Roche, Switzerland) using SYBR Premix Ex Taq II (Takara, Japan) and the gene specific primers listed in Table 1. The stable reference genes, β-actin and RP49, were selected as the endogenous control to normalize the expression of the target genes across different samples. Each PCR reaction contained 10 µl of 2×SYBR Premix Ex Taq II, 6.4 µl of dH2O, 2 µl of cDNA, and 0.8 µl of each primer (10 μM). The reaction procedure was as follows: preincubation at 95°C for 30 s, followed by 40 cycles of denaturation at 95°C for 5 s, and annealing and elongation at 60°C for 30 s. At the end of each cycle, fluorescence readings were used to determine the extent of amplification. Finally, dissociation curve analysis was performed to examine the efficiency of the specific amplification. The experiments were repeated three times, and the relative expression levels were calculated using the 2−ΔΔct method (Livak and Schmittgen 2001).

Table 1.

Primer sequences used in this study

Primer name	Nucleotide sequences (5′–3′)
qRT-PCR
Ap-actin-qF	ACCACACCTTCTACAATGAGC
Ap-actin-qR	ACGTCTCGAACATGATCTGTG
ApRP49-qF	AAGACCCGTCACATGCTACC
ApRP49-qR	GCGTTCGACGATTAACTTCC
ApTPS-qF	CCTTCAGCGCGTTTAACATAG
ApTPS-qR	GCGAGAATTTGTCTCCGTAATG
ApTre-1A-qF	ACGAAGACTACACCAATGCTC
ApTre-1A-qR	ACCAACGAGATGAAAAGTCCC
ApTre-1B-qF	AGACGGAGTCTGGTACGATTA
ApTre-1B-qR	TAACGCGGAGCATCGTATTC
ApTre-2-qF	TGAAGGGTCCGAGTTTGAAG
ApTre-2-qR	CTGACGCCCACTGATGAAA
ApEcRB1-qF	GGTGATGATGTTGCGAGTGG
ApEcRB1-qR	AGAATATGACAATGGCCGTGAG
ApUSP-1-qF	GTGCGGAAAGACCTAACATACG
ApUSP-1-qR	CCCACTCTGAGGAACTGGAACT
EGFP-qF EGFP-qR	AGTTGTACTCCAGCTTGTGC GACGGCAACTACAAGACCC
Primer name	Nucleotide sequences (5′–3′)
RNAi
dsApEcRB1-F	TAATACGACTCACTATAGGGAGAATGCCTTGC GGTCGGTATG
dsApEcRB1-R	TAATACGACTCACTATAGGGAGCGCAACATCA TCACCTCGCT
dsEGFP-F	TAATACGACTCACTATAGGGAGACCACCTACG GCAAGCTGACCCTGAAGT
dsEGFP-R	TAATACGACTCACTATAGGGAGAGCCGTCGCC GATGGGGGTGTTCTGCTG

Ap, Antheraea pernyi; actin, the actin gene GU073316; RP49, the ribosomal protein 49 gene DQ296005; TPS, trehalose-6-phosphate synthase gene KU977454; Tre-1A, soluble trehalase 1A gene KU977455; Tre-1B, soluble trehalase 1B gene KU977456; Tre-2, membrane-bound trehalase gene KU977457; EcRB1, ecdysone receptor isoform B1 gene KY411159; USP-1, ultraspiracle protein 1 gene KY411160; EGFP, enhanced green fluorescent protein gene 20473140. F stands for forward, and R stands for reverse.

Measurements of Trehalose and Glycogen Content

Hemolymph was collected from eight pupae in each group to extract trehalose; the extraction was carried out as described previously (Nakamatsu and Tanaka 2004) with some modifications. After centrifugation to remove free cells, hemolymph was homogenized in cold ethanol; the final concentration of ethanol was adjusted to 80%. The mixture was incubated in a boiling water bath for 5 min and was then centrifugated at 15,000 rpm for 5 min. The supernatant was collected and transferred to a new tube, and the precipitate was re-extracted with 80% ethanol. The supernatant was dried using a nitrogen evaporator and then resuspended in ultra-pure water. The samples were analyzed on an Agilent HPLC system equipped with an evaporative light-scattering detector and a sugar D, NH2-MS packed column (4.6 mm I.D.×250 mm, cosmosil). The mobile phase was the mixture of acetonitrile and water (80:20 v/v) with a flow rate of 1 ml/min. The quantity of trehalose present in the samples was calculated according to standard solutions of trehalose.

The fat body of A. pernyi pupae were dissected and washed twice using Ringer’s solution. The glycogen content of each sample was measured using a glycogen assay kit (Nanjing Jiancheng Biotech, China).

Enzyme Activity Assays

In order to obtain crude extracts for enzyme activity assays, 100 mg of pupae was ground in 20 mM PB buffer, followed by sonication for 30 s, and centrifugation at 12,000 × g for 30 min at 4°C. The supernatant was directly used to measure the activity of TPS and soluble trehalase (Guo et al. 2015). The precipitate was resuspended in 20 mM PB buffer and used for membrane-bound trehalase activity assay (Tatun et al. 2008).

TPS activity was measured as reported previously (Mitsumasu et al. 2010). The reaction mixture consisted of 100 µl of crude extract, 30 mM Tris–HCl (pH 7.4), 2.5 mM glucose-6-phosphate (Sigma–Aldrich, St. Louis, MO), 2.5 mM UDPG (Sigma–Aldrich), and 2.5 mM MgCl2. The reaction mixture was incubated at 25°C for 30 min and terminated in boiling water for 5 min. After centrifugation at 13,000 rpm for 5 min, the supernatant was collected for activity analysis. The reaction mixture (a total volume of 0.5 ml) contained 200 µl of the supernatant, 1.25 mM phosphoenolpyruvate (Sigma–Aldrich), 5 U each of pyruvate kinase (Sigma–Aldrich) and lactate dehydrogenase (Sigma–Aldrich), and 0.3 mM NADH (Sigma–Aldrich). The reaction mixture was incubated at 25°C for 10 min and was then centrifuged at 12,000 × g for 3 min. TPS activity was determined by measuring the extent of NADH oxidation spectrophotometry at 340 nm.

The activities of soluble and membrane-bound trehalase were determined according to a previously described procedure (Tatun et al. 2008) with some modifications. Briefly, the reaction mixture containing 250 µl of 40 mM trehalose, 200 µl of soluble or membrane-bound trehalase fraction extract, and 550 µl of 20 mM PB buffer was incubated at 25°C for 30 min; the reaction was then terminated by incubating in a boiling water bath for 5 min. The supernatant was obtained by centrifugation, and the amount of glucose in the supernatant was measured using a glucose assay kit (Comin, China).

Quantification of 20-hydroxyecdysone

Hemolymph samples were prepared according to a procedure described previously (Meng et al. 2015) with some modifications. Hemolymph samples (0.5 ml) were homogenized with an equal volume of methanol, incubated on ice for 10 min, and then centrifuged at 13,000 rpm for 10 min at 4°C. The supernatant was collected, and the precipitate was re-extracted. The incorporated supernatant was then dried using a nitrogen evaporator, and the remainder was dissolved in an appropriate amount of ELISA buffer (1 M phosphate solution containing 1% BSA, 4 M sodium chloride, and 10 mM EDTA). The level of 20E in hemolymph was determined using a commercial 20E enzyme immunoassay kit (Cayman Chemicals Inc., USA) according to the manufacturer’s instructions. The absorbance at 450 nm was determined, and a standard curve was plotted using 20E standards (Sigma–Aldrich).

20E, Cucurbitacin B, and Cycloheximide Treatment

20E (Sigma–Aldrich, St. Louis) was dissolved in 10% ethanol to make a stock solution at 5 mg/ml, which was then diluted with PBS buffer to create a working solution. The A. pernyi diapause pupae were divided into five groups, each group consisted of eight individuals. Mean fresh body weight of each A. pernyi pupa was approximately 8.6 ± 0.2 g. Since 20E could trigger nearly all the A. pernyi diapausing pupae to capacitate the direct development at a high applied dose of up to 20 μg, we investigated the effect of 20E on trehalose metabolism in A. pernyi diapause pupae at a dose range of 20–80 μg (Liu et al. 2015, Chen et al. 2020). Various amounts of 20E (20, 40, 60, and 80 μg) were injected into each group, and equal volumes of PBS buffer were used as controls. At 24-h postinjection, these A. pernyi pupae were collected and subjected to analysis of gene expression, trehalose content, and enzyme activity described in Quantitative Real-Time PCR, Measurements of Trehalose and Glycogen Content, and Enzyme Activity Assays sections, respectively.

To examine the effect of other steroids-like compound on trehalose metabolism, rhapontisterone B (Wuhan ChemFaces Biochemical Co., Ltd, China) were used as the negative control for 20E treatment. Similarly, various amounts of rhapontisterone B (20, 40, 60, and 80 μg) were applied topically on the pupae, and the same volumes of PBS buffer were used as controls. At 24 h after injection, the samples were collected for further analysis.

A stock solution (10 mM) of cucurbitacin B (CucB; MedChem Express) was prepared in DMSO and then diluted to various concentrations with 10% DMSO. CucB at a dose of 0.2 μg has been previously reported to efficiently inhibit the ecdysone signaling in vivo (Vellichirammal et al. 2017). Thus, after the long photoperiod treatment for 25 d, the A. pernyi pupae were, respectively, injected with 0.2 and 2 μg of CucB. An equal volume of 10% DMSO was injected into the pupae of the control group. Twenty-four hours after injection, eight pupae in each group were collected for analysis of gene expression, trehalose content, and enzyme activity assays as described earlier.

Cycloheximide (CHX; MedChem Express) was dissolved to 1 mg/ml in 10% DMSO; and 2 h before the 20E treatment, 4 μg of CHX was injected into A. pernyi pupae. A. pernyi pupae were divided into four groups, and each group contained eight individuals. Each experiment was carried out three times. The four groups were, respectively, injected with PBS buffer and 10% DMSO (CK), PBS buffer and 4 μg of CHX (CHX), 20 μg of 20E and 10% DMSO (20E), and 20 μg of 20E and 4 μg of CHX (20E + CHX). The samples in each group were collected at 12 h after 20E injection and then subjected to trehalase genes expression analysis.

RNA Interference Targeting ApEcRB1

To successfully perform RNA interference with ApEcRB1, a dsRNA fragment targeting ApEcRB1 was synthesized using a Promega T7 expression kit (Promega, USA) for in vitro transcription according to the manufacturer’s protocol. Gene-specific primers with the T7 polymerase promoter sequence are shown in Table 1. Fifty micrograms of dsApEcRB1 together with 20 μg of 20E were injected into the abdomen of A. pernyi pupae, and equivalent amounts of dsEGFP and 20E were injected into the pupae in the control group. In this experiment, each group contained eight individuals and was prepared in triplicate. All the treated pupae in each group were collected for further analysis after 24, 48, and 72 h of dsRNA injection.

Bioassay of Effect of CucB on Pupal-Adult Transformation of A. pernyi

To explore the role of EcR in pupal-adult transformation, CucB (2 μg, 10 µl) was injected into A. pernyi diapause pupae using a microsyringe (Hamilton). Pupae treated with the same volume of 10% DMSO served as the control. Treated pupae were incubated at 25°C and 17:7 (L:D) h photoperiod to facilitate the diapause termination in A. pernyi. Each group contained 14 individuals and was prepared in triplicate; the eclosion rate of each group was determined.

Statistical Analysis

Three biological and three technical replicates were used in each experiment. All data are presented as means ± standard errors determined using SPSS software (SPSS Inc., Chicago, IL). The difference between groups was determined using Student’s t-tests (to compare between two mean values) or by one-way analysis of variance (ANOVA) followed by a least significant difference (LSD) test (to compare between multiple mean values). The differences at P < 0.05 were considered significant.

Results

Expression Profiles of Genes Involved in Trehalose Metabolism During Diapause Termination and Posttermination Period

Relative expression levels of ApTPS, ApTre-1A, ApTre-1B, and ApTre-2 from the diapause to the diapause termination and the posttermination phase were determined by qPCR. The ApTre-1A, ApTre-1B, and ApTre-2 levels in the diapause pupae were relatively low, but were increased followed by a decrease in the diapause intensity and advance of development after the long-day photoperiod treatment (Fig. 1B). The expression of ApTre-1A increased slightly in the diapause termination phase, but then increased more dramatically in the posttermination phase, reaching its peak value (40.2 units) at day 30 after long-day photoperiod treatment. The increase in ApTre-2 expression was similar to the trend observed for ApTre-1A; however, its ascensional range was much narrower than that of ApTre-1A. The expression level of ApTre-1B first increased and then decreased in the diapause termination phase, but gradually increased in the posttermination phase until finally reaching a maximum value (6.1 units) when the pupae were treated with long-day photoperiod for 35 d. However, the mRNA level of ApTPS gene slightly fluctuated over the diapause termination and posttermination period.

Changes of Enzyme Activities Involved in Trehalose Metabolism During Diapause Termination and Posttermination Period

The enzyme activities of TPS and of soluble and membrane-bound trehalase were also investigated from the diapause to posttermination phase. After being exposed to a long-day photoperiod, soluble trehalase activity increased from day 0 to day 15, and then decreased on day 20. After that, it increased until reaching its peak value on day 30, and then slightly decreased on day 35 (Fig. 1C). Meanwhile, membrane-bound trehalase activity slightly decreased from day 0 to day 20 and then increased until day 35. TPS activity remained nearly the same until day 20; after which, it steadily increased until day 35.

Trehalose and Glycogen Contents During Diapause Termination and Posttermination Period

The results showed that hemolymph trehalose content (F = 267.776; df = 5, 12; P < 0.001) significantly decreased during the diapause termination and posttermination period stimulated by the long-day photoperiod. Trehalose concentration in the diapause pupae was steady at 10.54 ± 0.49 mg/ml (day 0), but after the long-day photoperiod treatment, it started to decline until reaching a minimum value of 3.06 ± 0.52 mg/ml on day 35 (Fig. 1D). However, the fat body glycogen concentration (F = 2405; df = 5, 12; P < 0.001) increased after day 15 until reaching its peak value on day 20 (12.84 ± 0.42 mg/g). After that, it decreased on day 25 and then increased on day 30, but thereafter decreased until reaching its minimum value (4.77 ± 0.36 mg/g) on day 35 (Fig. 1D). The increase in glycogen levels from day 15 to day 30 indicates that hemolymph trehalose may be converted into fat body glycogen during this period.

Changes in Hemolymph Ecdysone Concentration and Expression Profiles of ApECRB1 and ApUSP1 During the Diapause Termination and Posttermination Period

Changes in hemolymph 20E titer were measured to demonstrate the relationships between 20E and trehalase during the A. pernyi pupal diapause termination and posttermination period. The level of 20E in A. pernyi diapause pupae hemolymph was low with a value of 185.66 ± 0.02 ng/ml, but was significantly increased during the diapause termination and posttermination period (F = 104.23; df = 5, 12; P < 0.001). During the diapause termination phase, the 20E level increased significantly reaching the maximum value (843.80 ± 0.42 ng/ml) on day 15; after that, it sharply decreased on day 20 (417.42 ± 0.36 ng/ml). During the posttermination phase, the level of 20E increased until reaching another peak (653.98 ± 0.38 ng/ml) on day 30; however, it ultimately decreased to 243.44 ± 0.29 ng/ml on day 35 (Fig. 2A).

Fig. 2.

Trend of 20E titers in hemolymph (A) and the relative expression levels of ApEcRB1 and ApUSP1 (B) during A. pernyi pupal diapause termination and posttermination periods. The mRNA levels were normalized to reference genes β-actin and RP49. Data are means of three independent experiments, and error bars are SEs. Different letters above the error bars indicate significant differences at P < 0.05.

20E elicits its effects through binding to the EcR/USP heterodimer; therefore, the relative mRNA expression of their encoding genes during diapause termination and posttermination period were analyzed by qPCR (Ru et al. 2017). The expression of ApEcRB1 and ApUSP1 exhibited an up–down–up trend, according to the expression profiles. Additionally, the increase in the expression of these genes was closely related to the increase of the 20E level in hemolymph, except for that at the end of posttermination (Fig. 2B).

Effect of 20E on Trehalose Metabolism

The data in Figs. 1 and 2 suggest that an increase in 20E titer in hemolymph was associated with a significant increase in ApTre gene expression during diapause termination and posttermination period. Therefore, 20E may be involved in the control of trehalose metabolism in A. pernyi diapause pupae. To examine the effect of 20E on trehalose metabolism, 20–80 μg doses of 20E were injected into A. pernyi diapause pupae. The qRT-PCR analysis suggested that higher expression levels of ApTre-1A (F = 2218; df = 4, 10; P < 0.001) and ApTre-2 (F = 239.397; df = 4, 10; P < 0.001) were induced by the 20E injection in A. pernyi diapause pupae, which is in agreement with the increase in ApEcRB1 transcript levels (F = 24.428; df = 4, 10; P < 0.001) (Fig. 3A and B). The results suggested that the mRNA levels of ApTre-1A were significantly up-regulated by exogenous 20E in a dose-dependent manner, and the transcription level of ApTre-1A in pupae treated with 80 μg of 20E was approximately 26.1-fold higher than that in the control group. The changes in ApTre-2 expression were similar to that of ApTre-1A in relation to 20E treatment, but the mRNA levels of ApTre-2 were generally lower than that of ApTre-1A when treated with the same dose. Meanwhile, an increase in ApTre-1B mRNA was only observed when the dose increased to 80 μg, and ApTPS transcription increased by 20E-injection at a dose of 20 and 60 μg.

Fig. 3.

Influence of 20E on trehalose metabolism in A. pernyi diapause pupae. A. pernyi diapause pupae were separately injected with 20–80 μg of 20E; the control group (CK) was treated with PBS buffer. (A) Relative expression levels of ApEcRB1 and ApUSP1 in A. pernyi diapause pupae in response to 20E injection. (B) Relative expression levels of ApTPS, ApTre-1A, ApTre-1B, and ApTre-2 induced by 20E injection. The mRNA levels were normalized to reference genes β-actin and RP49. (C) Changes in trehalose content in the hemolymph of A. pernyi diapause pupae treated with 20E. (D) Changes of activities of trehalose-6-phosphate synthase, and soluble and membrane-bound trehalase caused by 20E injection. In the figure, the hollow triangle represents the trehalose-6-phosphate synthase activity, the solid box represents the soluble trehalase activity, and the solid triangle represents the membrane binding trehalase activity. Data are means of three independent experiments, and error bars are SEs. Different letters above the error bars indicate significant differences at P < 0.05.

As the injection dose of 20E increased, the enzyme activities of the soluble (F = 960.806; df = 4, 10; P < 0.001) and membrane-bound trehalase (F = 72.699; df = 4, 10; P < 0.001) increased. After the injection with 20E at a dose of 80 μg, the activities of soluble trehalase and membrane-bound trehalase increased by 2.20- and 2.10-folds, respectively, compared with those of the control group (Fig. 3D). Although TPS activity (F = 96.857; df = 4, 10; P < 0.001) increased as the amount injected 20E increased, a decrease in trehalose content (F = 25.579; df = 4, 10; P < 0.001) was observed as the 20E amount increased (Fig. 3C and D). This suggests that 20E treatment mainly led to an increase in soluble and membrane-bound trehalase activities of A. pernyi diapause pupae, which in turn contributed to a decline in trehalose concentrations in hemolymph.

Rhapontisterone B is a 3a-hydroxyl and 5a-epimer analogue of 20E. Previous studies have shown that the molting activity of ecdysteroid of the 3b-hydroxyl analogue is higher than that of the corresponding 3a-hydroxyl analogue (Bergamasco and Horn 1980). In addition, all active ecdysteroids have a cis-fused A/B ring junction, whereas the 5a-epimers are inactive (Ogawa et al. 1971). Thus, rhapontisterone B is expected to be an inactive ecdysteroid analogue and has shown a slight antagonized 20E activity in D. melanogaster Kc cells (Zou et al. 2018). Therefore, as the negative control of 20E, we also investigated the effect of rhapontisterone B injection on trehalose metabolism of A. pernyi diapause pupae. The content of trehalose and the expression of trehalose metabolism-related genes in the rhapontisterone B-treated and the PBS buffer-treated groups were not significantly different. This suggests that unlike 20E, rhapontisterone B could not promote the trehalose metabolism in A. pernyi diapause pupae (Fig. 4).

Fig. 4.

Influence of rhapontisterone B on trehalose metabolism in A. pernyi diapause pupae. A. pernyi diapause pupae were separately injected with rhapontisterone B at doses of 20–80 μg; the control group (CK) was treated with PBS buffer. (A) Relative expression levels of ApEcRB1 and ApUSP1 in A. pernyi diapause pupae as a result of rhapontisterone B injection. (B) Relative expression levels of ApTPS, ApTre-1A, ApTre-1B, and ApTre-2 induced by rhapontisterone B injection. The mRNA levels were normalized to those of reference genes β-actin and RP49. (C) Changes in trehalose content in the hemolymph of A. pernyi diapause pupae treated with rhapontisterone B. Data are means of three independent experiments, and error bars are SEs. The letters above the error bars indicate that the differences at P > 0.05, which are insignificant.

Effects of ApEcRB1 RNAi on Trehalose Metabolism During Diapause Termination

The insect EcR plays a crucial role in the up-regulation of multifarious genes when induced by 20E (Yamamoto and Alberts 1976, Martin et al. 2001). Our data (Fig. 3A) showed that exogenous 20E could induce the expression of ApEcRB1, indicating that ApEcRB1 could be involved in mediating 20E signaling in A. pernyi. To further confirm that the key genes involved in trehalose metabolism were regulated by 20E through ApEcRB1, the expressions of these genes in the A. pernyi diapause pupae were determined after the pupae were injected with a mixture of 20E and dsApEcRB1. The transcript levels of ApEcRB1 at 24-, 48-, and 72-h postinjection were 48.6% (F = 62.335; df = 1, 4; P = 0.001), 45.1% (F = 50.094; df = 1, 4; P = 0.002), and 33.6% (F = 62.492; df = 1, 4; P = 0.001), respectively, lower than those of the control group (Fig. 5A). This suggests that dsApEcRB1 injection resulted in an effective RNAi response. Twenty-four hours after the ApEcRB1 expression was suppressed by RNAi, ApTre-1A (F = 726.15; df = 1, 4; P < 0.001) and ApTre-2 (F = 16.358; df = 1, 4; P = 0.016) transcripts significantly decreased in dsApEcRB1-injected pupae (Fig. 5C and E). Significant suppression of ApTre-1A (F = 21.887; df = 1, 4; P = 0.009) and ApTre-2 (F = 47.856; df = 1, 4; P = 0.002) transcript level also lasted for 72 h, which coincided with the low ApEcRB1 expression. In addition, the expression of ApTPS was slightly affected at 24 h (F = 1.982; df = 1, 4; P = 0.232) and 72 h (F = 0.972; df = 1, 4; P = 0.380) postinjection, but was down-regulated at 48 h (F = 22.204; df = 1, 4; P = 0.009) postinjection in dsApEcRB1-treated group (Fig. 5B). However, ApTre-1B mRNA levels (F = 3.352; df = 1, 4; P = 0.141) in the dsApEcRB1-injected and dsEGFP-injected pupae were not significantly different (Fig. 5D). Compared with that in the control group, the trehalose content in dsApEcRB1-treated pupae was 18% greater at 24 h (F = 8.313; df = 1, 4; P = 0.045), 23.8% greater at 48 h (F = 62.319; df = 1, 4; P = 0.001), and 36% greater at 72 h (F = 229.272; df = 1, 4; P < 0.001), which may be caused by the decrease in trehalase activities after the interruption of ApEcRB1 (Fig. 5F).

Fig. 5.

Effects of ApEcRB1-specific RNA interference on trehalose metabolism in A. pernyi diapause pupae injected with 20E. (A–E) Relative expression levels of ApEcRB1, ApTPS, ApTre-1A, ApTre-1B, and ApTre-2. (F) Changes in trehalose content in hemolymph of A. pernyi diapause pupae injected with 20E and dsApEcRB1. The mRNA levels were normalized to those of reference genes β-actin and RP49, and the group injected with 20E + dsEGFP served as the control. Data are means of three independent experiments, and error bars are SEs. Single asterisks (P < 0.05) and double asterisks (P < 0.01) represent the significant differences between the 20E + dsEGFP and 20E + dsApEcRB1 groups at the same time period.

Effect of Cucurbitacin B Treatment on Trehalose Metabolism After Diapause Termination and Pupal-Adult Development

Cucurbitacin B (CucB) acts as an ecdysone receptor antagonist by competing for ecdysone receptor and binding with high affinity (Dinan et al. 1997). CucB has been used in lepidopteran insects, including B. mori and H. armigera, to inhibit 20E-related pathway signaling (Zou et al. 2018). To further confirm our hypothesis that ApEcRB1 is involved in the induction of trehalase gene expression, 0.2 and 2 μg of CucB were injected into A. pernyi pupae after diapause termination. The results indicated that CucB treatment caused a down-regulation of ApTre-1A (F = 3066; df = 2, 6; P < 0.001) and ApTre-2 (F = 23.516; df = 2, 6; P = 0.001) expression, but did not alter the transcription of ApTre-1B (F = 2.038; df = 2, 6; P = 0.211) and ApTPS (F = 0.4; df = 2, 6; P = 0.687) (Fig. 6A–D). Compared with that in the control group, the trehalose content in the pupae treated with 0.2 and 2 μg of CucB were increased by 69 and 91%, respectively (F = 417.816; df = 2, 6; P < 0.001) (Fig. 6E). These results suggest that ApECRB1 regulates trehalase catabolism by mediating ApTre-1A and ApTre-2 gene expression in A. pernyi pupae after diapause termination.

Fig. 6.

Effects of cucurbitacin B (CucB) on expression levels of genes involved in trehalose metabolism, trehalose content, and adult emergence in A. pernyi pupae after diapause termination. Two doses of CucB (0.2 and 2 μg) were injected into A. pernyi pupae after long photoperiod treatment for 25 d, and an equal volume of 10% DMSO was injected as the control (CK). (A–D) The influence of CucB injection on relative expression levels of ApTPS, ApTre-1A, ApTre-1B, and ApTre-2. (E) Changes in trehalose content in the hemolymph of A. pernyi pupae treated with CucB. (F) Adult emergence rates of pupae after treatment of diapause pupae with CucB. Diapause pupae were exposed to a long-day photoperiod 17:7 (L:D) h at 25°C after 2 μg CucB-injection, eclosion rates were then recorded. Each group had 14 individuals, and error bars indicate the mean ± SE of three replicates. Different letters above the error bars indicate significant differences at P < 0.05.

Based on our evidence on the function of ApECRB1 in pupal trehalose catabolism, we further explored whether it is involved in the control of pupal-adult development. Before exposure to long-day photoperiod conditions to break diapause, diapause pupae were injected with 2 μg of CucB; and 10% DMSO-treated pupae were considered as the control group. From the 23rd to 38th days, all pupae in the control group finished metamorphosis, while in the CucB group, the first adult emerged on the 31st day, 50% by the 40th day, and 100% by the 54th day (Fig. 6F). These results indicate that CucB treatment delayed adult emergence in A. pernyi with long-day photoperiod stimuli.

Response of ApTres Genes to Cycloheximide

To investigate whether ApTre-1A and ApTre-2 expression were directly regulated by 20E, CHX was used as a protein synthesis inhibitor, and its effects on the 20E-dependent induction of these genes were examined. The group that received a combination of 20E and CHX displayed ApTre-1A and ApTre-2 mRNA levels that were 69% (F = 586.411; df = 1, 4; P < 0.001) and 51% (F = 1339; df = 1, 4; P < 0.001), respectively, lower than those of the group that received 20E alone. This suggests that CHX could inhibit the 20E-induced up-regulation of ApTre-1A and ApTre-2 (Fig. 7).

Fig. 7.

Effect of cycloheximide (CHX) on 20E-induced ApTre-1A and ApTre-2 mRNA expression. Control: PBS buffer and 10% DMSO injection; CHX: PBS buffer and CHX injection; 20E: 20E and 10% DMSO injection; and 20E+CHX: 20E and CHX injection. The mRNA levels were normalized to those of reference genes β-actin and RP49. Data are means of three independent experiments, and error bars are SEs. Different letters above the error bars indicate significant differences at P < 0.05.

Discussion

Trehalose serves not only as a glucose source for energy metabolism, but also as a protectant for protein and biological membranes stabilization to cope with environmental stress in insects (Crowe et al. 1984, Elbein et al. 2003). Studies have shown that diapause pupae of A. pernyi accumulate higher levels of trehalose than nondiapause pupae (Lu et al. 1992). In the present study, hemolymph trehalose concentration gradually decreased as trehalase activity increased during diapause termination and posttermination period (Fig. 1). In a previous study, trehalase gene expression and enzyme activity of fat body increased in the univoltine strain of A. pernyi under a long photoperiod, which is in agreement with the results of the present study (Wang et al. 2018). In Delia antique (Diptera: Anthomyiidae) diapause pupae, trehalose concentration decreased at the last stage of the diapause maintenance and postdiapause phase (Guo et al. 2015). In H. armigera, trehalose was degraded quickly after diapause hormone was injected into diapause pupae to break diapause (Xu et al. 2009). These results provide compelling evidence that a decline in trehalose is related to a decrease in diapause intensity in insects.

The steroid hormone 20E participates in various physiological events during insect growth and metamorphosis (Yao et al. 2010, Cai et al. 2014). It is well established that the cessation of prothoracicotropic hormone (PTTH) release blocks the synthesis and the release of steroid hormone ecdysteroid from prothoracic glands (PGs), which leads to diapause initiation in A. pernyi (Wang et al. 2013). In contrast, hemolymph ecdysteroid titer increased drastically after A. pernyi diapause pupae were exposed to 16:8 (L:D) h to break diapause (Takeda et al. 1997). The resumption of ecdysteroid secretion may also promote postdiapause development (McDaniel 1979, Loeb 1982, Bodnaryk 1985, Endo 1997). In the present study, the level of 20E in hemolymph showed an overall increase (except for a significant decrease in the titer on day 20), and the up-regulation of ApECRB1 and ApUSP1 mRNA levels coincided with the increase in hemolymph 20E titer during diapause termination and posttermination period (Fig. 2). Moreover, the up-regulation of ApTre-1A and ApTre-2 expression appeared to be in parallel with the increase of 20E level in hemolymph (Figs. 1 and 2). This indicates that an increase in 20E concentration could activate the expression of these trehalase genes during the progression of diapause termination and posttermination of A. pernyi pupae.

Based on the fact that 20E application could trigger the rapid response of diapause termination, we investigated the effect of exogenous 20E on trehalose metabolism in A. pernyi diapause pupae. The results showed that exogenous 20E upregulated the expression of ApTre-1A and ApTre-2 genes, which in turn caused the increase of the soluble and membrane-bound trehalase activities, leading to a significant decline of hemolymph trehalose content in A. pernyi diapause pupae (Fig. 3). Due to their different properties, soluble trehalase and membrane-bound trehalase are believed to use different sources of trehalose. Soluble trehalase is located in the cell and functions in the intracellular trehalose hydrolyzation, whereas membrane-bound trehalase is a transmembrane enzyme that functions in the hydrolysis of extracellular trehalose (Mitsumasu et al. 2008, de Almeida et al. 2009). Thus, injection of 20E may increase both soluble and membrane-bound trehalase activities, accelerating the decline of trehalose content in A. pernyi diapause pupae. Since ApTPS transcription fluctuated as the dose of 20E-injection increased, ApTPS gene may not be directly controlled by 20E. Hemolymph trehalose concentration is controlled by a dynamic equilibrium of synthesis and hydrolysis of trehalose (Becker et al. 1996). The increase in TPS activity associated with the 20E-injection might be attributed to the compensation for the decline of trehalose. Thus, our results suggested that exogenous 20E accelerated the breakdown of trehalose to glucose though an increase in soluble and membrane-bound trehalase activity, which may enhance trehalose catabolism in A. pernyi diapause pupae. This finding is consistent with the observation that exogenous 20E could cause a decrease in trehalose concentration (Oda et al. 1997, Singtripop 2002), and can elevate the soluble trehalase activity in the midgut of O. fuscidentalis diapause larvae with 1-d postinjection (Singtripop 2002, Tatun et al. 2008).

The insect EcR, a ligand-inducible nuclear transcription factor, binds to USP to form a heterodimer that effectively activates the expression of 20E-inducible genes and mediates ecdysone signaling (Yao et al. 1993, Riddiford 1999, Riddiford et al. 2000). Our ApEcRB1 silencing experiment revealed that the dsApEcRB1 injection caused the significant down-regulation of ApTre-1A and ApTre-2 expression during diapause termination (Fig. 5). Similarly, CucB treatment inhibited the expression of these two trehalase genes, which in turn led to an increase in hemolymph trehalose in A. pernyi pupae after diapause termination (Fig. 6). This result, together with the result from the ApEcRB1 RNA interference experiment, indicate that ApEcRB1 is involved in regulating trehalase gene expression in response to 20E. Consistent with our results, the expression levels of LdTre-1a, LdTre-1b, and LdTre-2 were significantly reduced after LdEcR gene in Leptinotarsa decemlineata (Coleoptera: Chrysomelidae) third-instar larvae was knocked down (Shi et al. 2016). Also, mRNA and protein levels of AlTre1 decreased after the injection of AlEcRB-specific siRNA, which resulted in decreased soluble trehalase activity and increased trehalose content in the nymphs of A. lucorum (Tan et al. 2015). In the present study, neither the treatment with ApEcRB1-specific RNAi nor with CucB led to the decrease in ApTre-1B expression (Figs. 5D and 6C). Consistent with these results, we also found that the ApTre-1B expression in the 20E-treated group and the control group were not significant different (Fig. 3B). These results suggest that this gene is neither directly controlled by 20E nor ApEcRB1. The continuous expression of ApTre-1B may supply the energy necessary for the survival of the individuals. Ecdysone-responsive genes appear to be differentially regulated by 20E. After binding to the EcR/USP receptor, 20E directly activates a small set of early regulatory gene expression. The transcription factors that are encoded by these early genes subsequently induce multitudinous late target genes (Ashburner et al. 1974). Our results revealed that CHX inhibited the 20E-induced up-regulation of ApTre-1A and ApTre-2 genes, suggesting that ApTre-1A and ApTre-2 are 20E secondary-response genes, and the activation of these genes requires the 20E signaling pathway (Fig. 7).

As a hormonal receptor of ecdysteroid, EcR regulates growth and development in insects. To discover whether 20E can promote pupal-adult development and is dependent on ApEcRB1 in A. pernyi, we treated diapause pupae with CucB before treating them with the long-day photoperiod. Our findings showed that CucB treatment delayed adult emergence in A. pernyi (Fig. 6D). The suppression of ApEcRB1 caused by the CucB treatment led to the down-regulation of ApTre-1A and ApTre-2 expression, indicating that there is the decrease of trehalase activities in A. pernyi pupae. Thus, under these circumstances, trehalose cannot be converted into glucose to provide energy and substrate for chitin synthesis for pupal-adult development, which could be the reason of the delay in adult emergence that was observed in CucB- treated A. pernyi. This observation is in agreement with a previous study, in which the knockdown of EcR was found to reduce the soluble trehalase activity, in turn preventing the normal growth and development of A. lucorum (Tan et al. 2015).

In conclusion, our results showed that 20E led to an increase in trehalose catabolism during the diapause termination and posttermination period of A. pernyi pupae (Fig. 8). The up-regulation of ApTre-1A and ApTre2, which are the 20E secondary-response genes, were induced by 20E through ApEcRB1 in A. pernyi diapause pupae. Meanwhile, the increase of soluble trehalase and membrane-bound trehalase activity caused a decline in trehalose concentration in hemolymph. Moreover, ApEcRB1 may be involved in controlling pupal-adult development by mediating ApTre-1A and ApTre-2 expression in A. pernyi. Our findings contribute to the understanding of the role of 20E in regulating trehalose catabolism during the diapause termination and posttermination period. In general, the dose of a single hormone application required to elicit its effect is much larger than the hormone concentration that induces corresponding events in vivo (Satake et al. 1998, Singtripop 2002). Our previous study also showed that the content of trehalose and the expression of trehalose metabolism-related genes in the control groups and the experimental groups injected with 20E lower than 20 μg (5 and 10 μg) were not significantly different (data not shown). A previous study has reported that exogenous ecdysone could be rapidly metabolized, and only a small portion of the hormone could be recovered in fly larvae (Karlson and Bode 1969). It is likely that A. pernyi diapause pupae undergo similar degradation mechanism; and for this reason, a low dose of exogenous ecdysone could not alter the trehalose metabolism. This could be an alternative explanation for why a high dose of 20E is required for A. pernyi diapause termination to take place in most cases, especially when the A. pernyi pupae have large sizes. In future studies, we will continue to examine this issue and identify the functions of trehalase genes during the pupal-adult development of A. pernyi.

Fig. 8.

Schematic representation showing how 20E is involved in promoting trehalose catabolism through ApEcRB1 at the diapause termination and posttermination phase in A. pernyi pupae. Through the classic nuclear receptor complex EcR/USP, 20E induces the up-regulation of ApTre-1A and ApTre2 expression, which in turn increases the enzyme activity of soluble and membrane-bound trehalase, leading to a decline in hemolymph trehalose concentration.