Lauren E King1,2, Hui-Hua Zhang1,2, Cathryn M Gould3, Daniel W Thomas3, Lachlan W Whitehead1,2, Kaylene J Simpson3,4, Antony W Burgess1,2,5, Maree C Faux1,2. 1. Walter and Eliza Hall Institute of Medical Research, Parkville, VIC, Australia. 2. Department of Medical Biology, University of Melbourne, Parkville, VIC, Australia. 3. Victorian Centre for Functional Genomics, Peter MacCallum Cancer Centre, Melbourne, VIC, Australia. 4. The Sir Peter MacCallum Department of Oncology, University of Melbourne, Parkville, VIC, Australia. 5. Department of Surgery, RMH, University of Melbourne, Parkville, VIC, Australia.
Abstract
Truncating mutations in the tumour suppressor gene APC occur frequently in colorectal cancers and result in the deregulation of Wnt signalling as well as changes in cell-cell adhesion. Using quantitative imaging based on the detection of membrane-associated E-cadherin, we undertook a protein coding genome-wide siRNA screen to identify genes that regulate cell surface E-cadherin in the APC-defective colorectal cancer cell line SW480. We identified a diverse set of regulators of E-cadherin that offer new insights into the regulation of cell-cell adhesion, junction formation and genes that regulate proliferation or survival of SW480 cells. Among the genes whose depletion promotes membrane-associated E-cadherin, we identified ZEB1, the microRNA200 family, and proteins such as a ubiquitin ligase UBE2E3, CDK8, sorting nexin 27 (SNX27) and the matrix metalloproteinases, MMP14 and MMP19. The screen also identified 167 proteins required for maintaining E-cadherin at cell-cell adherens junctions, including known junctional proteins, CTNND1 and CTNNA1, as well as signalling enzymes, DUSP4 and MARK2, and transcription factors, TEAD3, RUNX2 and TRAM2. A better understanding of the post-translational regulation of E-cadherin provides new opportunities for restoring cell-cell adhesion in APC-defective cells.
Truncating mutations in the tumour suppressor gene APC occur frequently in colorectal cancers and result in the deregulation of Wnt signalling as well as changes in cell-cell adhesion. Using quantitative imaging based on the detection of membrane-associated E-cadherin, we undertook a protein coding genome-wide siRNA screen to identify genes that regulate cell surface E-cadherin in the APC-defective colorectal cancer cell line SW480. We identified a diverse set of regulators of E-cadherin that offer new insights into the regulation of cell-cell adhesion, junction formation and genes that regulate proliferation or survival of SW480 cells. Among the genes whose depletion promotes membrane-associated E-cadherin, we identified ZEB1, the microRNA200 family, and proteins such as a ubiquitin ligase UBE2E3, CDK8, sorting nexin 27 (SNX27) and the matrix metalloproteinases, MMP14 and MMP19. The screen also identified 167 proteins required for maintaining E-cadherin at cell-cell adherens junctions, including known junctional proteins, CTNND1 and CTNNA1, as well as signalling enzymes, DUSP4 and MARK2, and transcription factors, TEAD3, RUNX2 and TRAM2. A better understanding of the post-translational regulation of E-cadherin provides new opportunities for restoring cell-cell adhesion in APC-defective cells.
Colorectal cancer (CRC) causes almost 862,000 deaths globally per year (World Health Organisation). Truncating mutations and subsequent loss of the APC (adenomatous polyposis coli) gene is the most common genetic event found in colon adenomas and CRC (75–90% of tumours [1]). Identifying the genes which can reverse key biological changes associated with the loss of APC in CRC cells has broad therapeutic implications. We have investigated the genes which regulate the levels of membrane-associated E-cadherin the CRC cell line SW480. Although APC is implicated in the control of canonical Wnt signalling [2, 3], APC is also involved in a range of other cellular processes including cell migration [4, 5], cell-cell adhesion [6, 7], mitosis [8] and differentiation [5, 9]. These processes are disrupted when APC is truncated.Restoration of full-length APC in APC mutant CRC cells reduces β-catenin/TCF/LEF1 signalling [7, 9] and in SW480 cells the expression of full-length APC leads to functional adhesion junctions, reduced colony growth in soft agar and the SW480-APC cells no longer grow as xenografts in mice [7]. The restoration of full length APC has been accomplished in vivo using a transgenic shAPC/KrasG12D/p53fl/fl mouse model where the expression of APC induced a sustained regression of a colorectal adenocarcinoma and re-establishment of colon crypt homeostasis [9].The loss of functional APC reduces cell-cell adhesion [10]. β-catenin was discovered as a component of an adhesion junctions complex, where it binds to the cytoplasmic tail of E-cadherin in conjunction with α-catenin and links E-cadherin to the actin cytoskeleton [11]. There has been much debate as to whether canonical Wnt signalling and cell-cell adhesion are linked via the regulatory state of β-catenin phosphorylation [12]. E-cadherin can suppress the oncogenic potential of activated β-catenin in models of mousecolon cancer [13]. Thus E-cadherin appears to have a role in tumour suppression, as a regulator of Wnt signalling and cell-cell adhesion. In APC mutant and CTNNB1 mutant adenomas and early stage CRC, E-cadherin expression at the cell membrane appears normal [14]. However, at later stages of CRC, especially in cells at the invasive front, there is a loss of E-cadherin and an increase in nuclear β-catenin [1]. A role for E-cadherin in tumorigenesis is underscored by the increased intestinal tumour burden in Apc+/1638N/Cdh1 +/- mice compared to mice with the Apc+/1638N mutation [15]. The potential of E-cadherin to inhibit the progression of CRCs [13] highlights the need to understand the regulation of E-cadherin levels, location and function in CRC cells with depleted and/or truncated APC.Previous genome-wide studies in CRC models identified genes in the CRC cell line DLD-1 which regulate Wnt/β-catenin signalling in the context of an APC mutation [16, 17]; however, it is unclear whether the apparent effects on Wnt signalling are due to changes in the levels of cell surface E-cadherin. In this study, we performed a protein coding genome-wide screen to identify genes that regulate membrane-associated E-cadherin in APC mutant CRC cells. Loss of APC in CRC cells decreases the level of cell surface E-cadherin [18]. Using a high-throughput screen with siRNA SMARTpools, we have identified genes which suppress or stimulate the level of E-cadherin at the membrane of SW480 cells [19]. Validation and stringent gene-exclusion filters help to eliminate off-target or indirect effects [20] and resulted in the identification of 34 negative regulators and 167 positive regulators of membrane associated E-cadherin. In addition to confirming genes known to regulate the levels of membrane associated E-cadherin, we discovered a number of genes that had not previously been associated with E-cadherin regulation. This screen also revealed that miR200 family members were powerful stimulators of membrane E-cadherin. As well as regulation of E-cadherin, the screen identified anti-proliferative and pro-survival genes, however, there was no relationship between the expression of these genes and E-cadherin levels. Our imaging based screen has identified genes that can regulate membrane-associated E-cadherin in CRC cells deficient for APC and provide a new understanding of the complex mechanisms governing E-cadherin and cell-cell adhesion. The manipulation of genes that can regulate the level of E-cadherin at cell-cell junctions provides potential new targets for therapeutic intervention in CRC.
Results
A genome-wide imaging-based screen to identify regulators of membrane associated E-cadherin in SW480 colorectal cancer cells
To investigate genes that can regulate membrane associated E-cadherin (Ecad) in the APC mutant SW480 CRC cells we carried out a quantitative high-content imaging-based siRNA screen of 18120 protein coding genes. We used siRNA knockdown of ZEB1 and CDH1 as controls to measure increases or decreases in membrane-associated E-cadherin levels, respectively (Fig 1). We developed an image processing algorithm to quantitate automatically the membrane associated E-cadherin (referred to as the Ecad score) (Fig 1 & S1 Fig). Untreated SW480 cells display E-cadherin in occasional patches of cells (Fig 1C); these E-cad patches disappear when the cells are exposed to siCDH1; in contrast, when SW480 cells are treated with siZEB1 most cells express membrane associated E-cadherin (Fig 1A and 1B). As expected, in the mock-transfected cells, there is a small proportion of SW480 cell clusters with membrane-associated E-cadherin staining (Fig 1C). When the cells are transfected with siZEB1, E-cadherin membrane staining is significantly increased in almost all the cells (Fig 1A and 1D). Conversely, none of the SW480 cells treated with siCDH1 have E-cadherin staining at the membrane (Fig 1B) and the Ecad score is 0 (Fig 1D). ZEB1 protein was reduced following treatment with siRNAs targeting ZEB1 (Fig 1E).
Fig 1
Detection of membrane associated E-cadherin in SW480 cells.
Representative images from the screen showing nuclei and E-cadherin staining and the E-cadherin detection algorithm. Cells were treated with siRNA: (A) siZEB1 (increased Ecad), (B) siCDH1 (decreased Ecad) and (C) mock controls. 72 hours later the cells were fixed, permeabilized and stained with Hoechst and αE-cadherin (HECD1). Immunofluorescent images were taken at 20x on the Cellomics ArrayScan. An E-cadherin detection algorithm was applied to the images: Scale bars; 50μm in both upper panels and insert. (D) The quantitation of membrane associated E-cadherin from a representative 384-well plate. Ecad score = average number of E-cadherin fibres detected per cell in a well. The Ecad score was averaged over replicate wells and normalised to the number of control (mock transfected) wells contained on every plate (Ecad score, mock n = 16 wells, siZEB1 and siCDH1, n = 6 wells, mean ± SD). (E) Expression of ZEB1 in SW480 cells treated with individual siRNA duplexes from the SMARTpool (siZEB1 #1–4, as indicated). ZEB1 expression is reduced with each siRNA duplex. The blot is representative of three individual experiments. Shown are cropped images, uncropped blots are included in S1 Raw images; Quantitation of ZEB1 is shown below (mean± SEM) (n = 3). Protein levels were determined using densitometry against the loading control β-tubulin *p<0.05 (exact p values are indicated); one-tailed unpaired t-test vs mock control.
Detection of membrane associated E-cadherin in SW480 cells.
Representative images from the screen showing nuclei and E-cadherin staining and the E-cadherin detection algorithm. Cells were treated with siRNA: (A) siZEB1 (increased Ecad), (B) siCDH1 (decreased Ecad) and (C) mock controls. 72 hours later the cells were fixed, permeabilized and stained with Hoechst and αE-cadherin (HECD1). Immunofluorescent images were taken at 20x on the Cellomics ArrayScan. An E-cadherin detection algorithm was applied to the images: Scale bars; 50μm in both upper panels and insert. (D) The quantitation of membrane associated E-cadherin from a representative 384-well plate. Ecad score = average number of E-cadherin fibres detected per cell in a well. The Ecad score was averaged over replicate wells and normalised to the number of control (mock transfected) wells contained on every plate (Ecad score, mock n = 16 wells, siZEB1 and siCDH1, n = 6 wells, mean ± SD). (E) Expression of ZEB1 in SW480 cells treated with individual siRNA duplexes from the SMARTpool (siZEB1 #1–4, as indicated). ZEB1 expression is reduced with each siRNA duplex. The blot is representative of three individual experiments. Shown are cropped images, uncropped blots are included in S1 Raw images; Quantitation of ZEB1 is shown below (mean± SEM) (n = 3). Protein levels were determined using densitometry against the loading control β-tubulin *p<0.05 (exact p values are indicated); one-tailed unpaired t-test vs mock control.An Ecad score was determined for each target gene in the primary screen in which siRNA SMARTpools targeting 18120 genes were analysed (Fig 2 and S1 Table). While the majority of siRNAs did not affect membrane-associated E-cadherin, the knock down of a relatively small number of genes (453) resulted in increased Ecad scores many comparable to the average E-cad score for siZEB1. The mean E-cad scores for all of the siRNA SMARTpools were plotted relative to mock controls (Fig 2A). Intra-sample normalisation was applied using a fold change to the average mock control per plate and subsequent inter-sample normalisation across plates was applied using a robust z-score normalisation [21, 22]. Conversion of the Ecad score to the robust Z score highlights the small subset of candidate genes that increase E-cadherin upon siRNA knockdown (Fig 2B). The 5.16-fold cut-off for the 231 negative regulators of E-cadherin is equivalent to an Ecad Score of 1.6 -fold greater than mock (normalised). In addition to ZEB1, the screen identified genes with a known association with CRC, including ID2 [23], CDK8 [16], LEF1 [24] as negative regulators of E-cadherin (Fig 2C).
Fig 2
A genome-wide imaging based siRNA screen identifies regulators of membrane-associated E-cadherin in SW480 colon cancer cells.
(A) Membrane associated Ecad scores normalised to mock transfectants for all SMARTpool siRNAs (black) transfected into SW480 cells. Controls are highlighted: mock (blue), siZEB1 (orange), siCDH1 (red) & siPLK1 (green). (B) Mock normalised Robust Z-score (Ecad) plot for SMARTpool siRNA screen. The cut-off for E-cadherin negative regulatory genes is indicated by the red-dotted line (Z-score>5.16); the Z- score cut-off for positive regulatory genes is <0.036. (C) Normalised Robust Z-score (Ecad) (Z-score Ecad) is shown for genes with a functional association with E-cadherin regulation and a gene* with potential miRNA-200 family off-target effects.
A genome-wide imaging based siRNA screen identifies regulators of membrane-associated E-cadherin in SW480 colon cancer cells.
(A) Membrane associated Ecad scores normalised to mock transfectants for all SMARTpool siRNAs (black) transfected into SW480 cells. Controls are highlighted: mock (blue), siZEB1 (orange), siCDH1 (red) & siPLK1 (green). (B) Mock normalised Robust Z-score (Ecad) plot for SMARTpool siRNA screen. The cut-off for E-cadherin negative regulatory genes is indicated by the red-dotted line (Z-score>5.16); the Z- score cut-off for positive regulatory genes is <0.036. (C) Normalised Robust Z-score (Ecad) (Z-score Ecad) is shown for genes with a functional association with E-cadherin regulation and a gene* with potential miRNA-200 family off-target effects.We detected 188 positive regulators of membrane-associated E-cadherin, including genes which have already been implicated in E-cadherin expression, binding and/or stability, such as CTNNBIP1, CTNND1, KIF7 and DUSP4 (Fig 2C and S1 v Table). The Z-scores for these genes are similar to that of the siCDH1 knockdown (e.g.-1.15 for CDH1 compared to -1.12 for CTNND1, Fig 2C). Thus, the high-throughput screen identified genes known to regulate membrane associated cell-cell adhesion as well as a significant number of genes which regulate the level of E-cadherin at cell-cell junctions.
The gene identified as having the highest robust Z-score (UBE2E3*) from the primary screen (Fig 2C) includes effects from an off-target knockdown associated with the micro-RNA (miR)-200 family (S2A Fig), which are known to regulate and repress ZEB1 expression [25, 26]. Given that the miR-200 family has been shown to regulate ZEB1 and E-cadherin, we investigated whether individual siRNAs from the SMARTpool contain the seed sequences similar to the miR-200 family. Specifically, we used the Dharmacon Seed Sequence Analysis pipeline (Dharmacon RNAi Technologies (Horizon Discovery), unpublished tool) to identify any siRNAs that share the same seed sequence as miRNA families (miRBase version 19) (S2A Fig). We identified eleven genes with an Ecad score of >1.6 in the SMARTpool screen that contained a single duplex siRNA that shared the same seed sequence as the miR-200 family (S2B Fig). For 10 of the 11 miR200 family of genes, only 1 of the 4 duplex siRNAs demonstrated a significantly increased E-cad score (S2B Fig) and in each case that duplex contained the same seed sequence as the miR-200 family. The ubiquitin ligase UBE2E3 was the only gene from this list that when knocked down increased the E-cad score with multiple duplexes from the SMARTpool (S2B Fig). Western blot analysis confirmed that all four siRNA duplexes successfully reduced UBE2E3 levels (Fig 3A and 3B). The siUBE2E3 duplex #1, the miR-200 mimic, elicits the largest increase in total E-cadherin with concomitant reduction in ZEB1, as expected. However, UBE2E3 siRNA duplexes #2 and #3 also result in increased E-cadherin levels (Fig 3A and 3B) and membrane-association (Fig 3C). These duplexes did not exert corresponding changes in ZEB1 suggesting the possibility that UBE2E3 siRNA duplexes #2 and #3 regulate membrane E-cadherin via different mechanisms of action that do not involve ZEB1. Collectively, the change in Ecad score for the siRNAs containing the seed sequence is likely due to the regulation of miR-200, however, as UBE2E3 duplexes elicited increases in E-cadherin without altering ZEB1, UBE2E3 may regulate membrane-associated E-cadherin by a different mechanism.
Fig 3
Effect of siUBE2E3 on SW480 membrane-associated E-cadherin.
SW480 cells were transfected with individual siRNA duplexes from the UBE2E3 SMARTpool for 72 hours: (A) Expression of ZEB1, E-cadherin and UBE2E3 were analysed by immunoblot. β-tubulin was used as a loading control. siRNA#1 (1*) shares the same 5’ nucleotide sequence as miR200 family seed sequence. The blot is representative of three individual experiments. Shown are cropped images, uncropped blots are included in S1 Raw images; (B) Quantitation of E-cadherin, ZEB1 and UBE2E3 protein levels upon siUBE2E3 knockdown in SW480 cells. Protein levels were determined using densitometry against the loading control β-tubulin and are representative for triplicate experiments (mean± SEM) *p<0.05 (p = 0.026 and p = 0.039 for si UBE2E3 1 and 3, respectively), **p<0.005 (p = 0.00247), ***p<0.001 for E-cadherin and UBE2E3 or duplicate experiments (mean ± sd) for ZEB1 *p = 0.023, **p = 0.0035, ***p<0.001; one-tailed unpaired t-test vs mock control; (C) Immunofluorescence staining of E-cadherin in fixed SW480 cells, 72 hours post treatment with siUBE2E3 siRNA duplexes #1, 2, 3 or mock control. Scale bar; 50μM.
Effect of siUBE2E3 on SW480 membrane-associated E-cadherin.
SW480 cells were transfected with individual siRNA duplexes from the UBE2E3 SMARTpool for 72 hours: (A) Expression of ZEB1, E-cadherin and UBE2E3 were analysed by immunoblot. β-tubulin was used as a loading control. siRNA#1 (1*) shares the same 5’ nucleotide sequence as miR200 family seed sequence. The blot is representative of three individual experiments. Shown are cropped images, uncropped blots are included in S1 Raw images; (B) Quantitation of E-cadherin, ZEB1 and UBE2E3 protein levels upon siUBE2E3 knockdown in SW480 cells. Protein levels were determined using densitometry against the loading control β-tubulin and are representative for triplicate experiments (mean± SEM) *p<0.05 (p = 0.026 and p = 0.039 for si UBE2E3 1 and 3, respectively), **p<0.005 (p = 0.00247), ***p<0.001 for E-cadherin and UBE2E3 or duplicate experiments (mean ± sd) for ZEB1 *p = 0.023, **p = 0.0035, ***p<0.001; one-tailed unpaired t-test vs mock control; (C) Immunofluorescence staining of E-cadherin in fixed SW480 cells, 72 hours post treatment with siUBE2E3 siRNA duplexes #1, 2, 3 or mock control. Scale bar; 50μM.
Identification of pro-survival and anti-proliferative genes
Prior to validation with the individual siRNAs from the SMART pool, the candidate gene list was refined by applying several filters to the screening analysis pipeline (S3 Fig). Firstly, cell counts were used to assess toxicity. 176 siRNAs had a clear impact on cell viability (i.e. when the cell count < 1500 cells in 25 Fields of View (FOV) [22]); these genes were excluded as specific E-cadherin regulators (S1ii Table & S3iii Fig). It should be noted that siCDH1 did not reduce the SW480 cell counts, i.e. loss of membrane associated E-cadherin was not cytotoxic.The high-throughput screen identified that the knock down of 176 genes reduced cell proliferation (S1 ii Table). The nuclear staining from representative fields for two pro-survival genes, CASP8AP2 and TUBA1B, demonstrates the reduced cell count compared to mock control transfected cells (S4A Fig). Previous gene screens designed to detect genes essential for cell production have identified the ribosomal, mitosis and the proteasome/ubiquitin systems as important for proliferation [27, 28]. Similarly, our screen identified genes in each of these categories: 19 ribosomal genes including 14 RPL genes and 5 RPS genes; cell division and mitosis genes such as CDK1, INCENP, KMT5a, PLK1 and ZNF207; and proteasome/ubiquitin genes such as PSMD6, PSMD7, UBA52, UBB and UBC. Interestingly, the earlier screen on breast cancer cell lines [28] and our screen identified that knocking down the Notch inhibitory gene NUMB is cytotoxic. While these ‘pro-survival’ genes were ruled out as specific E-cadherin regulatory genes, their expression in SW480 (mutant APC) cells was compared to that in SW480+APC (restored APC) cells in order to identify genes that are differentially expressed as a result of loss of function of APC [7, 29]. We identified 7 genes (POLR2A, SYNGR1, CST3, FOXD1, ETV3, OLR1, GRIP2) that are important for the survival of SW480 cells. We note that POLR2A, CST3, FOXD1 and ETV3 also show differential expression in 4 other CRC cell lines with wild-type APC (HCT116, LIM1215, LIM1899 and RKO) [30]. As well as pro-survival, we identified 37 anti-proliferative genes whose depletion promotes SW480 cell proliferation. Genes were termed anti-proliferative based on a decreased number of FOV that were required to reach the target cell count (S1 iii Table). The average number of FOV to reach the target count of 3000 cells for the mock control wells in the primary screen was 20±3.13 (mean±SD, n = 464) (S1 vii Table). The anti-proliferative genes reached the target cell count at 2 standard deviations below the mean FOV (i.e. <15 FOV) and showed no effect on membrane associated levels of E-cadherin. SW480 cells treated with siRNAs targeting four of these genes, ITPRIP, CLRN3, HOXC4 and MDP1, showed greatly increased numbers of cells/field (S4B Fig). The anti-proliferative genes included phosphatases, homeobox, cell junction and ADP-ribosylation factors. Interestingly, the depletion of magnesium-dependent phosphatase 1 (MDP1) has been implicated as a poor prognostic factor in gastric cancer [31]. Thus our screen identified targets that regulate proliferation in addition to pro-survival genes. Genes with an Ecad score <0.2 and >1.6-fold (positive and negative regulators, respectively) were considered as candidate E-cadherin regulators and were validated further (S3iv Fig). Genes where the expression was low (RPKM <1) [29] were removed because any changes in Ecad Score with these siRNA was considered unreliable (S3v Fig). Finally, the siRNAs containing seed sequence enrichment for the miRNA 200 family were removed (S3vi Fig).
Novel regulators of E-cadherin
The 419 genes that appeared to regulate membrane-associated E-cadherin levels directly were re-screened using each of the four siRNAs from the SMARTpool (S3vii Fig). Genes were only considered valid hits when changes in E-cad score occurred with at least 2 siRNA [32]. The deconvolution screen identified 201 genes that regulate membrane associated E-cadherin in SW480 cells comprising 34 negative regulators of E-cadherin (siZEB1-like, Ecad high genes) (S2 Table and Fig 4A) and 167 positive regulators of E-cadherin (Ecad low) (S3 Table and Fig 4A). We identified several genes that have been reported previously to be important in the regulation of cell-cell adhesion including CTNNA1, CTNND1 and ZEB1.
Fig 4
siRNAs which alter SW480-membrane-associated E-cadherin.
(A) Summary of the outcome of the secondary validation screen. The number of active siRNA for E-cadherin negative and positive regulators are indicated. At least 2 out of 4 siRNA duplexes must statistically recapitulate the primary SMARTpool screen to be considered a hit. (B) Representative images from the deconvoluted screen of αE-cadherin and Hoechst staining, 72 hours post transfection of positive regulators with selected duplex siRNAs (25nM) for mock, CTNNBIP1, CTNND1, DOCK3, DUSP4 and ITGB4. Scale bar; 50 μM, 20x magnification. (C and D) Functional categorization of candidate E-cadherin positive (C) and negative (D) regulatory genes identified from the screen (Panther Classification GO-Slim Molecular Functions, System Version 15.0).
siRNAs which alter SW480-membrane-associated E-cadherin.
(A) Summary of the outcome of the secondary validation screen. The number of active siRNA for E-cadherin negative and positive regulators are indicated. At least 2 out of 4 siRNA duplexes must statistically recapitulate the primary SMARTpool screen to be considered a hit. (B) Representative images from the deconvoluted screen of αE-cadherin and Hoechst staining, 72 hours post transfection of positive regulators with selected duplex siRNAs (25nM) for mock, CTNNBIP1, CTNND1, DOCK3, DUSP4 and ITGB4. Scale bar; 50 μM, 20x magnification. (C and D) Functional categorization of candidate E-cadherin positive (C) and negative (D) regulatory genes identified from the screen (Panther Classification GO-Slim Molecular Functions, System Version 15.0).Reduced E-cadherin membrane staining is evident following treatment with individual siRNA duplexes for CTNNBIP1, CTNND1, DOCK3, DUSP4 and ITGB4 (Fig 4B). Among positive regulators, we identified CTNNBIP1 (β-catenin-TCF4 interaction inhibitor 1) a beta-catenin signalling inhibitor that also has a role in cadherin-based adhesion [33] and is upregulated in SW480+APC cells (restored APC) compared to SW480 cells [29]. The identification of transcriptional regulator RUNX2 and its downstream target TRAM2 as positive regulators, suggests a regulatory role for this pathway in cell-cell adhesion. Other positive regulators include REP15, STAT5A, PI4K2A, ITGB4, MARK2, TEAD3, DUSP4, RIPK1 and ALDH9A1. In several cases the knockdown of these genes has been correlated with invasion and loss of E-cadherin, but this is the first time that an association between the expression of these genes and the levels of membrane associated E-cadherin has been reported. For example, ITGB4 has been implicated in CRC progression and as a miR-21 target which represses ITGB4 leading to increased CRC cell migration [34]; STAT5A has been shown to promote E-cadherin and negatively regulate cell migration and invasion [35]; and MARK2 has been linked to regulation of epithelial polarity [36]. DOCK3 (a RAC1-GEF) has been shown to regulate cell adhesion in non-small cell lung cancer cells [37]. The MAP kinase phosphatase DUSP4 has been implicated in CRC proliferation [38] and in promoting E-cadherin expression in non-small cell lung cancer [39]. Gene ontology (GO) analysis showed that genes identified as both positive and negative regulators of E-cadherin are enriched for ‘Binding’ and ‘Catalytic Activity’ (Fig 4C and 4D; S2 and S3 Tables) and many of them function in cell-cell adhesion and endocytosis. In addition, STRING analysis which assesses and integrates protein associations [40] showed a significant enrichment of interactions (P = 0.000124) of positive E-cadherin regulators. This included binding and catalytic activity GO terms and identified functional enrichment in cell junction organisation and signalling by receptor tyrosine kinases reactome pathways (S2 Table).Negative regulators of E-cadherin include genes involved in a range of cellular pathways such as CDK8, a β-catenin regulator; SNX27, a member of the sorting nexin family of genes [41]; ESP8L1, a gene related to epidermal growth factor receptor pathway substrate 8 (EPS8) [42]; and ZNF518A, a zinc finger gene known to interact with histones [43] (S2 Table). E-cadherin immunostaining for ZEB1 as well as CDK8, SNX27, EPS8L1 and ZNF518A and their corresponding Ecad score for each of the four duplexes is shown in Fig 5. E-cadherin immunostaining is shown for the siRNA duplex that elicited the highest Ecad score. As distinct from the positive regulators where 4/4 and 3/4 of the siRNA duplexes reduced the levels of E-cadherin, aside from ZEB1, only 2/4 siRNA increased the levels of membrane associated E-cadherin for the remaining negative regulators. For UBE2E3 3/4 of the siRNA increased membrane-associated E-cadherin but duplex #1 contained a miR-200 seed sequence and markedly suppressed ZEB1 (see Fig 3). We investigated the potential role of sorting nexin 27 (SNX27) and matrix metalloproteinases MMP14 and MMP19 in more depth (S5 and S6 Figs). SNX27 facilitates recycling of endocytosed membrane-associated proteins by linking the endosome associated cargo to a retromer complex that can recycle the cargo back to the plasma membrane. Depletion of SNX27 was confirmed (S5A and S5B Fig) and resulted in increased membrane associated E-cadherin in SW480 and HCT116 cells (S5C–S5E Fig). The increased E-cadherin upon SNX27 depletion suggests a novel role for SNX27 in post-transcriptional regulation of E-cadherin. We chose the SW480+APC cells to test whether overexpression of SNX27 would reduce cell-cell adhesion in cells with functional adherens junctions. Expression of SNX27GFP, but not the functionally disrupted SNX27H114A mutant, resulted in loss of membrane associated E-cadherin in SW480+APC cells (S5F and S5G Fig). The mutation of the evolutionary conserved His114 to Ala (SNX27H114A) abrogates binding of the PDZ domain of SNX27 to PDZ binding domain containing cargo [41]. In SNX27-H114A-GFP expressing cells E-cadherin distribution is not disrupted (S5F and S5G Fig). These results show that SNX27 regulates cell-cell adhesion via an interaction with a PDZ-domain-binding protein. We noted a reverse correlation between expression of E-cadherin and SNX27 in CRC cells (S5H Fig) and between E-cadherin and ZEB1 (S5I Fig). We found that SNX27 depletion is linked to changes in ZEB1 (S5J Fig). As depletion of ZEB1 did not change the level of SNX27 (S5K Fig) the potential regulation of E-cadherin by SNX27 is not downstream of ZEB1.
Fig 5
SW480-membrane associated E-cadherin can increase when negative regulators are knocked down.
Representative images from the deconvoluted screen of αE-cadherin, 72 hours post transfection of selected duplex siRNAs (25nM, duplex # indicated in brackets) for mock, ZEB1, CDK8, SNX27, EPS8L1 and ZNF518A. Scale bar; 50 μM, 20x magnification with enlarged images for E-cadherin shown below. Hoechst staining shows cell nuclei. Mock normalised Ecad score for individual siRNA (numbered 1–4) in the deconvolution screen is shown below.
SW480-membrane associated E-cadherin can increase when negative regulators are knocked down.
Representative images from the deconvoluted screen of αE-cadherin, 72 hours post transfection of selected duplex siRNAs (25nM, duplex # indicated in brackets) for mock, ZEB1, CDK8, SNX27, EPS8L1 and ZNF518A. Scale bar; 50 μM, 20x magnification with enlarged images for E-cadherin shown below. Hoechst staining shows cell nuclei. Mock normalised Ecad score for individual siRNA (numbered 1–4) in the deconvolution screen is shown below.RNA sequencing revealed that MMP14 and MMP19 were upregulated in parental SW480 compared to SW480+APC cells (S6A Fig) [29]. MMP14 and MMP19 levels are also higher in HCT116 LIM1215 and LIM1899 CRC cells which contain wild-type APC [30]. MMP14 and MMP19 elicited Ecad scores of 1.48 and 1.56 in the primary screen, prompting further investigation. We noted that MMP14 protein levels negatively correlate with E-cadherin in CRC cell lines (S6B Fig). Depletion of MMP14 (with siRNA#2) and MMP19 resulted in increased E-cadherin protein but not mRNA (S6C–S6E and S6G–S6I Fig) for MMP14 and MMP19, respectively) suggesting post-transcriptional regulation of E-cadherin that results in altered membrane associated E-cadherin. Depletion of MMP14, but not MMP19, resulted in reduced ZEB1 (S6F and S6J Fig) but ZEB1 depletion did not change the levels of either MMP14 or MMP19 transcript (S6D and S6H Fig). Thus MMPs 14 and 19 appear to regulate E-cadherin at a post-transcriptional level that results in membrane-associated E-cadherin.Our imaging based screen has identified new candidate genes which regulate the level of membrane-associated E-cadherin, as well as several known positive and negative regulators of cell-cell adhesion in SW480colorectal cancer cells (Fig 6). These results demonstrate the diversity of regulatory mechanisms which can influence the level of membrane associated E-cadherin.
Fig 6
Model for the regulation of junctional E-cadherin.
Schematic representation of biological processes identified in the siRNA screen for regulation of membrane-associated E-cadherin: 1. Gene transcription; 2. miR regulation (eg miR200 family); 3. Recycling of anti-adhesive or retention of pro-adhesive cargo by SNX27; 4. Inhibition of β-catenin/Tcf transcription; 5. Lysosomal or proteosomal degradation; 6. Translocation; 7. MMP14/MMP19-mediated regulation. Negative (red) and positive (green) arrows and boundaries indicate regulation of membrane-associated E-cadherin are indicated.
Model for the regulation of junctional E-cadherin.
Schematic representation of biological processes identified in the siRNA screen for regulation of membrane-associated E-cadherin: 1. Gene transcription; 2. miR regulation (eg miR200 family); 3. Recycling of anti-adhesive or retention of pro-adhesive cargo by SNX27; 4. Inhibition of β-catenin/Tcf transcription; 5. Lysosomal or proteosomal degradation; 6. Translocation; 7. MMP14/MMP19-mediated regulation. Negative (red) and positive (green) arrows and boundaries indicate regulation of membrane-associated E-cadherin are indicated.
Discussion
APC mutation, as occurs in 80% of CRC, disrupts crypt homeostasis and results in loss of regulation of a number of biological processes: Wnt signalling (through deregulation of β-catenin), chromosomal stability, cell-cell adhesion and cell migration [5]. Loss of E-cadherin, the interacting partner of β-catenin at cell-cell junctions, is classically associated with an invasive cancer-cell phenotype however it has also been shown to provide a barrier to tumour development in the colon [13]. In our genome-wide imaging-based screen we have identified new processes which regulate the levels of junctional E-cadherin (Fig 6). The screen revealed 34 negative regulators (i.e. genes encoding proteins or microRNAs which decrease the level of E-cadherin) and 167 positive regulators of the levels of membrane associated E-cadherin.In contrast to two previous E-cadherin RNAi screens [44], we were able to measure membrane associated E-cadherin directly and in an unbiased manner using a cell line that had not been modified to overexpress protein and/or viral vectors. Our screen is therefore unique in its capacity to identify genes that regulate junctional E-cadherin. The findings share some overlap with previous studies, including the identification of negative regulators Caspase 7 (CASP7) and Keratin 13 (KRT13) as well as positive regulator such as Nudix-type motif 21 (NUDT21) and members of the RAS oncogene family (RAB-39 -4B and 7A) [44]. By incorporating our RNA-sequencing data from SW480 and SW480+APC cells in the analysis, we have also identified 7 candidates with increased expression in the tumorigenic cancer cell compared to the non-tumorigenic SW480+APC cells, that render cancer cell death upon knockdown and are therefore promising targets for colon cancer therapy.Although we calibrated the siRNA screen to detect genes which regulate E-cadherin specifically, we also measured the effect of each siRNA on the proliferation and viability of the SW480 cells. Many of these genes have been reported as cytotoxic in other siRNA or CRISPR knockdowns [22, 45] and are presumably essential for the viability of both normal and cancer cells, e.g. the ribosomal protein, the polo kinases, DNA polymerases, centromere proteins and proteasome associated genes; however, some of the cytotoxic genes should be considered as potential targets for colon cancer therapeutics, e.g. CDK1 [46], CASP8AP2 [47] and tuftelin-1.We found that among the highest scoring hits in the primary screen of the siRNA pools, individual siRNA duplexes were responsible for the increased Ecad score and these invariably contained a miR-200 family seed sequence targeting these microRNAs rather than specific genes. Regulation of E-cadherin and ZEB1 by miR-200 family members is well established [25, 26] but the results of this unbiased screen underscore the importance of the miR200 family in E-cadherin regulation. Our investigation of the miR200 seed sequences of candidate genes did enable us to identify UBE2E3 as a negative regulator that likely does not involve regulation of ZEB1, as increased E-cadherin with UBE2E3 duplexes did not result in associated changes in ZEB1.CDK8 has been identified as a marker of poor prognosis for patients with advanced colorectal cancer [16]. When CDK8 levels are elevated, cytoplasmic (i.e. activated) β-catenin increases. In our study reducing the levels of CDK8 leads to increased junctional E-cadherin and sequestration of β-catenin from the cytoplasm. Interestingly, BMP4 stimulates a YAP dependent increase in CDK8 [48] which would also reduce junctional E-cadherin and contribute to cancer associated EMT.Our identification of SNX27 as a negative regulator of membrane associated E-cadherin suggest a novel function for SNX27. SNX27 has an established role in facilitating recycling of endocytosed membrane-associated proteins by linking endosome associated cargo to a retromer complex [49]. SNX27 has been implicated in regulation of ZO-2 dynamics at the cell membrane, however, in contrast to our experiments, SNX27 was shown to promote the rate of ZO-2 recovery at the membrane [50]. It is intriguing to speculate that SNX27 may have dual functions in the regulation of junctional proteins that may include recycling membrane-associated proteins or protein trafficking. Our studies point to a requirement for the PDZ domain of SNX27, through which SNX27 has been shown to interact with PDZ binding motifs of cargo proteins [41, 49]. While the candidate cargo protein and exact mechanism for SNX27 regulation of E-cadherin is not yet clear, the SNX27 interactome which includes proteins involved in cell polarity, Wnt signalling or the shedding of cell surface receptors [51] suggest a mechanism that involves recycling proteins that are potentially ‘anti-adhesive’.Matrix metalloproteinases have been implicated in cell invasion, growth and survival. Our findings suggest that MMP14 and MMP19 also regulate membrane-associated E-cadherin. It is plausible that upregulation of MMP14 and MMP19 as a consequence of dysregulated Wnt signalling [29] promotes a tumourigenic phenotype through disruption of cell-cell adhesion, however the exact mechanism is not clear. Our data show post-transcriptional regulation of E-cadherin levels and suggest that MMP14 and MMP19 serve as modulators of membrane-associated E-cadherin, through cleavage or modification of a yet to be identified protein.Our understanding of the role of APC defects and Wnt signalling in the development and progression of CRC is still improving. Previous studies have identified mechanisms by which β-catenin controls Wnt stimulated expression; APC depletion also changes the periphery of cells, e.g. at the cell-cell junctions [52]. These changes are characterized by decreases in E-cadherin and other cell junctional proteins. Our discovery of a small set genes which can modulate membrane associated E-cadherin levels, not only points the way to discovering mechanisms to control cell-cell junctions, but offers a new set of targets for targeting colon cancer. The most potent gene knockdowns, which increased the levels of E-cadherin, were associated with off-target effects associated with the mir200 family, so reagents which control the action of those non-coding RNAs have potential as CRC therapeutics. Similarly, drugs which target any one of the genes which inhibit the accumulation of E-cad at the membrane (e.g. UBE2E3) have the potential to inhibit oncogenesis associated with the depletion of APC.
Materials and methods
siRNA screening process
Cells were transfected with 40nM/well of siRNA from the Dharmacon siGENOME SMARTpool protein coding library (RefSeq v.27). The concentration of siRNA used in the deconvolution screen was 25nM/well. The screens were performed in 384 well plates. Lipofectamine 2000 (0.06μl/well) and Opti-MEM (10.94 μl/well) and siRNA were robotically dispensed (Sciclone ALH3000, Perkin Elmer) into each well and incubated at room temperature for 15 mins. In the SMARTpool screen the following controls were used in columns 2 and 23: mock transfection, lipid and Opti-MEM, no siRNA = 16 wells, siCDH1/ZEB1/PLK1 = 6wells. In the deconvolution secondary screen: mock = 31 wells, siCDH1 or siZEB1 = 13 wells, siPLK1 = 4 wells. Cells were then robotically dispensed (2000 cells in 25ul media, minus antibiotics, per well using a BioTek406 automated dispenser, BioTek, Vermont, USA) into each well and incubated for 72 hours. Cells were fixed (25 μl/well of 4%PFA/PBS for 10mins), permeabilised (25 μl/well of 0.2% triton-X in 0.2%BSA/PBS for 5mins) using the BioTek406. The cells were incubated with αEcad (HECD1) antibody (25 μl/well, 1:200 dilution, for 1 hour) followed by goat anti-mouseAlexa Fluor-488 secondary antibody (25 μl/well 1:500 dilution, for 1 hour in the dark) and finally incubated with Hoechst 33342 (50μM) for 10mins. Three wash steps using blocking buffer were performed between each antibody incubation. All materials were dispensed robotically. The cells were then imaged on the Cellomics ArrayScan VTi (see S1 Fig for more details).
SW480 cells were acquired directly from the American Type Culture Collection (ATCC CCL228). SW480 cells were cultured in RPMI supplemented with 1.08% thioglycerol, 50mg/ml hydrocortisone, 100U/ml insulin, 10% foetal calf serum (plus 1.5mg/ml G418 for the SW480+APC cells [7]. Thioglycerol is used in culture media to stimulate proliferation and we have found that this provides consistent growth conditions, but the cells do not require thioglycerol for their growth. HCT116 and Difi cells were acquired from Oliver Sieber [30]. HCT116 [53] and Difi [54] cells were cultured in DMEM supplemented with 10% foetal calf serum. All cell lines were cultured at 37 C in a 10% CO2 incubator. Cell lines were tested for mycoplasma (WEHI antibody facility) and verified to be mycoplasma free prior to starting experiments. All cell lines were authenticated by STR (short tandem repeat) profiling analysis at the Australian Genome Research Facility (AGRF) (Parkville, VIC, Australia) using the GenePrint 10 System (Promega) [30].
siRNA transfections
3x105 cells were reverse transfected with 40nM of siRNA and 5μl lipofectamine 2000 (according to manufacturer’s instructions) in 6-well plate format. Twenty four hours post transfection the cells were washed once with PBS and replaced with 3mls of media. Individual siRNA for deconvolution studies (Dharmacon catalog numbers): SNX27: #1 D-017346-01_GUACGUAAAUUGGCACCUA; #2 D-017346-02_GGAACAACGGUUACAGUCA; #3 D-017346-03_CCAAGUAUAUCAGGCUAUC; #4 D-017346-04_GUGAAUUACUUUGCCUUAU. MMP14: #1 D-004145-01_GAACAAAUACUGGAAAUUC; #2 D-004145-02_GGUCUCAAAUGGCAACAUA; #3 D-004145-03_GCAAAUUCGUCUUCUUCAA; #4 D-004145-04_UCAAAUGGCAACAUAAUGA. MMP19: #1 D-004048-01_UGGACUACCUGUCACAAUA; #2 D-004048-03_GUGUGGCGCUACAUUAAUU;#3 D-004048-04_CUACUCGCCUCGAACACAA; #4 D-004048-18_GCGCAUCAUUGCAGCCCAU. ZEB1 SMARTpool L-006564-01.
Plasmid DNA transfections
2x106 SW480+APC cells were plated into 60mm tissue culture dishes. The following day 2μg of pEGFP-C1 (pCTRL-GFP), pEGFP-C1-SNX27 (pSNX27-GFP) or pEGFP-C1-SNX27-H114mut (pSNX27-H114-GFP) were transfected using 5μl of Fugene HD into fresh media.
RNA preparation and RT-PCR analysis
mRNA was extracted and purified using Illustra RNAspin Mini Kit (#25-0500-70 GE LifeSciences). The cDNA was prepared from mRNA using High Capacity cDNA Reverse Transcription Kit (#4368814 AB Applied Biosystems). The cDNA was then amplified in a reaction volume of 25μl using PowerSYBR Green PCR Master Mix (#4367659 Applied Biosystems). GAPDH was used as the house keeping gene. The samples were amplified in a 7300 Real-Time PCR system (Applied Biosystem)and the data was analysed using SDS software version 4.0 (Applied Biosystem) using the ΔΔCT method. The following primers were used: GAPDH FWD: CAATGACCCCTTCATTGACC, REV: TGATGACAAGCTTCCCGTTC; CDH1 FWD: GAACGCATTGCCACATACAC, REV: ATTCGGGCTTGTTGTCATTC; MMP14 FWD: GCAGAAGTTTTACGGCTTGC, REV: TAGCGCTTCCTTCGAACATT; MMP19 FWD: GCTTCCTACTCCCCATGACA, REV: GCCTCGGTGATATCTTCTGG; ZEB1 FWD: GCCAATAAGCAAACGATTCTG, REV: TTTGGCTGGATCACTTTCAAG.
Western blot analysis
Cells were washed once with ice-cold PBS. The cells were lysed directly using ice-cold lysis buffer (1M HEPES pH7.4, 5M NaCL, 0.5M EDTA, 10% Triton X-100, 10% Na Deoxycholate, 1x PhosStop (#04906837001 Roche) and 1x Complete EDTA-free protease inhibitor cocktail (#04693159001 Roche)) followed by 30mins incubation on ice. Lysates were centrifuged at 13,000 rpm for 30mins at 4˚C. Protein levels were standardised using a BCA protein kit (Pierce). The lysate was boiled in 2x Sample buffer (0.5M Tris-HCl pH6.8, 10% glycerol, 20% SDS (10% stock), 5% β-Mercaptoethanol, 5% Bromophenol blue (0.5% stock). Total cell lysates were analysed by SDS-PAGE (4–12% gradient gel (Thermo Fisher Scientific)), electro-transferred onto nitrocellulose membrane and blocked overnight (5% skimmed milk/TBS-T) at 4˚C prior to immunoblotting with antibodies. The levels of protein were quantified using densitometry, normalized to β-tubulin.
Immunofluorescence staining
Cells were fixed (4% PFA/PBS), permeabilized (0.2% Triton-X/0.2%BSA/PBS) and blocked in blocking buffer (0.2%BSA/PBS) for 1 hour at room temperature. Primary antibodies were diluted in blocking buffer and used according to manufacturer’s instructions. The cells were washed 3 times in blocking buffer and secondary-fluorescent tagged antibodies were diluted 1:500 in blocking buffer and incubated for 1 hour at room temperature. The cells were washed 3 times in PBS and incubated with DAPI (#10236276001 Roche Diagnostics) or Hoechst 33342 (#B2261 Sigma-Aldrich) to stain nuclei.
Statistical analysis
Statistical analyses were performed using an unpaired one-tailed Student’s t-test, unless otherwise described. The statistical analysis for the screen is detailed in S1 and S3 Figs. Data presented graphically are the means ± standard error of the mean (SEM) for three independent experiments unless otherwise stated.
Screening process & image analysis.
SW480 cells were thawed from liquid nitrogen and passaged so that for each round of transfections the cells were transfected at passage 5 and at day 8 post thaw. SW480 cells were reverse transfected using lipofectamine 2000 and 40nM of SMARTpool siRNA (Dharmacon RNAi Technologies) for the primary screen, and 25nM of the individual duplex siRNA in the deconvolution screen. The siRNA library (RefSeq v.27) was accessed through, and the screen performed at, the Victorian Centre for Functional Genomics (VCFG), Peter MacCallum Cancer Centre. Transfections took place in optical, black walled 384-well plates. All transfections and wash steps were carried out using the Caliper Sciclone ALH3000 and BioTek 406 liquid handling robots available at the VCFG. Cells were washed with 40μl of PBS and replaced with 40μl of fresh media 24 hours post transfection (medium flow rate). At 72 post transfection, the cells were fixed in 4% PFA/PBS, permeabilised, immunostained with αE-cadherin (HECD1) then Alexafluor-488 αmouse antibodies and co-stained with Hoechst 34442 to mark the nuclei. The plates were then imaged on the Cellomics ArrayScan VTi HCS Reader at 20X magnification using the Cellomics Morphology V.4 Bioapplication (see S1vi Table for algorithm settings). Briefly cells were identified in channel 1 using Hoechst stain. Identification of cells allowed the algorithm to identify cell number. This count is important for cell health, proliferation and toxicity reports, and to quantify E-cadherin levels (1). The algorithm created a ring around the nuclei edge. The ring was expanded away from the cell nucleus to identify a whole cell mask for each cell. The whole cell mask is required to quantify E-cadherin (2). E-cadherin staining was identified in channel 2 using the ‘fibre detection’ algorithm. Briefly the algorithm parameters were set to detect long fibre-like αEcad staining (3). The Ecad score was defined as the quantity of all E-cadherin fibres from channel 2 within the modified whole cell mask from channel 1. The mean Ecad score is then quantified as the total number of fibres within the cell mask in an entire well, divided by the number of cells detected in step 1 (4).(PDF)Click here for additional data file.
siRNAs with sequence identity to the mir200 family.
(A) Gene targets with a single siRNA duplex that encodes a miR-200 family seed sequence (see S3, part vi Fig). (B) Dharmacon micro-RNA seed sequence analysis was carried out on the SMARTpool siRNA sequences of 454 genes. siRNAs with sequence identify to the seed sequence on the miR-200 family increased the levels of membrane-associated E-cadherin. These miRNA have a defined role in E-cadherin regulation and therefore any changes with these siRNA are likely caused by a direct effect on miRNAs rather than a specific gene.(PDF)Click here for additional data file.
Data analysis workflow.
The Dharmacon SMARTpool protein coding library comprised 18120 genes (RefSeq v.27) and was screened in 384 well format, duplicate plates per transfection (i). Raw cell count (total number of cells identified from Hoechst stain/well) and Ecad score were averaged over the duplicate plates for all controls and SMARTpool siRNAs. The total number of mock control wells were averaged per plate (16 wells per primary screen plate and 31 wells per deconvolution screen plate). The raw cell count and Ecad Scores for all SMARTpool siRNAs and the remaining control siRNAs were then normalised to the mock control (from the same plate) (ii). siRNAs were excluded from further analysis based on low cell counts (iii). siPLK1 was used as a toxicity gene control to assess and define cut-off scores for low cell count and to ensure reproducible transfection conditions each transfection. siRNA were binned into the following Cell Viability categories based on cell count; CV1, CV2 and Low Count (LC). CV1: ≥ 0.7 -fold vs mock, CV2: ≥ 0.5 <0.7 -fold vs mock, LC: < 0.5 -fold vs mock. The target cell count per well was set to 3000 and the maximum number of fields was set to 25 to be binned into CV1 category. The minimum number of cells per field was set at 14 and the maximum number of continuous sparse fields (ie fields where there are less than 14 cells) was set to 6. siRNAs in the LC category (i.e <1500 cell count in 25 FOV) were excluded from further analysis. siRNAs were removed from further analysis based on Ecad score (iv). siZEB1 and siCDH1 were used as Ecad Score positive controls to assess and define cut-off values for the high and low Ecad thresholds. siRNAs were binned into the following Ecad Score categories; High (siZEB1 like siRNA): Ecad score 1.6≥ -fold vs mock, NC: Ecad score >0.2, <1.6 –fold vs mock, Low (siCDH1 like siRNA): Ecad score ≤0.2 –fold vs mock. siRNAs were not analysed further if they had an Ecad score in the NC category (v). RNA from SW480 cells was sequenced and analysed [1]. The siRNA targeting genes that had an RPKM of less than 1 were removed from further consideration on the premise that any changes in Ecad Score upon transfection with these siRNA may be attributed to off-target effects (v). microRNA seed sequence analysis was carried out on the SMARTpool siRNA sequences of 454 genes and compared against 3 times as many genes that had 0 Z score from the primary screen (Dharmacon RNAi Technologies unpublished program). siRNAs were removed on the basis that they had sequence identity to the seed sequence of the miRNA-200 family (vi). These miRNA have a defined role in E-cadherin regulation and therefore any changes with these siRNA are likely caused by a direct effect on miRNAs rather than a specific gene. siRNAs that passed the multiple filtering steps were then screened in the deconvolution validation screen (vii). The results from the primary screen revealed an abundant number of genes that had scored Ecad Low. The dynamic range for these genes was relatively small compared to the Ecad high genes (see S1I Table). From our own and other laboratories experience in culturing SW480 cells, we observe a higher ratio of cells with junctional E-cadherin when cells are grown to a high passage number and at increased cell density By increasing the Ecad score dynamic range between mock and siCDH1, variations in Ecad score were easier to identify between individual siRNA. We were able to increase the dynamic range by transfecting the cells at a higher passage number [2] and density (3000 cells/well) and without affecting the siCDH1 Ecad score (remains at zero). The Ecad high screen transfection was carried out under the same conditions as the primary screen. Genes were scored out of 4 individual siRNA for Ecad Score and removed from further analysis if they scored <2 active siRNAs (vii). 34 genes had a High Ecad Score (siZEB1 like genes) and 167 had a Low Ecad Score (siCDH1 like genes).(PDF)Click here for additional data file.
Pro-survival and anti-proliferative genes identified in the screen.
(A) Pro-survival genes. The number of cells/field is reduced when pro-survival genes are knocked down. Representative images from the screen of Hoechst staining 72 hours post transfection of siRNAs for mock, CASP8AP2 and TUBA1B. Scale bar; 50 μM. (B) Anti-proliferative genes. The number of cells/field is increased when anti-proliferative genes are knocked down. Representative images from the screen of Hoechst staining 72 hours post transfection of siRNAs for mock, ITPRIP, CLRN3, HOXC4 and MDP1. Scale bar; 50 μM.(PDF)Click here for additional data file.
SNX27 is a negative regulator of membrane associated E-cadherin expression in CRC cells.
(A) Whole cell lysate immunoblot analysis siSNX27 knockdown in SW480 cells. Cells were transfected using identical siRNA oligo sequences that were used in the screen for SNX27 or ZEB1 (SMARTpool) and protein levels were assessed 72 hours later. The blot was probed with antibodies against E-cadherin, SNX27 and β-tubulin (loading control) and is representative of 4 individual experiments. (B and C) Quantification of SNX27 (B) and E-cadherin protein (C) levels upon siSNX27 knockdown in SW480 cells (n = 4). Protein levels were determined using densitometry against the loading control β-tubulin and displayed as the mean ± SEM For SNX27 (B) ***p<0.001 for all samples vs mock control; for E-cadherin (C) ***p<0.001 for SNX27 si #1; **p<0.01 (p = 0.006 for SNX27si #2, and p = 0.005796 for ZEB1 si), *p<0.05 (p = 0.02 and p = 0.028 for SNX27si #3 and 4, respectively), for all samples vs mock control, paired one-tailed Student’s t-test. (D and E) SNX27 depletion promotes junctional E-cadherin in SW480 cells (D) and HCT116 cells (E). E-cadherin (Ecad) (green), SNX27 (red) and nuclei (DAPI) (blue). Scale bar 50μm. (F and G) SNX27 regulates cell adhesion through an interaction in the SNX27PDZ domain. SNX27-eGFP expression disrupts junctional E-cadherin in SW480+APC cells (F) but PDZ-domain mutant, SNX27-H114A-eGFP expression does not (G). Cell contacts are indicated by arrows. Junctional staining is absent in SNX27-eGFP expressing cells ** (F) but are intact in SNX27-H114A-eGFP expressing cells # (G). SNX27-eGFP and SNX27-H114A-eGFP (green), E-cadherin (red), nuclei (DAPI) (blue). Scale bar 50μm, left hand panels and 80μm, enlarged inset, right hand panels. (H) Whole cell lysate immunoblot analysis of SNX27 and E-cadherin levels in Colo320, SW480 and SW480+APC cells. β-tubulin serves as a loading control. (I) Immunoblot analysis of ZEB1, E-cadherin and β-tubulin in SW480 and SW480+APC cells. Shown are cropped blots, representative of three independent experiments. (J) ZEB1 expression upon siSNX27 knockdown in SW480 cells. Immunoblot analysis: the blot was probed with E-cadherin, ZEB1, SNX27 and β-tubulin (loading control) antibodies and ZEB1 protein levels quantified (mean ± SEM, n = 3; unpaired one-tailed Student’s t-test, *p<0.05, p values are indicated). (K) ZEB1 does not regulate SNX27 levels. SW480 cells were transfected with siZEB1 (SMARTpool) and protein levels were assessed 72 hours later. The blot was probed with SNX27 and β-tubulin (loading control) antibodies and are representative of two independent experiments. Quantitation is shown below (mean ± SEM, n = 2). Shown are cropped blots. Uncropped blots are included in S1 Raw images.(PDF)Click here for additional data file.
Post transcriptional regulation of E-cadherin by MMP14 and MMP19.
(A) Differential RNAseq analysis of MMP gene expression for SW480, SW480+APC and SW480 +control (SW480+ctrl) cells. Shown is the MEAN ± Std Dev of triplicate samples. (B) Whole cell lysate immunoblot analysis of MMP14 and E-cadherin in Difi, SW480 and SW480+APC cells. β-tubulin serves as a loading control. (C) siMMP14 knockdown (duplex#2) in SW480 cells promotes E-cadherin. E-cadherin immunoblot analysis from cells transfected with siMMP14 duplexes for 72 h. Quantification is shown in the plot below, Mean± SEM (n = 4, *p = 0.05, one-tailed unpaired Student’s t-test vs mock control). (D)
MMP14 mRNA expression from SW480 cells transfected with siRNAs #1–4 or siZEB1 (SMARTpool) for 72 hours. Shown is MEAN ± SEM (n = 4), **p<0.01 (p = 0.006), ***p<0.001), one-tailed unpaired Student’s t-test vs mock control. Note only duplex #2 results in depletion of MMP14. (E)
CDH1 mRNA expression from SW480 cells transfected with siMMP14 #2 or siZEB1 (SMARTpool) for 72 hours. Shown is mean ± SEM (n = 4), *p<0.05 (p = 0.028), one-tailed paired Student’s t-test vs mock control. (F) Whole cell lysis analysis of ZEB1 expression after knockdown of MMP14 #1–4. Quantification of ZEB1 protein levels (Mean ± SD (n = 2)) is shown below the representative blot. (G) siMMP19 knockdown in SW480 cells promotes E-cadherin. E-cadherin immunoblot analysis from cells transfected with siMMP19 duplexes for 72 h. Cells were harvested 72 hours post-transfection and whole cells lysates probed with antibodies against E-cadherin and β-tubulin. Quantification is shown in the plot below. Mean± SEM (n = 5) *p<0.05, **P<0.005 (exact p values are indicated) one-tailed unpaired Student’s t-test vs mock control. (H)
MMP19 mRNA expression from SW480 cells transfected with siMMP duplexes #1–4 or siZEB1 (SMARTpool) for 72 hours. Shown is MEAN ± SEM (n = 4) *p<0.05 (p = 0.048), ***p<0.001 one-tailed paired Student’s t-test vs mock control. (I)
CDH1 mRNA expression from SW480 cells transfected with siMMP19 duplexes #1–4 or siZEB1 (SMARTpool) for 72 hours. Shown is MEAN ± SEM (n = 4), *p<0.05 (p = 0.011), one-tailed unpaired Student’s t-test vs mock control. (J) Whole cell lysis analysis of ZEB1 expression after knockdown of MMP19 #1–4. For immunoblot analysis, cells were harvested 72 hours post-transfection and whole cells lysates probed with antibodies against ZEB1 and β-tubulin. Quantification of ZEB1 protein levels is shown below the representative blot. Mean ± SD (n = 4). Protein levels were determined using densitometry normalised to the loading control β-tubulin. For RNA expression, the data is normalised to GAPDH and shows the average of four independent experiments displayed as the Mean± SEM. Shown are cropped blots. Uncropped blots are included in S1 Raw images.(PDF)Click here for additional data file.(PDF)Click here for additional data file.
Data analysis pipeline.
(XLSX)Click here for additional data file.
Validated negative regulators of membrane associated E-cadherin.
(XLSX)Click here for additional data file.
Validated positive regulators of membrane associated E-cadherin.
(XLSX)Click here for additional data file.
Supporting information reference list.
(DOCX)Click here for additional data file.2 Sep 2020PONE-D-20-23014Genes regulating membrane-associated E-cadherin and proliferation in adenomatous polyposis coli mutant colon cancer cells: High content siRNA screenPLOS ONEDear Dr. Maree C Faux,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.Please submit your revised manuscript within 60 days. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsWe look forward to receiving your revised manuscript.Kind regards,Chunming LiuAcademic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. Please provide additional information about the SW480, HCT116 and Difi cells used in this work, including source, history and any quality control testing procedures (authentication, characterisation, and mycoplasma testing). For more information, please see http://journals.plos.org/plosone/s/submission-guidelines#loc-cell-lines.3. Please note that PLOS does not permit references to “data not shown.” or "not shown". Authors should provide the relevant data within the manuscript, the Supporting Information files, or in a public repository. If the data are not a core part of the research study being presented, we ask that authors remove any references to these data.4. In the Methods section, please provide the source, product number and any lot numbers of the primary antibodies used in the Western blot and immunofluorescence analysis for your study.5. To comply with PLOS ONE submission guidelines, in your Methods section, please provide additional information regarding your statistical analyses. For more information on PLOS ONE's expectations for statistical reporting, please see https://journals.plos.org/plosone/s/submission-guidelines.#loc-statistical-reporting.6.Thank you for stating the following in your Competing Interests section:[No].Please complete your Competing Interests on the online submission form to state any Competing Interests. If you have no competing interests, please state "The authors have declared that no competing interests exist.", as detailed online in our guide for authors at http://journals.plos.org/plosone/s/submit-nowThis information should be included in your cover letter; we will change the online submission form on your behalf.Please know it is PLOS ONE policy for corresponding authors to declare, on behalf of all authors, all potential competing interests for the purposes of transparency. PLOS defines a competing interest as anything that interferes with, or could reasonably be perceived as interfering with, the full and objective presentation, peer review, editorial decision-making, or publication of research or non-research articles submitted to one of the journals. Competing interests can be financial or non-financial, professional, or personal. Competing interests can arise in relationship to an organization or another person. Please follow this link to our website for more details on competing interests: http://journals.plos.org/plosone/s/competing-interests7. We note that you have indicated that data from this study are available upon request. PLOS only allows data to be available upon request if there are legal or ethical restrictions on sharing data publicly. For more information on unacceptable data access restrictions, please see http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions.In your revised cover letter, please address the following prompts:a) If there are ethical or legal restrictions on sharing a de-identified data set, please explain them in detail (e.g., data contain potentially sensitive information, data are owned by a third-party organization, etc.) and who has imposed them (e.g., an ethics committee). Please also provide contact information for a data access committee, ethics committee, or other institutional body to which data requests may be sent.b) If there are no restrictions, please upload the minimal anonymized data set necessary to replicate your study findings as either Supporting Information files or to a stable, public repository and provide us with the relevant URLs, DOIs, or accession numbers. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories.We will update your Data Availability statement on your behalf to reflect the information you provide.8.PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: YesReviewer #2: Yes**********2. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: I Don't KnowReviewer #2: Yes**********3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #2: Yes**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #2: Yes**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: There is a lack of consistency in the use of italics for a gene name, and capitalization needs to be used for Wnt, Notch, and others.It would be helpful if the authors compared the findings with an APC wild type cancer cell line in the main body of the text. While they used APC expressing SW480 cells, these cells harbor an APC mutation, which may have a separate role.The use of UBE2E3 siRNAs in Figure 3 isn't clear.DOCK3 and DUSP4 are not discussed in the description of Figure 4.The images used are not convincing of junctional expression of E-cadherin. Perhaps color or higher magnification should be used.The rationale for the use of thioglycerol in the SW480 cell culture media is unclear.The ZEB1 expression needs to be shown in Figure 1 with use of the siZEB1.In Figure 3, it's unclear what the *, **, or *** are compared to. In addition, it is surprising that none of the values in the ZEB1 graph are significant.In Figure 5, it would be helpful to describe how the decision is made in regards to which siRNA to show. For example, the siZEB1 (4) is shown, but according to the graph, it is the one unlike the others.Reviewer #2: The manuscript titled “Genes regulating membrane-associated E-cadherin and proliferation in adenomatous polyposis coli mutant colon cancer cells: High content siRNA screen” identified novel candidate genes that regulate E-cadherin and may play a role in colon cancer. I recommend publishing this work after minor revisions.1, In figure 2A, the highest Ecad score was around 20 while UBE2E3 in figure 2C showed 66.5 Ecad score. Why was UBE2E3 not included in figure 2A? What was the gene name with a highest Ecad score around 20 in figure 2A and why was it not included in figure 2C?2, In S5 D figure, the knock down of siSNX27 was not really evident compared to mock, while the western blot results of siSNX27 in S5 A and B showed more than 50% knockdown. What was the reason?3, At line 272, adding a brief background of the function of SNX27 and SNX27H114A mutant would help readers understand S5 F and G figures.4, Regarding S5 F and G figures, the siRNA screen and identification of SNX27 as a negative regulator of E-cad was in SW480 cells. Why did the authors use SW480+APC cells instead of SW480 cells? If the authors also used SW480 cells to compare SNX27GFP and SNX27H114A mutant in affecting E-cad, was the results in agreement with those in SW480+APC cells?**********6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.21 Sep 2020Dear Professor Liu,RE: PONE-D-20-23014Genes regulating membrane-associated E-cadherin and proliferation in adenomatous polyposis coli mutant colon cancer cells: High content siRNA screenThank you for your invitation to submit a revised version of our manuscript. We have addressed each of the points raised during the review process.The authors have declared that no competing interests exist.There are no restrictions to sharing the data from this study; the data are presented in the manuscript and Supporting Information files.The original blots are included in Supporting Information in a pdf file named ‘S1_raw_images’.Our detailed response to each of the points raised during the review process is below:Journal Requirements:1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdfResponse:The manuscript has been formatted according to the PLOS ONE’s style requirements as outlined on the style template pdf documents.2. Please provide additional information about the SW480, HCT116 and Difi cells used in this work, including source, history and any quality control testing procedures (authentication, characterisation, and mycoplasma testing). For more information, please see http://journals.plos.org/plosone/s/submission-guidelines#loc-cell-lines.Response:Additional information about the SW480, HCT and Difi cells used in this work, including source, history and quality control testing procedures is now included in the Methods Section under ‘Cell Culture Conditions’:‘SW480 cells were acquired directly from the American Type Culture Collection (ATCC CCL228). SW480 cells were cultured in RPMI supplemented with 1.08% thioglycerol, 50mg/ml hydrocortisone, 100U/ml insulin, 10% foetal calf serum (plus 1.5mg/ml G418 for the SW480+APC cells(7). Thioglycerol is used in the culture media to stimulate proliferation. HCT116 and Difi cells were acquired from Oliver Sieber(30). HCT116(53) and Difi(54) cells were cultured in DMEM supplemented with 10% foetal calf serum. All cell lines were cultured at 37 C in a 10% CO2 incubator. Cell lines were tested for mycoplasma (WEHI antibody facility) and verified to be mycoplasma free prior to starting experiments. All cell lines were authenticated by STR (short tandem repeat) profiling analysis at the Australian Genome Research Facility (AGRF) (Parkville, VIC, Australia) using the GenePrint 10 System (Promega)(30).’3. Please note that PLOS does not permit references to “data not shown.” or "not shown". Authors should provide the relevant data within the manuscript, the Supporting Information files, or in a public repository. If the data are not a core part of the research study being presented, we ask that authors remove any references to these data.Response:Reference to “data not shown” or “not shown” have been removed.1. We have included the data with the calculation from the mock wells in the primary screen in S1 vii Table. The text now reads:‘The average number of FOV to reach the target count of 3000 cells for the mock control wells in the primary screen was 20±3.13 (mean±SD, n=464) (S1 vii Table).’2. In the Discussion: We see reduced Wnt target gene expression upon restoration of membrane E-cadherin in MMP14 depleted cells (not shown), consistent with the idea that E-cadherin can be considered as a tumour suppressor by acting as a ‘sink’ for cytosolic �-catenin(13, 48) . However, this is not the case with MMP19.We have not included this data in the manuscript and have removed these two sentences from the ‘Discussion’.3. Fig 2 Figure legend: The cut-off for E-cadherin negative regulatory genes is shown (Z-score>5.16); the Z- score cut-off for positive regulatory genes is <0.036 (not shown).This refers to the cut off for the <0.036 which is not shown on the plot.The Figure 2B Legend now reads:‘(B) Mock normalised Robust Z-score (Ecad) plot for SMARTpool siRNA screen. The cut-off for E-cadherin negative regulatory genes is indicated by the red-dotted line (Z-score>5.16); the Z- score cut-off for positive regulatory genes is <0.036.’4. In the Methods section, please provide the source, product number and any lot numbers of the primary antibodies used in the Western blot and immunofluorescence analysis for your study.Response:The source, product number and lots numbers of the primary antibodies used in the Western blot and immunofluorescence analysis is now included in the ‘Materials and Methods’ section:‘The following primary and secondary antibodies were used: anti-E-cadherin (Abcam, HECD1 #ab1416 Lot# GR91484-1, 1:200), anti-E-cadherin (Cell Signaling 24E10 #3195 Lot# 04/2014, 1:1000), anti-E-cadherin (BD Transduction Laboratories #610182 Lot# 316522, 1:1000), anti-ZEB1 (Santa Cruz H-102 #sc-25388 Lot# H1513, 1:1000), anti-UBE2E3 (Abcam 4B4 #ab128098 (OT14B4) Lot# GR45436-1, 1:1000), anti-SNX27 (Abcam 1C6 #ab77799 Lot# GR212908-1 and GR20549-1, 1:500), anti-MMP14 (Millipore #MAB3328 LEM-2/15.8 Lot# 2488951, 1:1000), anti-ZO1 (BD Transduction Laboratories #61096 Lot# 34962, 1:200), anti-β-tubulin (Sigma Aldrich TUB2.1 T4026 Lot# 125M4884V, 1:1000), anti-occludin (Abcam #ab31721 Lot# GR115633-1, 1:200), and secondary antibodies: Alexa488 goat αmouse/rabbit (Thermo Scientific #A-11001 and #A-11035, 1:500) and Alexa546 goat αmouse/rabbit (Thermo Scientific #A-11030 and #A-11035, 1:500).’5. To comply with PLOS ONE submission guidelines, in your Methods section, please provide additional information regarding your statistical analyses. For more information on PLOS ONE's expectations for statistical reporting, please see https://journals.plos.org/plosone/s/submission-guidelines.#loc-statistical-reporting.Response:A Statistical Analysis section is now included in the ‘Materials and Methods’ section:‘Statistical AnalysisStatistical analyses were performed using an unpaired one-tailed Student’s t-test, unless otherwise described. The statistical analysis for the screen is detailed in S1 Fig and S3 Fig. Data presented graphically are the means ± standard error of the mean (SEM) for three independent experiments unless otherwise stated.’Exact p-values are reported for all values greater than or equal to 0.001. P-values less than 0.001 are expressed as p<0.001. (eg Fig 1, 3, S5 Fig, S6 Fig).6.Thank you for stating the following in your Competing Interests section:[No].Please complete your Competing Interests on the online submission form to state any Competing Interests. If you have no competing interests, please state "The authors have declared that no competing interests exist.", as detailed online in our guide for authors at http://journals.plos.org/plosone/s/submit-nowThis information should be included in your cover letter; we will change the online submission form on your behalf.Please know it is PLOS ONE policy for corresponding authors to declare, on behalf of all authors, all potential competing interests for the purposes of transparency. PLOS defines a competing interest as anything that interferes with, or could reasonably be perceived as interfering with, the full and objective presentation, peer review, editorial decision-making, or publication of research or non-research articles submitted to one of the journals. Competing interests can be financial or non-financial, professional, or personal. Competing interests can arise in relationship to an organization or another person. Please follow this link to our website for more details on competing interests: http://journals.plos.org/plosone/s/competing-interestsResponse:Please see the statement in the cover letter above: “The authors have declared that no competing interests exist.”7. We note that you have indicated that data from this study are available upon request. PLOS only allows data to be available upon request if there are legal or ethical restrictions on sharing data publicly. For more information on unacceptable data access restrictions, please see http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions.In your revised cover letter, please address the following prompts:a) If there are ethical or legal restrictions on sharing a de-identified data set, please explain them in detail (e.g., data contain potentially sensitive information, data are owned by a third-party organization, etc.) and who has imposed them (e.g., an ethics committee). Please also provide contact information for a data access committee, ethics committee, or other institutional body to which data requests may be sent.b) If there are no restrictions, please upload the minimal anonymized data set necessary to replicate your study findings as either Supporting Information files or to a stable, public repository and provide us with the relevant URLs, DOIs, or accession numbers. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories.We will update your Data Availability statement on your behalf to reflect the information you provide.Response:Please see response in the cover letter above:‘There are no restrictions to sharing the data from this study; the data are presented in the Manuscript and Supporting Information files.’8.PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.Response:Please see response in the cover letter above:The original blots are included in Supporting Information in a pdf file named ‘S1_raw_images’.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: YesReviewer #2: Yes2. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: I Don't KnowReviewer #2: Yes3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #2: Yes4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #2: Yes5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1:There is a lack of consistency in the use of italics for a gene name, and capitalization needs to be used for Wnt, Notch, and others.Response: The manuscript text has been amended so that italics are consistently used for a gene name and capitalization is used for Wnt, Notch.It would be helpful if the authors compared the findings with an APC wild type cancer cell line in the main body of the text. While they used APC expressing SW480 cells, these cells harbor an APC mutation, which may have a separate role.Response: We compare SW480 cells with APC-expressing SW480 (SW480+APC) cells in the main body of the text on four occasions:While the SW480+APC cells express full-length APC, residual truncated APC is still expressed, as the reviewer points out. The SW480+APC cells are also a non-tumourigenic cell line and provide a model for comparison of cells with functional cell adhesion junctions. We have now compared gene expression in four other CRC cells that contain wild-type APC, but these cells are tumourigenic and contain different mutations, including other Wnt pathway genes (eg �-catenin, RNF43) which could also influence the adherens junction.1. We compare expression of ‘pro-survival’ genes in SW480 with the non-tumourigenic SW480+APC cells. We have now compared ‘pro-survival’ gene expression in 4 other CRC cells with wild-type APC (HCT116, LIM1215, LIM1899 and RKO). The revised text is below:‘While these ‘pro-survival’ genes were ruled out as specific E-cadherin regulatory genes, their expression in SW480 (mutant APC) cells was compared to that in SW480+APC (restored APC) cells in order to identify genes that are differentially expressed as a result of loss of function of APC(7, 29). We identified 7 genes (POLR2A, SYNGR1, CST3, FOXD1, ETV3, OLR1, GRIP2) that are important for the survival of SW480 cells. We note that POLR2A, CST3, FOXD1 and ETV2 also show differential expression in 4 other CRC cell lines with wild-type APC (HCT116, LIM1215, LIM1899 and RKO)(30).’2. We report that expression of CTNNBIP1, a gene identified as a positive regulator, is upregulated in SW480+APC cells compared to SW480 cells. We have previously shown that SW480+APC cells demonstrate functional cell-cell adhesion junctions (Faux et al., J Cell Science 2004) and the upregulation of CTNNBIP1 which has been implicated in cadherin-based adhesion underscores the strong cell adhesion phenotype in the SW480+APC cells. CTNNBIP1 is not upregulated in HCT116, LIM1215, LIM1899 or RKO CRC cells which express wild-type APC but we suggest that this may be due to other mutations in these cells (including �-catenin).3. In S5 Fig, expression of SNX27GFP, but not its functionally disrupted SNX27H114A mutant, results in loss of membrane associated E-cadherin in SW480+APC cells. The SW480+APC cells demonstrate robust E-cadherin at cell-cell contacts whereas other CRC cells do not show such strong junctional staining which would make interpretation of experiments with other CRC cell lines difficult.4. RNA sequencing revealed that MMP14 and MMP19 were upregulated in parental SW480 compared to SW480+APC cells. MMP14 and MMP19 are also upregulated in HCT116, LIM1215 and LIM1899 CRC cells. We have revised the text accordingly:‘RNA sequencing revealed that MMP14 and MMP19 were upregulated in parental SW480 compared to SW480+APC cells (Supporting Information S6A Fig)(29). MMP14 and MMP19 levels are also higher in HCT116 LIM1215 and LIM1899 CRC cells which contain wild-type APC (30). MMP14 and MMP19 elicited Ecad scores of 1.48 and 1.56 in the primary screen, prompting further investigation.’The use of UBE2E3 siRNAs in Figure 3 isn't clear.Response: The manuscript text and figure legend have been amended to clarify the use of UBE2E3 siRNAs in Figure 3 (see below). The labels on the figure have been changed to include siUBE2E3 duplex.‘Western blot analysis confirmed that all four siRNA duplexes successfully reduced UBE2E3 levels (Fig 3A, B). The siUBE2E3 duplex #1, the miR-200 mimic, elicits the largest increase in total E-cadherin with concomitant reduction in ZEB1, as expected. However, UBE2E3 siRNA duplexes #2 and #3 also result in increased E-cadherin levels (Fig 3A and B) and membrane-association (Fig 3C). These duplexes did not exert corresponding changes in ZEB1 suggesting the possibility that UBE2E3 siRNA duplexes #2 and #3 regulate membrane E-cadherin via different mechanisms of action that do not involve ZEB1. Collectively, the change in Ecad score for the siRNAs containing the seed sequence is likely due to the regulation of miR-200, however, as UBE2E3 duplexes elicited increases in E-cadherin without altering ZEB1, UBE2E3 may regulate membrane-associated E-cadherin by a different mechanism.’‘Figure 3. Effect of siUBE2E3 on SW480 membrane-associated E-cadherin. SW480 cells were transfected with individual siRNA duplexes from the UBE2E3 SMARTpool for 72 hours: (A) Expression of ZEB1, E-cadherin and UBE2E3 were analysed by immunoblot. β-tubulin was used as a loading control. siRNA#1 (1*) shares the same 5’ nucleotide sequence as miR200 family seed sequence. The blot is representative of three individual experiments. Shown are cropped images, uncropped blots are included in Supporting Information S1 raw images; (B) Quantitation of E-cadherin, ZEB1 and UBE2E3 protein levels upon siUBE2E3 knockdown in SW480 cells. Protein levels were determined using densitometry against the loading control β-tubulin and are representative for triplicate experiments (mean± SEM) *p<0.05 (p=0.026 and p=0.039 for si UBE2E3 1 and 3, respectively), **p<0.005 (p=0.00247), ***p<0.001 for E-cadherin and UBE2E3 or duplicate experiments (mean ± sd) for ZEB1 *p=0.023, **p=0.0035, ***p<0.001; one-tailed unpaired t-test vs mock control; (C) Immunofluorescence staining of E-cadherin in fixed SW480 cells, 72 hours post treatment with siUBE2E3 siRNA duplexes #1, 2, 3 or mock control. Scale bar; 50µM.’DOCK3 and DUSP4 are not discussed in the description of Figure 4.Response: We have amended the text to include DOCK3 and DUSP4 in the description of Figure 4.‘DOCK3 (a RAC1-GEF) has been shown to regulate cell adhesion in non-small cell lung cancer cells (37). The MAP kinase phosphatase DUSP4 has been implicated in CRC proliferation(38) and in promoting E-cadherin expression in non-small cell lung cancer (39).’The images used are not convincing of junctional expression of E-cadherin. Perhaps color or higher magnification should be used.Response: We have included enlarged images of E-cadherin staining for SW480 cells treated with siRNAs targeting ZEB1, CDK8, SNX27, EPS8L1 and ZNF518A in Fig 5, which show increased junctional E-cadherin staining compared to mock.The rationale for the use of thioglycerol in the SW480 cell culture media is unclear.Response: Thioglycerol is used in the culture media to stimulate proliferation and has been included in the Materials and Methods ‘Cell Culture Conditions’ section.‘Thioglycerol is used in the culture media to stimulate proliferation.’The ZEB1 expression needs to be shown in Figure 1 with use of the siZEB1.Response: We have included a new Figure, Figure 1E, showing a Western blot of Zeb1 from siZEB1 and mock transfected cells. We show a representative blot and the normalised ZEB1, quantified from 3 independent experiments. The following is included in the main text and figure legend:‘ZEB1 protein was reduced following treatment with siRNAs targeting ZEB1 (Fig 1E).’(E) Expression of ZEB1 in SW480 cells treated with individual siRNA duplexes from the SMARTpool (siZEB1 #1-4, as indicated). ZEB1 expression is reduced with each siRNA duplex. The blot is representative of three individual experiments. Shown are cropped images, uncropped blots are included in Supporting Information S1 raw images; Quantitation of ZEB1 is shown below (mean± SEM) (n=3). Protein levels were determined using densitometry against the loading control β-tubulin *p<0.05 (exact p values are indicated); one-tailed unpaired t-test vs mock control.In Figure 3, it's unclear what the *, **, or *** are compared to. In addition, it is surprising that none of the values in the ZEB1 graph are significant.Response: The Figure 3 legend has been amended to indicate that protein levels are compared to the mock control. Statistical analysis for ZEB1 has now been included and are significant.(B) Quantitation of E-cadherin, ZEB1 and UBE2E3 protein levels upon siUBE2E3 knockdown in SW480 cells. Protein levels were determined using densitometry against the loading control β-tubulin and are representative for triplicate experiments (mean± SEM) *p<0.05 (p=0.026 and p=0.039 for si UBE2E3 1 and 3, respectively), **p<0.005 (p=0.00247), ***p<0.001 for E-cadherin and UBE2E3 or duplicate experiments (mean ± sd) for ZEB1 *p=0.023, **p=0.0035, ***p<0.001; one-tailed unpaired t-test vs mock control;In Figure 5, it would be helpful to describe how the decision is made in regards to which siRNA to show. For example, the siZEB1 (4) is shown, but according to the graph, it is the one unlike the others.Response: Representative images for E-cadherin immunostaining are shown for the siRNA duplex that elicited the highest Ecad score in order to illustrate the altered membrane E-cadherin from the screen images. The text has been amended to include the following:‘E-cadherin immunostaining is shown for the siRNA duplex that elicited the highest Ecad score.’Reviewer #2: The manuscript titled “Genes regulating membrane-associated E-cadherin and proliferation in adenomatous polyposis coli mutant colon cancer cells: High content siRNA screen” identified novel candidate genes that regulate E-cadherin and may play a role in colon cancer. I recommend publishing this work after minor revisions.1, In figure 2A, the highest Ecad score was around 20 while UBE2E3 in figure 2C showed 66.5 Ecad score. Why was UBE2E3 not included in figure 2A? What was the gene name with a highest Ecad score around 20 in figure 2A and why was it not included in figure 2C?Response: The measurements shown in Figure 2A and Figure 2B/C are different: Figure 2A shows the Ecad score (average membrane fibre count/cell normalised to mock) and Figure 2B and C are the Normalised Robust Z-scores (Ecad). This has now been clarified in the Figure and Figure Legend. Specifically, Figure 2C now reads ‘Z-score (Ecad)’ instead of Ecad score and the Figure Legend for Figure 2C now reads: ‘Normalised Robust Z-score (Ecad) (Z-score Ecad) is shown for genes…’. The full Figure Legend is below:‘Figure 2. A genome-wide imaging based siRNA screen identifies regulators of membrane-associated E-cadherin in SW480colon cancer cells. (A) Membrane associated Ecad scores normalised to mock transfectants for all SMARTpool siRNAs (black) transfected into SW480 cells. Controls are highlighted: mock (blue), siZEB1 (orange), siCDH1 (red) & siPLK1 (green). (B) Mock normalised Robust Z-score (Ecad) plot for SMARTpool siRNA screen. The cut-off for E-cadherin negative regulatory genes is shown (Z-score>5.16); the Z- score cut-off for positive regulatory genes is <0.036 (not shown), (C) Normalised Robust Z-score (Ecad) (Z-score Ecad) is shown for genes with a functional association with E-cadherin regulation and a gene* with potential miRNA-200 family off-target effects.’The gene with the highest Ecad score in Figure 2A is UBE2E3; it is included in Figure 2C with a Normalised Robust Z-score of 66.5.2, In S5 D figure, the knock down of siSNX27 was not really evident compared to mock, while the western blot results of siSNX27 in S5 A and B showed more than 50% knockdown. What was the reason?Response: The signal for SNX27 in the micrographs in S5 D Figure is diminished in the siSNX27 compared to mock with corresponding increased E-cadherin. The subcellular distribution of SNX27 is concentrated in perinuclear puncta and this signal is considerably brighter in the mock treated cells. There is some background fluorescence. In the S5 D Figure, siSNX27 panel, there is a cell which shows bright fluorescent puncta, representing a non-transfected cell. The increased membrane staining for E-cadherin in the siSNX27 cells is very clear, but there is not membrane E-cadherin signal in the cell with the SNX27 perinuclear puncta.3, At line 272, adding a brief background of the function of SNX27 and SNX27H114A mutant would help readers understand S5 F and G figures.Response: The text has been amended to include the following brief description of the function of SNX27 and SNX27H114A mutant:‘SNX27 facilitates recycling of endocytosed membrane-associated proteins by linking the endosome associated cargo to a retromer complex that can recycle the cargo back to the plasma membrane. Depletion of SNX27 was confirmed (S5A, B Fig) and resulted in increased membrane associated E-cadherin in SW480 and HCT116 cells (S5C, D, E Fig). The increased E-cadherin upon SNX27 depletion suggests a novel role for SNX27 in post-transcriptional regulation of E-cadherin. Expression of SNX27GFP, but not the functionally disrupted SNX27H114A mutant, resulted in loss of membrane associated E-cadherin in SW480+APC cells (S5F, G Fig). The mutation of the evolutionary conserved His114 to Ala (SNX27H114A) abrogates binding of the PDZ domain of SNX27 to PDZ binding domain containing cargo(41). In SNX27-H114A-GFP expressing cells E-cadherin distribution is not disrupted (S5F, G Fig). These results show that SNX27 regulates cell-cell adhesion via an interaction with a PDZ-domain-binding protein.’4, Regarding S5 F and G figures, the siRNA screen and identification of SNX27 as a negative regulator of E-cad was in SW480 cells. Why did the authors use SW480+APC cells instead of SW480 cells? If the authors also used SW480 cells to compare SNX27GFP and SNX27H114A mutant in affecting E-cad, was the results in agreement with those in SW480+APC cells?Response: We chose the SW480+APC cells because these cells produce functional cell-cell adhesion contacts, with E-cadherin membrane staining. In contrast, SW480 cells show minimal E-cadherin membrane staining and further loss of junctional membrane E-cadherin is difficult to detect. The result in SW480 cells is in agreement with SW480+APC cells. The following sentence has been included in the text:‘We chose the SW480+APC cells to test whether overexpression of SNX27 would reduce cell-cell adhesion in cells with functional adherens junctions.’We trust that our manuscript is now suitable for publication in PLOS ONE.Yours sincerely,Maree FauxThe Walter and Eliza Hall Institute of Medical Research,1G Royal Parade, Parkville, VICTORIA 3051AustraliaEmail: faux@wehi.edu.auSubmitted filename: Response to Reviewers.docxClick here for additional data file.28 Sep 2020PONE-D-20-23014R1Genes regulating membrane-associated E-cadherin and proliferation in adenomatous polyposis coli mutant colon cancer cells: High content siRNA screenPLOS ONEDear Dr. Maree C Faux,Thank you for submitting your revised manuscript to PLOS ONE. The manuscript was carefully reviewed by the original reviewers. Although the reviewers believe that the revised manuscript was significantly improved, they still have minor concerns. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.Please submit your revised manuscript within two months. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsWe look forward to receiving your revised manuscript.Kind regards,Chunming LiuAcademic EditorPLOS ONE[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.Reviewer #1: All comments have been addressedReviewer #2: All comments have been addressed**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: (No Response)Reviewer #2: Yes**********3. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: (No Response)Reviewer #2: Yes**********4. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: (No Response)Reviewer #2: Yes**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: (No Response)Reviewer #2: Yes**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: While all comments have been addressed, there is still concern about the use of thioglycerol in the cell culture media for the SW480 cells. The authors state that it is needed for proliferation. While thio is used in some primary cell culture media, it should not be required for culturing the highly aggressive SW-480 cells. The concern here is that there is something inherently wrong with these cells that require thioglycerol to grow, which may also influence the results described in the manuscript.Reviewer #2: (No Response)**********7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.29 Sep 2020Thank you for your invitation to submit a revised version of our manuscript. We are pleased to see that both reviewers agree that ‘All comments have been addressed’ and that all other requirements have been resolved. We have addressed the remaining concern raised by Reviewer 1 in our detailed response below:6. Review Comments to the AuthorReviewer #1: While all comments have been addressed, there is still concern about the use of thioglycerol in the cell culture media for the SW480 cells. The authors state that it is needed for proliferation. While thio is used in some primary cell culture media, it should not be required for culturing the highly aggressive SW-480 cells. The concern here is that there is something inherently wrong with these cells that require thioglycerol to grow, which may also influence the results described in the manuscript.Response: We have routinely cultured colon cancer cell lines in RPMI supplemented with 10%FCS, insulin, thioglycerol and hydrocortisone. We have found that this provides consistent growth conditions for a range of cell lines and have used this media for culturing the SW480 cells in this study. We understand the reviewer's concern for a robust cell line such as SW480 cells, but we have also grown the SW480 cells in other media such as DME plus 10% FCS and have not observed a difference in growth rate. Furthermore, the various controls that we used in the experiments in the manuscript do not show adverse effects on proliferation or other growth characteristics. We do not believe that there is something inherently wrong with these cells that require thioglycerol to grow.We have included the following in the revised manuscript:‘Thioglycerol is used in culture media to stimulate proliferation and we have found that this provides consistent growth conditions, but the cells do not require thioglycerol for their growth.’Submitted filename: Response to Reviewers.docxClick here for additional data file.2 Oct 2020Genes regulating membrane-associated E-cadherin and proliferation in adenomatous polyposis coli mutant colon cancer cells: High content siRNA screenPONE-D-20-23014R2Dear Dr. Maree C Faux,We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.Kind regards,Chunming LiuAcademic EditorPLOS ONEAdditional Editor Comments (optional):Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.Reviewer #1: All comments have been addressed**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: (No Response)**********3. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: (No Response)**********4. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: (No Response)**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: (No Response)**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: (No Response)**********7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: No7 Oct 2020PONE-D-20-23014R2Genes regulating membrane-associated E-cadherin and proliferation in adenomatous polyposis coli mutant colon cancer cells: High content siRNA screenDear Dr. Faux:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.If we can help with anything else, please email us at plosone@plos.org.Thank you for submitting your work to PLOS ONE and supporting open access.Kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. Chunming LiuAcademic EditorPLOS ONE
Authors: Ahmed S Sultan; Jianwu Xie; Matthew J LeBaron; Erica L Ealley; Marja T Nevalainen; Hallgeir Rui Journal: Oncogene Date: 2005-01-27 Impact factor: 9.867
Authors: R Smits; P Ruiz; S Diaz-Cano; A Luz; S Jagmohan-Changur; C Breukel; C Birchmeier; W Birchmeier; R Fodde Journal: Gastroenterology Date: 2000-10 Impact factor: 22.682
Authors: Ron Firestein; Adam J Bass; So Young Kim; Ian F Dunn; Serena J Silver; Isil Guney; Ellen Freed; Azra H Ligon; Natalie Vena; Shuji Ogino; Milan G Chheda; Pablo Tamayo; Stephen Finn; Yashaswi Shrestha; Jesse S Boehm; Supriya Jain; Emeric Bojarski; Craig Mermel; Jordi Barretina; Jennifer A Chan; Jose Baselga; Josep Tabernero; David E Root; Charles S Fuchs; Massimo Loda; Ramesh A Shivdasani; Matthew Meyerson; William C Hahn Journal: Nature Date: 2008-09-14 Impact factor: 49.962
Authors: Bin Xie; Allison Maker; Andrew V Priest; David M Dranow; Jenny N Phan; Thomas E Edwards; Bart L Staker; Peter J Myler; Barry M Gumbiner; Sanjeevi Sivasankar Journal: Proc Natl Acad Sci U S A Date: 2022-08-03 Impact factor: 12.779
Fig 1
Fig 2
Fig 3
Fig 4
Fig 5
Fig 6