Oxymatrine exerts anti-fibrotic effects in a rat model of hepatic fibrosis by suppressing endoplasmic reticulum stress.

OBJECTIVE: This study evaluated the anti-fibrotic effects of oxymatrine and the role of endoplasmic reticulum (ER) stress in hepatic fibrosis (HF) in animal models.
METHODS: The HF rat model was established by exposure to NaAsO2, followed by treatment with oxymatrine. Biomarkers of HF and ER stress were measured. The difference in protein expression between groups was evaluated using isobaric tag for relative and absolute quantification (iTRAQ) analysis. The mechanism by which oxymatrine modulated ER stress to alleviate arsenic-induced HF was evaluated using LX2 hepatic stellate cells in vitro.
RESULTS: The rat model mimicked the pathological and physical phenotypes of HF including ER stress, oxidative stress, impaired liver function, and fibrosis. Treatment with oxymatrine suppressed these responses. Moreover, apoptosis, inflammation, and hepatic stellate cell activation were also inhibited by oxymatrine treatment. The differentially expressed proteins and pathways related to ER stress were identified in the HF and oxymatrine-treated groups via iTRAQ analysis combined with liquid chromatography-mass spectrometry. LX2 cells were activated by NaAsO2 in vitro. Meanwhile, oxymatrine suppressed the activation of LX2 cells by alleviating ER stress and regulating cellular calcium homeostasis.
CONCLUSIONS: Oxymatrine could reverse NaAsO2-induced HF by alleviating ER stress.

Introduction

Hepatic fibrosis (HF) is a pathological change characterized by abnormal hyperplasia and the accumulation of extracellular cell matrix (ECM) in chronic liver injury.[1],[2] Chronic injury may induce repetitive tissue damage, reduce the regenerative capacity of the liver, and promote the necrosis or apoptosis of parenchymal cells, which are replaced by ECM.[3] The progression of liver fibrosis can cause decompensated cirrhosis or hepatocellular carcinoma, which will directly affect patient survival.[1] Fortunately, if treated at an early stage to eliminate pathogenic factors, HF can be reversed.[4]

It has been confirmed that endoplasmic reticulum (ER) stress is associated with the initiation and progression of liver fibrosis.[5],[6] The ER is an important intracellular organelle involved in various important biological functions, including protein folding and synthesis, and it serves as a calcium reservoir.[7],[8] An overload of unfolded or misfolded proteins in the ER contributes to ER stress.[9] Thus, the modulation of ER stress is a promising treatment strategy for reversing the progression of fibrosis.

Many traditional Chinese medicines have been used to help reduce liver fibrosis. Oxymatrine, the main bioactive component of Sophora flavescens, exhibits various biological activities, including anti-inflammatory, anti-fibrosis, anti-viral, cardioprotective effects[10],[11] Moreover, oxymatrine can suppress the proliferation of hepatic stellate cells (HSCs), which is believed to be associated with HF.[12] Oxymatrine may also inhibit the secretion of transforming growth factor (TGF)-β1 and TGF-α1 to degrade the ECM.[13],[14] Based on the aforementioned studies, models of HF were established and treated with oxymatrine in the present study to investigate the anti-fibrotic effects and mechanism of the agent.

Materials and methods

Study design and animals

Sixty-four male Sprague–Dawley rats were obtained from the Mudanjiang Medical University Animal Center (Mudanjiang, China). Each cage housed five or six rats in specific pathogen-free conditions at 20–25°C and 50% to 70% relative humidity. The rats had free access to food and water. All animal experiments were conducted in accordance with the ARRIVE guidelines and were approved by the Second Affiliated Hospital of Mudanjiang Medical University Animal Ethics Committee in 2018.

HF model and treatment

After habituation for 1 week, the rats were randomly divided into two groups: vehicle control (n = 8) and HF (n = 56). NaAsO2 (arsenic; 5 mg/kg/day) was administered via gavage for 20 consecutive weeks (five times a week) to establish the HF model. The vehicle control group was fed a normal diet and water. Physical conditions, the color of urine, the coat, and the condition of the eyes were recorded to evaluate the pathological processes. Body weight was evaluated every 2 weeks during the establishment of the model. Eight rats in each group sacrificed via laparotomy at 20 weeks. Morphological changes in the liver were visualized using hematoxylin and eosin (H&E) and Masson staining to evaluate the severity of fibrosis.[15] ECM, liver function indicators, serum, and urine arsenic concentrations were determined. The arsenic concentration was measured via atomic fluorescence spectrometry.

The remaining HF rats were divided into three groups of 16 animals each: vehicle, low-dose oxymatrine (25 mg/kg/day), and high-dose oxymatrine (50 mg/kg/day). Animals were treated with oxymatrine for 8 weeks. The rats were not exposed to NaAsO2 during the treatment period. The food intake in all groups was equal. Every 4 weeks in the treatment period, eight rats in each group were sacrificed. The aforementioned parameters were evaluated after 4 and 8 weeks of treatment. Histological examination of liver via H&E and Masson staining was conducted.

Histological staining

Briefly, after NaAsO2 exposure for 20 weeks, rats were anesthetized and sacrificed via laparotomy. Liver sections (5 μm thick) were prepared for H&E and Masson staining according to standard protocols.[15] H&E and Masson staining results were analyzed by a pathologist using the double-blind method. Fibrosis was assessed using the Ishak fibrosis stage.

Reverse transcription-quantitative PCR (qPCR)

Liver and cellular total RNA was separated using TRIzol™ reagent (Invitrogen, Karlsruhe, Germany). cDNA was synthesized from 500 ng of total RNA using a PrimeScript™ reagent kit (Takara Bio, Kusatsu, Shiga, Japan) according to the manufacturer’s instructions. Primers for qPCR were designed for 100- to 200-bp segments using Primer 5.0 (Table 1). qPCR was performed using an ABI 7300 machine (Thermo Fisher Scientific, Waltham, MA, USA) with SYBR ExTaq™ premix (Takara Bio). Each reaction was performed in triplicate.

Table 1.

Sequences of primers used for reverse transcription-quantitative PCR.

Genes	Forward primer (5′–3′)	Reverse primer (5′–3′)
RYR1	CTCCGCCTCTTTCATGGACAT	CTGCCCGGTAGTGACATGC
CAPN2	GAAGCGTCCCACGGAACTG	GTGCAGGAGGGTGTCGTTG
GRP78	CATCACGCCGTCCTATGTCG	CGTCAAAGACCGTGTTCTCG
CHOP	GAACGGCTCAAGCAGGAAATC	TTCACCATTCGGTCAATCAGAG
SERCA2	AAACCACGGAGGAATGTTTGG	AGCTCATTGAGGCCGTATTTC
GAPDH	AGAAGGCTGGGGCTCATTTG	AGGGGCCATCCACAGTCTTC

CAPN2, calpain 2; GRP78, endoplasmic reticulum chaperone BiP; CHOP, DNA damage-inducible transcript 3 protein; SERCA2, sarcoplasmic/endoplasmic reticulum Ca2+ transport ATPase 2.

Western blotting

The protein concentration was determined using the bicinchoninic acid method. Protein samples were separated using 10% SDS-PAGE and transferred to PVDF membranes (MilliporeSigma, Merck KgaA, Darmstadt, Germany) according to the standard protocol. The following primary antibodies were employed: α-smooth muscle actin (α-SMA; 1:800, Cell Signaling Technology, Danvers, MA, USA), calpain 2 (1:1000, Cell Signaling Technology), DNA damage-inducible transcript 3 protein (CHOP; 1:800, Cell Signaling Technology), ER chaperone BiP (GRP78; 1:1000, Cell Signaling Technology), sarcoplasmic/endoplasmic reticulum Ca2+ transport ATPase 2 (Serca2; 1:800, Cell Signaling Technology), cleaved caspase-12 (Cell Signaling Technology), GAPDH (Cell Signaling Technology), and β-actin (Cell Signaling Technology). Membranes were incubated with the secondary antibody (HRP, 1:20,000, ZSGB-Bio, Beijing, China) for 1 hour at room temperature. Protein bands were visualized using Western Lighting ECL and the VersaDoc imaging system (Bio-Rad, Hercules, CA, USA) and quantified using QuantityOne software (Bio-Rad).

Oxidative stress-related indices

Liver malondialdehyde (MDA) and total superoxide dismutase (T-SOD) activities were detected using MDA and T-SOD kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, Jiangsu, China).

Enzyme-linked immunosorbent assay (ELISA)

The levels of liver fibrosis-related factors, including hyaluronic acid (R&D Systems, Minneapolis, MN, USA), collagen type IV (COL-IV; CUSABIO), and rat/human TGF-β1 (Abcam) were determined by ELISA.

Isobaric tag for relative and absolute quantification (iTRAQ) analysis

In each group, three rats were selected for iTRAQ analysis using an 8-plex iTRAQ system (Sigma-Aldrich, St. Louis, MO, USA). Briefly, 200 μg of protein were reduced using 5 mM tris-(2-carboxyethyl) phosphine and 10 mM alkylated methyl methanethiosulfonate, followed by digestion with trypsin (33 μg per 1 mg of protein) at 37°C for 16 hours. Different iTRAQ tags were used to label samples from the different rats according to the manufacturer’s protocol. Next, the labeled peptides were mixed and dried using a SpeedVac (15 minutes;(Thermo Savant, Inc., Holbrook, NY, USA) for iTRAQ analysis. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses were conducted to identify differentially expressed proteins (DEPs).

Cell culture

The HSC line LX2 was bought from the Type Culture Collection of the Chinese Academy of Sciences (Beijing, China). Cells were cultured in Dulbecco’s modified Eagle’s medium (Gibco, Thermo Fisher Scientific) supplement with 10% fetal bovine serum (Gibco, Thermo Fisher Scientific) and 1% penicillin-streptomycin (Gibco, Thermo Fisher Scientific). Cells were maintained in a humidified incubator in an atmosphere of 5% CO2 at 37°C.

Cell Counting Kit-8 (CCK-8) assay

CCK-8 (Dojindo Molecular Technologies, Kumamoto, Japan) was used to evaluate LX2 cell proliferation according to the manufacturers’ protocol.

Flow cytometry

LX2 cells were seeded into 12-well plates and divided into the following groups: negative control 1 μM NaAsO2, 500 μg/mL oxymatrine, and 1 μM NaAsO2/500 μg/mL oxymatrine. Apoptosis rates were determined using flow cytometry and Annexin V-FITC and propidium iodide (PI, BD Biosciences, San Jose, CA, USA) double staining.[16] Briefly, LX2 cells were washed twice with cold PBS and resuspended at a concentration of 1 × 106 cells/mL in 1× binding buffer. In total, 100 μL of the cell suspension were incubated with 5 μL of Annexin V-FITC and 5 μL of PI for 15 minutes at 25°C. After 400 μL of 1× binding buffer were added to the cell suspension, apoptosis was analyzed by flow cytometry using a Becton Dickinson FACSCalibur flow cytometer (BD Biosciences).

Statistical analysis

All data were presented as the mean ± SD. Statistical comparisons were performed using SPSS 19.0 software (IBM Corp, Armonk, NY, USA). Unpaired two-sample t-tests were used for comparisons between two groups. Three or more groups were compared using one-way ANOVA followed by the least significant difference test. P < 0.05 denoted statistical significance.

Results

Chronic NaAsO2 exposure induced HF

The HF rat model was established by exposing the animals to NaAsO2. Serum, urine, and liver arsenic levels were increased in rats exposed to NaAsO2 (all P < 0.05, Figure 1a, b). Compared with the control findings, the rats exposed to NaAsO2 had significantly lower body weight (P < 0.05, Figure 1c). The liver index and serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels were markedly increased in the HF rat model (all P < 0.05, Figure 1d–f). Chronic NaAsO2 exposure also caused a significant increase in liver MDA content, whereas liver T-SOD levels were decreased (both P < 0.05, Figure 1g, h).

Figure 1.

Chronic NaAsO2 exposure induced HF-like phenotypes. (a, b) Liver, urine, and serum arsenic concentrations were increased in the HF rat model. (d) Body weight was lower in the HF rat model. (d) The liver index was lower in the HF rat model. (e, f) Serum ALT and AST levels were increased in the HF rat model. (g, h) Changes of MDA and T-SOD levels after 20 weeks. (i) Advanced fibrosis formation in the HF rat model. Scale bar, 100 μm. *P < 0.05 vs. control.

HF, hepatic fibrosis, ALT, alanine aminotransferase; AST, aspartate aminotransferase; MDA, malondialdehyde; T-SOD, total superoxide dismutase.

There was obvious bridging necrosis and pseudolobular formation in the liver tissue of rats exposed to NaAsO2, and the Ishak score was 5 to 6. In the control group, the lobular structure integrity was maintained without inflammatory cell infiltration and fibrosis, and the Ishak score was 0 (Figure 1i). Chronic NaAsO2 exposure thus mimicked the phenotypes of HF as confirmed by H&E and Masson staining of liver sections.

Anti-fibrosis effect of oxymatrine in NaAsO2-induced HF

Liver and serum arsenic concentrations were not affected by oxymatrine exposure. NaAsO2-induced ECM secretion was inhibited after 4 or 8 weeks of exposure to either low- or high-dose oxymatrine (all P < 0.05, Figure 2a–c). After 4 or 8 weeks of treatment, both the low and high doses of oxymatrine increased the body weight of rats, although body weight remained below the control level (data not shown). Increases in serum ALT and AST levels were reversed by 4 or 8 weeks of oxymatrine treatment (data not shown). Meanwhile, 4 weeks of oxymatrine treatment were sufficient to reduce the liver index test at the high dose but not the low dose. At 8 weeks, the liver index was normalized in both the low- and high-dose groups. ELISA and western blotting analysis were used to detect α-SMA expression and revealed that oxymatrine treatment inhibited the activation of HSCs (P < 0.05, Figure 2d, e). The expression of GRP78, an ER stress marker, was increased by NaAsO2 exposure (P < 0.05), and its upregulation was alleviated by oxymatrine treatment (P < 0.05, Figure 2f). The changes in liver MDA and T-SOD levels also indicated that oxymatrine treatment suppressed NaAsO2-induced oxidative stress (both P < 0.05, Figure 2g, h). In addition, western blotting illustrated for cleaved caspase-12, TNF-α, and IL-6 further verified that NaAsO2-induced apoptosis and inflammation were reversed by oxymatrine treatment.

Figure 2.

Oxymatrine improves the NaAsO2-induced fibrosis-like phenotype. (a–c) Liver TGF-β1, HA, and COL-IV expression changes were reversed by treatment with oxymatrine. (d, e) Liver α-SMA upregulation was alleviated after 8 weeks of treatment with oxymatrine. (f) GRP78 upregulation in the liver was alleviated by oxymatrine treatment. (g, h) NaAsO2-induced fibrosis reversed by exposure to high and low doses of oxymatrine for 8 weeks. *P < 0.05 vs. control; #P < 0.05 vs. NaAsO2 group.

TGF, transforming growth factor; HA, hyaluronic acid; COL-IV, collagen type IV; α-SMA, α-smooth muscle actin; GRP78, endoplasmic reticulum chaperone BiP.

iTRAQ analysis of DEPs

iTRAQ analysis was combined with liquid chromatography–mass spectrometry to detect DEPs in the livers of rats in the control, HF, and oxymatrine treatment groups. In total, 1156 DEPs were identified including 703 proteins with differences in expression between oxymatrine- and vehicle-treated rats (Figure 3a). Hierarchical cluster analysis was performed according to the DEPs for two categories: control versus NaAsO2 exposure and vehicle versus oxymatrine treatment (Figure 3b, c).

Figure 3.

Identification of DEPs in the NaAsO2-induced HF model and the anti-fibrotic effect of oxymatrine. (a) Venn diagram and heat map comparing the significant DEPs between, (b) the control and HF groups and between, and (c) the HF and high-dose oxymatrine groups.

DEPs, differentially expressed proteins; HF, hepatic fibrosis.

GO functional annotation indicated that the DEPs were enriched in 136 biological process (BP) terms, 39 cellular component (CC) terms, and 634 molecular function (MF) terms in the comparison between the control and NaAsO2 groups, whereas 208 BP terms, 80 CC terms, and 97 MF terms were identified in the comparison between the vehicle and oxymatrine group (Figure 4a). KEGG pathway analysis revealed 43 pathways that were altered by NaAsO2 exposure compared with the control findings and 38 pathways that were altered by oxymatrine treatment versus vehicle treatment (Figure 4b). In particular, “response to ER stress” was identified as a BP term, “ER membrane and lumen” was identified as a CC term, and “proteins process in ER” was identified in the KEGG pathway analysis. The iTRAQ and GRP78 protein analysis indicated that NaAsO2 exposure induced ER stress, and this stress was alleviated by oxymatrine treatment.

Figure 4.

Pathways and functional enrichment analysis of DEPs. (a) Gene Ontology functional classification of DEPs related to CC terms between the control and HF groups and (b) Kyoto Encyclopedia of Genes and Genomes pathway analysis comparing the control and HF groups.

DEPs, differentially expressed proteins; CC, cellular component.

Oxymatrine suppresses NaAsO2-induced proliferation and ER stress in vitro

In the present study, LX2 cells were selected to investigate the underlying mechanism of NaAsO2-induced liver fibrosis and the anti-fibrotic effects of oxymatrine. The CCK-8 assay demonstrated that 0.5 and 1 μM NaAsO2 promoted LX2 cell proliferation in a time-dependent manner. Subsequently, we found that oxymatrine could inhibit 1 μM NaAsO2-induced cell proliferation. Therefore, this concentration was selected for the subsequent experiments. Flow cytometry of cleaved caspase-12 levels indicated that NaAsO2 treatment promoted apoptosis in LX2 cells, and this effect was suppressed by oxymatrine (Figure 5a, b). Compared with the control findings, NaAsO2 increased α-SMA levels, and this increase inhibited by oxymatrine (Figure 5b). The changes in α-SMA expression indicated that NaAsO2 exposure could active HSCs, and this effect was suppressed by oxymatrine. Calpain 2, CHOP, GRP78, and Serca2 protein levels were also determined to evaluate the level of ER stress. Western blot analysis indicated that NaAsO2-induced ER stress could be reversed by treatment with oxymatrine (Figure 5c, d). After NaAsO2 exposure, the cellular calcium level was increased, and this increase was blocked by treatment with oxymatrine (Figure 5e). From these data, it was concluded that ER stress and cellular calcium homeostasis are associated with NaAsO2 and oxymatrine treatment in LX2 cells.

Figure 5.

NaAsO2 promotes apoptosis and induces endoplasmic reticulum stress in LX2 cells. (a) Flow cytometric analysis of LX2 cells, (b) α-Smooth muscle actin and cleaved caspase-12 upregulation were reversed by treatment with oxymatrine, (c, d) Western blotting and statistical analysis of calpain 2, CHOP, GRP78, and Serca2 expression in LX2 cells treated with NaAsO2 and oxymatrine, and (e) Calcium concentration in LX2 cells after NaAsO2 and oxymatrine treatment. *P < 0.05 vs. control, #P < 0.05 vs. NaAsO2 group.

α-SMA, α-smooth muscle actin; CHOP, DNA damage-inducible transcript 3 protein; GRP78, endoplasmic reticulum chaperone BiP; Serca2, sarcoplasmic/endoplasmic reticulum Ca2+ transport ATPase 2.

SOD and MDA levels were detected to evaluate the level of oxidative stress. The results illustrated that oxymatrine could reverse NaAsO2-induced oxidative stress. In addition, oxymatrine suppressed NaAsO2-stimulated ECM secretion. qPCR for CHOP, GRP78, Serca2, and RyR1 indicated that NaAsO2-induced ER stress was alleviated by treatment with oxymatrine.

Discussion

In the present study, we found that oxymatrine can reverse ER stress and restore calcium homeostasis, which may be the mechanism underlying its anti-fibrotic effects. The efficacy of oxymatrine was verified in both a NaAsO2-induced rat model of HF and LX2 cells. The present results support its potential utility for treating and preventing HF.

Arsenic, a group 1 carcinogen, can affect many organs, including the kidneys, skin, and liver. As the main target of arsenic toxicity, chronic arsenic exposure induces severe liver fibrosis and various types of cancer.[17-19] The present study indicated that ER stress and calcium homeostasis are important elements in the progression of HF and that oxymatrine has anti-fibrotic effects in vitro and in vivo. It was noted that NaAsO2 exposure promoted apoptosis, oxidative damage, and ECM secretion in rats. Histological staining of liver sections revealed that NaAsO2 exposure induced serve fibrosis-like phenotypes. The results of the present study are consistent with previous findings.[13],[20]

Oxymatrine has a wide range of pharmacological activities. It has been reported that oxymatrine alleviates CCl4 exposure-induced HF in a mouse model.[21] In the present study, we found that the HF-like phenotypes induced by NaAsO2 exposure were alleviated by treatment with oxymatrine. Moreover, NaAsO2 exposure can promote apoptosis, increase the expression of fibrosis-related proteins, induce ER stress, and disrupt calcium homeostasis, and all of these effects were reversed by oxymatrine. GRP78 is a heat shock protein in essence that functions as a molecular chaperone. It can facilitate protein folding and relieve stress. When ER stress occurs, GRP78 expression increases. Thus, in the present study, GRP78 was regarded as a marker of ER stress. Moreover, it was confirmed that GRP78 is a marker of ER stress in the development of liver fibrosis in other studies.[6]

Then, iTRAQ and liquid chromatography–mass spectrometry were used to determine the changes in protein expression induced by NaAsO2 exposure and oxymatrine treatment. On this basis, we identified proteins with altered expression in GO and KEGG analyses. According to the results, ER stress played an important role in the development of hepatic fibrosis in the NaAsO2 exposure model. Moreover, ER-related pathways were also altered by treatment with oxymatrine, which indicated that oxymatrine may regulate ER stress to generate an anti-fibrotic effect. Wu et al. demonstrated using iTRAQ that GSH and TGF-β1 expression was upregulated in arsenic-induced liver fibrosis.[22] Because of the different doses of NaAsO2 and different bioinformatics analysis methods used, they did not find proteins related to ER stress in their mouse model.

ECM secretion may be the key driver of HF. In this study, we found that NaAsO2-treated LX2 cells secreted ECM, and this secretion was alleviated by treatment with oxymatrine. Previous researchers indicated that ER stress is a major contributor to liver disease and hepatic fibrosis.[23] Furthermore, regulation of unfolded protein response signaling pathways to suppress ER stress alleviated HF in a non-alcoholic fatty liver disease mouse model.[24],[25] ER stress is associated with intracellular calcium homeostasis.[26] In the present study, we also found that cellular calcium levels were depressed by NaAsO2 exposure and restored by oxymatrine treatment.

Conclusion

Oxymatrine can restore calcium homeostasis, thereby reversing ER stress and alleviating HF following NaAsO2 exposure. However, further studies are required to verify whether this is the general mechanism of HF development and the anti-fibrotic effects of oxymatrine. Further studies aiming to develop new anti-fibrotic drugs should focus on ER stress and cellular calcium homeostasis.