| Literature DB >> 33036991 |
Pei Zhou1,2,3, Xiaoke Yuan4, Hui Liu1,2,3, Yanli Qi1,2,3, Xiulai Chen1,2,3, Liming Liu5,2,3.
Abstract
pecies">Candida glabrata is a high-performance microbial cell factory for the production of organic acids. To elucidate the role of the C. glabrata Mediator tail subunit Med2 (CgMed2) at pH 2.0, we deleted or overexpressed CgMed2 and used transcriptome analysis to identify genes that are regulated by CgMed2. At pH 2.0, the deletion of CgMed2 resulted in a cell growth decrease of 26.1% and a survival decrease of 32.3%. Overexpression of CgMed2 increased cell growth by 12.4% and cell survival by 5.9% compared to the wild-type strain. Transcriptome and phenotypic analyses identified CgYap6 as a transcription factor involved in acid pH stress tolerance. Deletion of CgYap6 caused growth defects, whereas its overexpression enhanced cell growth at pH 2.0. Furthermore, total glycerophospholipid content and membrane integrity decreased by 33.4% and 21.8%, respectively, in the CgMed2Δ strain; however, overexpression of CgMed2 increased the total glycerophospholipid content and membrane integrity by 24.7% and 12.1%, respectively, compared with those of the wild-type strain at pH 2.0. These results demonstrated that under acid pH stress, CgMed2 physically interacts with CgYap6, which translocates from the cytoplasm to the nucleus after being phosphorylated by the protein kinase CgYak1. Once in the nucleus, CgYap6 recruits CgMed2 to express glycerophospholipid-related genes. Our study elucidated the function of CgMed2 under acid pH stress and provides a potential strategy to equip Candida glabrata with low-pH resistance during organic acid fermentation.IMPORTANCE This study investigated the function of the Mediator tail subunit CgMed2 in C. glabrata under low-pH stress. The protein kinase CgYak1 activates CgYap6 for the recruitment of CgMed2, which in turn increases glycerophospholipid content and membrane integrity to confer low-pH stress tolerance. This study establishes a new link between the Mediator tail subunit and transcription factors. Overall, these findings indicate that CgMed2 is a novel target to induce the low-pH stress response in C. glabrata.Entities:
Keywords: Candida glabratazzm321990; Mediator subunit Med2; glycerophospholipid; low-pH stress; transcriptome
Mesh:
Substances:
Year: 2020 PMID: 33036991 PMCID: PMC7688241 DOI: 10.1128/AEM.01915-20
Source DB: PubMed Journal: Appl Environ Microbiol ISSN: 0099-2240 Impact factor: 4.792
FIG 1CgMed2 is essential for cell growth under low-pH stress. (A and B) The wild-type (wt), CgMed2Δ, and CgMed2Δ/CgMED2 strains were spotted on YNB plates at pH 5.5 and pH 2.0. (C and D) Growth curves of the wild-type (wt), CgMed2Δ, and CgMed2Δ/CgMED2 at pH 5.5 and pH 2.0. (E) Cell survival of all three strains at different pHs. (F) IC50s of the wild-type (wt), CgMed2Δ, and CgMed2Δ/CgMED2 strains at different concentration of HCl. Error bars indicate standard deviations. *, P < 0.05; **, P < 0.01; ***, P < 0.001 (compared to the corresponding wild-type strain, as determined by a t test).
FIG 2Global transcriptome analysis of the mutant CgMed2Δ and the wild-type strain. (A) Venn diagrams depicting the numbers of upregulated and downregulated genes in the wild-type strain and CgMed2Δ strain under the pH 2.0 condition compared with the expression levels of those genes in the corresponding strains under the pH 5.5 condition. (B) Venn diagrams depicting the numbers of upregulated and downregulated genes in the CgMed2Δ strain under pH 5.5 and pH 2.0 conditions compared with the expression levels of those genes in the wild-type strains under pH 5.5 and pH 2.0 conditions. (C and D) Quantitative reverse transcription-PCR (qRT-PCR) verified the mRNA expression levels of the most downregulated transcription factor genes, calculated relative to the ACT1 level, at pH 2.0 and pH 5.5. Error bars indicate the standard deviations. *, P < 0.05; **, P < 0.01; ***, P < 0.001 (compared to the corresponding wild-type strain, as determined by a t test). (E) The most downregulated transcription factor genes were deleted, and the mutant strains were spotted on YNB plates under pH 2.0 and pH 5.5 conditions. (F) The most downregulated transcription factor genes were overexpressed, and the mutant strains were spotted on YNB plates under pH 2.0 and pH 5.5 conditions.
Differentially expressed genes associated with transcription factors and protein kinase
| Gene name | Gene product function | Log2FC | ||
|---|---|---|---|---|
| 5.5 | 2.0 | |||
| YAP6 | Basic leucine zipper transcription factor; computational analysis suggests a role in regulation of expression of genes involved in carbohydrate metabolism | −0.93 | −1.79 | |
| HAP5 | Subunit of the Hap2p/3p/4p/5p CCAAT-binding complex; complex is a transcriptional activator and global regulator of respiratory gene expression | −0.96 | −1.39 | |
| COM2 | Transcription factor that binds IME1 upstream activation signal; | −0.89 | −1.15 | |
| AFT1 | Transcription factor involved in iron utilization and homeostasis | −0.32 | −1.60 | |
| SUT1 | Positively regulates sterol uptake genes under anaerobic conditions; involved in hypoxic gene expression | −0.77 | −1.56 | |
| YAP5 | Basic leucine zipper iron-sensing transcription factor; involved in diauxic shift | −0.62 | −2.21 | |
| MSN2 | Stress-responsive transcriptional activator; activated in stochastic pulses of nuclear localization in response to various stress conditions | −1.65 | −1.51 | |
| SCH9 | Protein kinase; involved in transactivation of osmostress-responsive genes; integrates nutrient signals and stress signals from sphingolipids to regulate lifespan | −0.58 | −1.54 | |
| YAK1 | Serine-threonine protein kinase; component of a glucose-sensing system that inhibits growth in response to glucose availability | −0.86 | −2.46 | |
FC, fold change, which represents the ratio of the expression levels for two samples.
FIG 3CgMed2 interacts with CgYap6. (A) CgMed2 and CgYap6 were fused with the eGFP reporter and overexpressed, and the subcellular localization was visualized under pH 2.0 and pH 5.5 conditions. (B) The wild-type, CgMed2Δ, CgYap6Δ, and CgMed2ΔYap6Δ strains were spotted on YNB plates under pH 2.0 and pH 5.5 conditions. (C) Yeast two-hybrid assays confirmed the interaction between CgMed2 and CgYap6 at pH 2.0. (D) Coimmunoprecipitation assay to detect the interaction between CgYap6 and CgMed2 in vivo at pH 2.0.
Survival of various strains at pH 5.5 and pH 2.0
| Strain | % survival | |
|---|---|---|
| 5.5 | 2.0 | |
| Wild type | 100 | 77.4 (2.23) |
| 98.3 (1.34) | 44.6 (3.41) | |
| 99.6 (1.62) | 47.5 (2.57) | |
| 96.4 (1.47) | 42.3 (1.95) | |
Survival rates are expressed relative to those of wild-type cells. Results are the averages from three experiments, with standard deviations in parentheses.
P ≤ 0.01 versus wild type.
FIG 4CgYak1 phosphorylates CgYap6 at pH 2.0. (A) Immunoprecipitation of CgYap6-His was performed in the wild-type (wt) and CgYak1Δ strains at pH 5.5 and pH 2.0, followed by Western blotting using anti-His antibody. The arrow indicates the phosphorylation band of CgYap6. (B) Extracts prepared from CgYap6-His-expressing wild-type cells, grown at pH 5.5 and pH 2.0, were treated with alkaline phosphatase and phosphatase inhibitor as indicated. The arrows indicate the phosphorylation band of CgYap6. (C) Immunoprecipitation of phosphorylated CgYap6 was performed in the wild-type (wt) and CgYak1Δ strains at pH 5.5 and pH 2.0, followed by Western blotting using anti-phosphoserine/threonine antibody. (D) Quantification of relative phosphorylation levels of CgYap6 in the wild-type (wt) and CgYak1Δ strains. Error bars indicate the standard deviations. *, P < 0.05; **, P < 0.01; ***, P < 0.001 (compared to the corresponding wild-type strain, as determined by a t test).
FIG 5CgMed2 is involved in regulating glycerophospholipid metabolism. (A) Statistical analysis of the metabolic pathways in which the differentially expressed genes were significantly enriched in the CgMed2Δ strain compared with levels in the wild-type (wt) strain at pH 2.0. (B) Heat maps of differentially expressed genes involved in glycerophospholipid metabolism. (C and D) Quantitative reverse transcription-PCR (qRT-PCR) verified the mRNA expression levels of the glycerophospholipid genes, calculated relative to the ACT1 level, under normal (C) and low-pH (D) conditions. Error bars indicate the standard deviations. *, P < 0.05; **, P < 0.01; ***, P < 0.001 (compared to the corresponding wild-type strain, as determined by a t test).
FIG 6Untargeted metabolomics analysis of the wild-type strain and mutant CgMed2Δ. (A) The results were combined from hydrophilic metabolomics extraction by LC-MS (including negative ionization and positive ionization). (B and C) Glycerophospholipid composition changes in the wild-type (wt), CgMed2Δ, and CgMed2Δ/CgMED2 strains at pH 5.5 and pH 2.0. All data are presented as mean values from three independent experiments. Error bars indicate the standard deviations. *, P < 0.05; **, P < 0.01; ***, P < 0.001 (compared to the corresponding wild-type strain, as determined by a t test).
FIG 7CgYap6 regulates glycerophospholipid genes in a CgYak1-dependent manner. (A and B) Association of CgYap6 with the core promoter of glycerophospholipid metabolism genes was determined by ChIP analysis combined with qRT-PCR to measure occupancy in the wild-type (wt) and CgYak1Δ strains at pH 5.5 and pH 2.0. Relative fold enrichment was calculated by the formula provided in Materials and Methods. (C and D) Transcript levels of genes involved in glycerophospholipid metabolism were analyzed with RNA prepared from the wt and CgYak1Δ strains at pH 5.5 and pH 2.0. The data were normalized to the expression level of the ACT1 gene. All data are presented as mean values from three independent experiments. Error bars indicate the standard deviations. *, P < 0.05; **, P < 0.01; ***, P < 0.001 (compared to the corresponding wild-type strain, as determined by a t test).
FIG 8CgMed2 affects membrane integrity. (A) Quantification of membrane integrity in the wild-type, CgMed2Δ, and CgMed2Δ/CgMED2 strains at pH 5.5 and pH 2.0. (B and C) Scanning electron microscopy analysis of membrane integrity in the wild-type, CgMed2Δ, and CgMed2Δ/CgMED2 strains at pH 5.5 and pH 2.0. Under a confocal fluorescence microscope, all cells showed red fluorescence indicating an integral membrane, whereas cells with a damaged membrane showed green fluorescence (SYTOX green); cells with integral or damaged membranes can be stained by FM4-64. Error bars indicate the standard deviations. *, P < 0.05; **, P < 0.01; ***, P < 0.001 (compared to the corresponding wild-type strain, as determined by a t test).
Strains and plasmids used in this study
| Strain or plasmid | Relevant characteristics | Reference |
|---|---|---|
| Strains | ||
| | This study | |
| | This study | |
| | This study | |
| | This study | |
| | This study | |
| | This study | |
| | This study | |
| | This study | |
| | This study | |
| | This study | |
| | This study | |
| | This study | |
| | This study | |
| | This study | |
| | This study | |
| | This study | |
| AH109 | This study | |
| | This study | |
| | This study | |
| Plasmids | ||
| pY26 | 2μ Amp | This study |
| pGBKT7 | Kan | This study |
| pGADT7 | Amp | This study |
Primers used in this study
| Category and name | Sequence (5′→3′) |
|---|---|
| Deletion | |
| L- | TACAAATTAGCTATTATTACCAA |
| L- | |
| | |
| | |
| R- | |
| R- | GGATAAATTTTTTGATAGTTTAGTA |
| L- | TTTATCAGGAACAAGCTGTTAC |
| L- | |
| | |
| | |
| R- | |
| R- | AAAAGCATCTGTCACAGAAAAG |
| L- | TTTGTAGTGCCGCTTTCCC |
| L- | |
| | |
| | |
| R- | |
| R- | ACAACTTTTTCTTGGTATAATTTAT |
| L- | CTTTCCTTTAATGCTCTCGA |
| L- | |
| | |
| | |
| R- | |
| R- | CCTCATTAAGTGATGACGAACTACA |
| L- | TATAAGGAAGGAAAAGTTAAGACGT |
| L- | |
| | |
| | |
| R- | |
| R- | TCTGTACCATCTTTTATATGCAATC |
| L- | AAAAAGAAAAAGCTATAGCAAGGAG |
| L- | |
| | |
| | |
| R- | |
| R- | GCCTTTTGTGTTTAAGTTGC |
| L- | ATGCGAACCCTTCGCC |
| L- | |
| | |
| | |
| R- | |
| R- | AAAACTGTGACTTTCTGCCT |
| L- | ACTATATCAGCAGCTACGAGCC |
| L- | |
| | |
| | |
| R- | |
| R- | TGGGGACAACTCACTGGAT |
| Overexpression | |
| | |
| | |
| | |
| | |
| | |
| | |
| | |
| | |
| | |
| | |
| | |
| | |
| | |
| | |
| Yeast two-hybrid assay | |
| BD- | |
| BD- | |
| AD- | |
| AD- | |
| Coimmunoprecipitation | |
| pY26/PGPD- | ATTCTAGAACTAGTGGATCCATGAGTTACAAGAACAGGCT |
| pY26/PGPD- | TCGACGGTATCGATAAGCTTTTACAGATCCTCTTCAGAGATGAGTTTCTGCTCGATATTAAAGCCATTTAGGTCTAGG |
| pY26/PTEF- | GAATTGTTAATTAAAGATCTCTAGTGGTGGTGGTGGTGGTGGGACTTCTCGCCAGCAATTG |
| pY26/PTEF- | CAGTTAACTCCGGACCGCGGATGGGACAAGTTAACATGCG |
| RT-PCR | |
| | GGAGGATTCCAAATGCTA |
| | GTTGCTCAAGAATTCGTC |
| | ACGAGATAGAGTCTACGA |
| | GCGAATATTATAGGTGCC |
| | GAGGAACTACTTCAATAACATA |
| | CGTCATTAAGAGTCATTACA |
| | GCATCAGTACACCACTAG |
| | GACCATTTTCCGAAGAGA |
| | GCCAGATCGACTAATAAC |
| | TGGTGACATGTATATTGAC |
| | CGTTGAGTAGTGTACCAA |
| | AGCCTTCTTCAGTTCTAG |
| | AGTGCATTGGTATTTTCC |
| | TGAGGATGGAAGTAATTCA |
| | ACCTGACTTGTGATTTGA |
| | TTGGCTTAACGGTAATGA |
| | CTCTGATGCTATTGATAAAGG |
| | CACAGTACGATAGGACAG |
| | GCTGAAGAGATTGCCTAA |
| | AGTCGCATAGGTGAATAG |
| | CCGAAGAGACTAACCTATA |
| | CCAGTTTATTGGTGAATGA |
| | AAGGGCAAGTCTAAGTTC |
| | GCAAGAAGAAGATGAAGATG |
| | GCTCCATACTTCTACTCTG |
| | CAGCAATCTTGGTTAGGA |
Underlining indicates sequences of regions flanking a target gene or a restriction site.