| Literature DB >> 33036234 |
Michael Frimpong1,2, Shirley Victoria Simpson3, Hubert Senanu Ahor1,2, Abigail Agbanyo2, Solomon Gyabaah2, Bernadette Agbavor2, Ivy Brago Amanor3, Kennedy Kwasi Addo3, Susanne Böhlken-Fascher4, Jonas Kissenkötter4, Ahmed Abd El Wahed4,5, Richard Odame Phillips2.
Abstract
Yaws is a skin debilitating disease caused by Treponema pallidum subspecies pertenue with most cases reported in children. World Health Organization (WHO) aims at total eradication of this disease through mass treatment of suspected cases followed by an intensive follow-up program. However, effective diagnosis is pivotal in the successful implementation of this control program. Recombinase polymerase amplification (RPA), an isothermal nucleic acid amplification technique offers a wider range of differentiation of pathogens including those isolated from chronic skin ulcers with similar characteristics such as Haemophilus ducreyi (H. ducreyi). We have developed a RPA assay for the simultaneous detection of Treponema pallidum (T. pallidum) and H. ducreyi (TPHD-RPA). The assay demonstrated no cross-reaction with other pathogens and enable detection of T. pallidum and H. ducreyi within 15 min at 42 °C. The RPA assay was validated with 49 clinical samples from individuals confirmed to have yaws by serological tests. Comparing the developed assay with commercial multiplex real-time PCR, the assay demonstrated 94% and 95% sensitivity for T. pallidum and H. ducreyi, respectively and 100% specificity. This simple novel TPHD-RPA assay enables the rapid detection of both T. pallidum and H. ducreyi in yaws-like lesions. This test could support the yaws eradication efforts by ensuring reliable diagnosis, to enable monitoring of program success and planning of follow-up interventions at the community level.Entities:
Keywords: Haemophilus ducreyi; Treponema pallidum; molecular diagnostics; point-of-care test; recombinase polymerase amplification
Year: 2020 PMID: 33036234 PMCID: PMC7709673 DOI: 10.3390/tropicalmed5040157
Source DB: PubMed Journal: Trop Med Infect Dis ISSN: 2414-6366
RPA Primer and Probe for T. pallidum and H. ducreyi Detection.
| Name | Sequence | Amplicon Size |
|---|---|---|
| TP_RPA_FP3 | GTAACACTAATGTCGAGACTGAAAAGGAGTGC | 144 bp |
| TP_RPA_RP2 | GAATGATGAGACGCTCACACTTGTTATGC | |
| TP_RPA_P1 | GTATCTGCATCTGCTGTGCAGGATCCGGCA (BHQ2-dT) (X-dSpacer) (ROX-dT)GTCCAAGCTGTCATG-PH | |
| Hd_RPA_FP3 | TACTCAGGCAACGGATACCCAACATGCA | 169 bp |
| Hd_RPA_RP1 | GAGGTAAATCAGGCTGTTACAGGTCATTTA | |
| Hd_RPA_P1 | TACGCCTAAATCGTTAACTGCGGGATTAGG (BHQ2-dT) (X-dSpacer) (FAM-dT)AGATGGCCATGGTAG-PH |
FP: Forward primer, RP: Reverse primer, P: probe, FAM-dT and ROX-dT: thymidine nucleotide carrying Fluorochrome; dSpacer: tetrahydrofuran basic site mimic, BHQ2-dT: thymidine nucleotide carrying Black Hole quencher, PH: 3′ phosphate group.
Figure 1Sensitivity analysis of the singleplex RPA assay using synthetic molecular DNA standard. The assay showed a sensitivity of 10 copies/reaction in T. pallidum and H. ducreyi. RPA reaction tubes were removed and quick vortexed/mixed four minutes after state of amplification and hence no florescence recorded. Sensitivity test for T. pallidum (a) and H. ducreyi (b). “Neg” is negative control or no template control (NTC).
Figure 2Probit regression analysis. The limit of detection at 95% probability is 11 and 6 DNA molecules for T. pallidum and H. ducreyi, respectively. CI: confidence interval.
Diagnostic Performance of TPHD-RPA Assay as Compared to Multiplex qPCR for Each Pathogen.
| Target Organism | Samples Category | Sensitivity % | Specificity % | PPV % | NPV % | N | TPHD-RPA | qPCR | |
|---|---|---|---|---|---|---|---|---|---|
| (95% CI) | (95% CI) | (95% CI) | (95% CI) | pos | neg | ||||
|
| All samples | 94 | 100 | 100 | 97 | 49 | pos | 16 | 0 |
| (73−100) | (89−100) | (81−100) | (85−100) | neg | 1 | 32 | |||
| Samples containing a single organism | 100 | 100 | 100 | 100 | 42 | pos | 10 | 0 | |
| (72−100) | (89−100) | (72−100) | (89−100) | neg | 0 | 32 | |||
| Samples containing both pathogens | 86 | 100 | 100 | 97 | 39 | pos | 6 | 0 | |
| (49−100) | (89−100) | (61−100) | (84−100) | neg | 1 | 32 | |||
|
| All samples | 95 | 100 | 100 | 97 | 49 | pos | 20 | 0 |
| (77−100) | (88−100) | (84−100) | (83−100) | neg | 1 | 28 | |||
| Samples containing a single organism | 100 | 100 | 100 | 100 | 42 | pos | 14 | 0 | |
| (78−100) | (88−100) | (78−100) | (88−100) | neg | 0 | 28 | |||
| Samples containing both pathogens | 86 | 100 | 100 | 97 | 39 | pos | 6 | 0 | |
| (49−100) | (89−100) | (61−100) | (85−100) | neg | 1 | 32 | |||
CI: confidence interval, PPV: Positive predictive value, NPV: Negative predictive value, n: Number of samples tested, pos: positive, neg: negative.