C. elegans CLASP/CLS-2 negatively regulates membrane ingression throughout the oocyte cortex and is required for polar body extrusion.

The requirements for oocyte meiotic cytokinesis during polar body extrusion are not well understood. In particular, the relationship between the oocyte meiotic spindle and polar body contractile ring dynamics remains largely unknown. We have used live cell imaging and spindle assembly defective mutants lacking the function of CLASP/CLS-2, kinesin-12/KLP-18, or katanin/MEI-1 to investigate the relationship between meiotic spindle structure and polar body extrusion in C. elegans oocytes. We show that spindle bipolarity and chromosome segregation are not required for polar body contractile ring formation and chromosome extrusion in klp-18 mutants. In contrast, oocytes with similarly severe spindle assembly defects due to loss of CLS-2 or MEI-1 have penetrant and distinct polar body extrusion defects: CLS-2 is required early for contractile ring assembly or stability, while MEI-1 is required later for contractile ring constriction. We also show that CLS-2 both negatively regulates membrane ingression throughout the oocyte cortex during meiosis I, and influences the dynamics of the central spindle-associated proteins Aurora B/AIR-2 and MgcRacGAP/CYK-4. We suggest that proper regulation by CLS-2 of both oocyte cortical stiffness and central spindle protein dynamics may influence contractile ring assembly during polar body extrusion in C. elegans oocytes.

Introduction

Oocyte meiosis comprises a single round of genome replication followed by two highly asymmetric cell divisions that produce one haploid gamete and two small polar bodies that contain discarded chromosomes [1-4]. An acentrosomal spindle segregates homologous chromosomes during the first reductional division, called meiosis I, when half of the recombined homologs are extruded into the first polar body. The equational meiosis II division then segregates sister chromatids, with half extruded into a second polar body and half remaining in the oocyte cytoplasm. Despite being essential for reducing oocyte ploidy, little is known about the cues that organize and influence the actomyosin contractile ring that mediates polar body extrusion.

The dynamics of membrane ingression relative to the oocyte meiotic spindle during polar body extrusion vary from species to species, and the relationships between spindle structure and furrow ingression remain poorly understood [5]. In Caenorhabditis elegans, the oocyte contractile ring initially forms distal to the membrane-proximal meiotic spindle pole, with the spindle axis oriented orthogonally to the overlying cell cortex [5-7]. When observed in utero, the contractile ring ingresses past both the membrane-proximal pole and one set of the segregating chromosomes to then constrict and ultimately separate the nascent polar body from the oocyte [6]. These dynamics contrast substantially with mitotic cytokinesis (Fig 1A), during which signals from astral microtubules and the central spindle position the contractile ring midway between the two spindle poles [8-10]. While the signals required for contractile ring assembly and constriction during mitotic cytokinesis are relatively well understood, how oocyte meiotic spindles influence contractile ring dynamics during polar body extrusion is not known.

Fig 1

Schematics of oocyte meiotic polar body extrusion, mitotic cytokinesis and oocyte meiotic spindle assembly-defective mutants.

(A) The positioning and dynamics of contractile ring assembly and ingression during oocyte polar body extrusion and mitotic cytokinesis. (B) Illustrations of oocyte meiotic spindle structure in control and mutant oocytes. Green = microtubules, blue = chromosomes, magenta = contractile rings, and orange = ASPM-1 pole marker, black = plasma membrane. See text for details.

Several genes have been shown to be required for polar body extrusion in C. elegans, but how their functions are coordinated remains poorly understood. Similar to mitotic cytokinesis, polar body cytokinesis requires filamentous actin and the non-muscle myosin II heavy-chain NMY-2 and light-chains MLC-4 and MLC-5 [6,11,12]. The cytoskeletal scaffolding protein anillin/ANI-1 facilitates transformation of the initial actomyosin contractile ring into a midbody tube, with anillin depletion resulting in large and unstable polar bodies that often fuse with the oocyte [7]. Consistent with its role as a key activator of cortical actomyosin, the small GTPase RhoA (RHO-1) and its RhoGEF ECT-2 also are required for oocyte polar body extrusion [6,13]. Knockdown of the centralspindlin complex, comprised of MgcRacGAP/CYK-4 and kinesin-6/ZEN-4, results in the assembly of abnormally large contractile rings and a subsequent failure in extrusion [6]. Finally, the chromosomal passenger complex (CPC) member Aurora B/AIR-2 also is required [14].

Formation of the contractile ring distal to both meiotic spindle poles raises the question of how the ring moves relative to the spindle such that it constricts midway between segregating chromosomes. One mechanism proposed for C. elegans is that global contraction of actomyosin throughout the oocyte cortex produces a hydrostatic cytoplasmic force that, combined with depletion of cortical actomyosin overlying the membrane-proximal pole, leads to an out-pocketing of the membrane within the contractile ring that pulls the tethered spindle into the protruding pocket [6,15]. In support of this hypothesis, increased global cortical contractility due to depletion of casein kinase 1 gamma (CSNK-1), a negative regulator of RhoA activity, often results in extrusion of the entire meiotic spindle [15]. However, assessing whether global cortical contractility is required for polar body extrusion has been challenging due to the overlap in requirements for global cortical contractility and polar body contractile ring assembly and constriction.

Despite a stereotyped spatial relationship between the oocyte meiotic spindle and contractile ring assembly and ingression, little is known about how the spindle might influence ring assembly and dynamics. Nevertheless, four observations suggest that in C. elegans, the meiotic spindle provides important cues. First, meiotic spindles that fail to translocate to the oocyte cortex induce the formation of membrane furrows that ingress deeply towards the displaced spindle [6]. Second, loss of the centralspindlin complex, present at the central spindle during anaphase, results in the formation of rings with an abnormally large diameter [6]. Third katanin/mei-1 mutants, which assemble apolar spindles, produce very large polar bodies during meiosis II when microtubule severing is compromised [16]. Finally, while work in mice suggests that chromosomes themselves may provide cues for ring assembly and polar body extrusion via the small GTPase Ran [17,18], knock down of C. elegans RAN-1 does not prevent polar body extrusion [19,20]. These findings suggest that in C. elegans the oocyte meiotic spindle provides cues that influence contractile ring assembly and ingression.

To explore the relationship between meiotic spindle assembly and polar body extrusion, we have examined polar body extrusion in three spindle assembly defective mutants that each lack the function of a conserved protein: CLASP/CLS-2, kinesin-12/KLP-18, or katanin/MEI-1 (Fig 1B). CLASP family proteins promote microtubule stability through their association with microtubules and their tubulin heterodimer-binding TOG (Tumor Over-expressed Gene) domains, decreasing the frequency of microtubule catastrophe and promoting rescue of de-polymerizing microtubules [21-24]. Moreover, human CLASPs have been shown to influence not only microtubule stability and dynamics, but also to interact with actin filaments and potentially crosslink filamentous actin and microtubules [25]. CLS-2 is one of three C. elegans CLASPs and is required for mitotic central spindle stability and for oocyte meiotic spindle assembly and chromosome segregation [26-29]. Vertebrate kinesin-12/KLP-18 family members promote mitotic spindle bipolarity by contributing to forces that push apart anti-parallel microtubules [30-32]. Consistent with such a function, C. elegans oocytes lacking the kinesin-12 family member KLP-18 form monopolar meiotic spindles that draw chromosomes towards a single spindle pole and fail to segregate them [33-35]. The widely conserved microtubule severing complex katanin is encoded by two C. elegans genes, mei-1 and mei-2 [36,37]. Loss of either subunit results in the formation of apolar meiotic spindles that fail to congress or segregate chromosomes [33,38,39], and mutant alleles with reduced microtubule severing extrude abnormally large polar bodies during meiosis II [16].

Here we report our use of fluorescent protein fusions and live cell imaging to characterize polar body extrusion during meiosis I in mutants lacking the function of CLS-2, KLP-18 or MEI-1. Previous studies indicate that both CLS-2 and MEI-1 are involved in polar body extrusion, with oocytes lacking CLS-2 frequently failing to extrude polar bodies [26,29,40], and oocytes lacking MEI-1 forming very large polar bodies [16,41-43]. Furthermore, klp-18 mutants sometimes lack an oocyte pronucleus, suggesting that all oocyte chromosomes can be extruded [33]. However, the process of polar body extrusion has not been directly examined in any of these mutants. Our live imaging of contractile ring assembly and ingression in these three spindle-defective mutant backgrounds shows that bipolar spindle assembly and chromosome segregation are not required for oocyte contractile ring assembly and polar body extrusion. However, CLS-2 is required for contractile ring assembly or stability, and acts as a negative regulator of global cortical membrane ingressions, while MEI-1 may be required late in polar body extrusion for contractile ring constriction. We suggest that CLS-2 influences oocyte cortical stiffness to promote polar body extrusion, and we further suggest that disruption of central spindle-associated protein dynamics may also contribute to proper oocyte meiotic contractile ring assembly and ingression.

Results

CLS-2 is required for oocyte meiotic spindle assembly and polar body extrusion

To investigate the role of CLS-2, we first examined the localization of an extragenic CLS-2::GFP fusion [27] in live oocytes (Fig 2A, S1 Fig, S1 and S2 Movies). Consistent with previous reports, CLS-2::GFP initially localized to meiosis I spindle microtubules and kinetochore cups, and to small patches, previously described as rod-shaped structures or linear elements, dispersed throughout the oocyte cortex [26,44]. Around the time of anaphase onset, the cortical CLS-2::GFP patches disappeared and CLS-2::GFP localized to the central spindle between the segregating chromosomes [29,40]. These results suggest that CLS-2 might have roles not only at the oocyte meiotic spindle but also throughout the oocyte cortex.

Fig 2

CLS-2 is required for oocyte meiotic spindle assembly and polar body extrusion.

(A) Control oocytes expressing CLS-2::GFP and mCherry:H2B during meiosis I; dashed boxes indicate the zoomed-in regions shown in top row. (B) Protein domain map for wild type CLS-2 [27], and location of first premature stop codon due to frameshift in cls-2(or1948). (C) Table of embryonic viability in wild type (N2) and cls-2 CRISPR-generated loss of function alleles. (D) Control and mutant oocytes expressing GFP::Tubulin and mCherry::H2B during meiosis I; t = 0 seconds (0s) corresponds to the end of meiosis I and beginning of meiosis II (see Materials and methods). (E) Comparison of integrated spindle microtubule pixel intensity over time between control (n = 17) and cls-2 mutant oocytes (n = 9 @ -340s, n = 10 @ -330 to -300s, n = 11 @ -290 to -160s, and n = 12 @ -150 to 0s), with the average intensity indicated and one standard deviation indicated. Here and in subsequent figure panels, T = 0s corresponds to the end of meiosis I and beginning of meiosis II, unless indicated otherwise (see Materials and methods). The -340s time point corresponds to roughly the beginning of anaphase in control oocytes. (F) Control and mutant oocytes expressing GFP::ASPM-1 and mCherry::H2B during meiosis I. (G) Percent of control and mutant oocytes that extrude a polar body during meiosis I, as determined by mCherry or GFP-fused histone signal remaining stably ejected from the oocyte cytoplasm for the duration of imaging (see Materials and methods).

Previous studies of CLS-2 requirements, using RNA interference (RNAi) or auxin-induced degradation (AID) of degron tagged CLS-2, have emphasized its central spindle function [26,29,40]. To more definitively assess its roles during oocyte meiotic cell division, we used CRISPR/Cas9 to generate putative null alleles. Each of the four alleles we isolated contains small insertions or deletions that result in frame shifts and premature stop codons before the first TOG domain, likely making them null (Fig 2B, S1 Fig). All are recessive, and homozygous mutant hermaphrodites exhibit fully penetrant embryonic lethality (Fig 2C). To investigate CLS-2 requirements, we have used the cls-2(or1948) allele, and hereafter we refer to oocytes from homozygous cls-2(or1948) hermaphrodites as cls-2 mutants.

We first used ex utero live cell imaging with transgenic strains that express GFP fused to a β-tubulin (GFP::TBB-2) and mCherry fused to a histone H2B (mCherry::H2B) to examine microtubule and chromosome dynamics during meiosis I in control and cls-2 mutant oocytes (Fig 2D; see Materials and methods). Control oocytes formed barrel shaped bipolar spindles that shortened and rotated to become perpendicular to the oocyte cortex prior to anaphase and polar body extrusion (n = 19). Consistent with previous reports [26,29,40], the meiosis I spindles in cls-2 mutants were disorganized and lacked any obvious bipolarity, with chromosomes moving into a small cluster before failing to segregate (n = 13). Furthermore, microtubule levels appeared to be reduced, and quantification of spindle microtubule intensity over time showed a substantial reduction in microtubule levels during meiosis I anaphase compared to control oocytes (Fig 2E). These results are consistent with the established roles of CLASP family members in promoting microtubule stability (see Introduction), and with a previous report that quantified reduced microtubule fluorescence intensity at metaphase in cls-2(RNAi) oocytes [40]. To assess when defects in meiosis I spindle assembly first appear in cls-2 oocytes, we used in utero live cell imaging and observed the early assembly of a normal cage-like microtubule structure that surrounded the oocyte chromosomes, followed by a rapid collapse of this microtubule structure to form an abnormally small cluster associated with the oocyte chromosomes (S1 Fig) (n = 5).

To further examine spindle assembly in cls-2 mutants, we imaged meiosis I in oocytes from transgenic strains expressing an endogenous fusion of GFP to the pole marker ASPM-1 and mCherry::H2B (Fig 2F). As described previously [45], multiple small GFP::ASPM-1 foci coalesced to form a bipolar spindle in control oocytes (n = 14). In cls-2 mutants, the GFP::ASPM-1 foci failed to coalesce to form two spindle poles but rather moved over time to form a single tight cluster of multiple small foci, and chromosomes again moved into a small cluster and failed to segregate (n = 11). We conclude that CLS-2 plays an important role in promoting microtubule stability during meiosis I and is required early for bipolar spindle assembly and chromosome segregation.

In addition to the extensive meiotic spindle defects, we also observed that cls-2 mutants frequently failed to extrude a polar body at the end of meiosis I, consistent with previous reports [26,29]. Control oocytes regularly extruded a polar body at the end of meiosis I, as scored using transgenic strains expressing either GFP::H2B or mCherry::H2B to determine whether oocyte chromosomes remained extruded for the duration of live imaging (93 of 94 control oocytes; Fig 2G; see Materials and methods). In contrast, meiosis I polar body extrusion failed in about 84% of the cls-2 mutant oocytes (80 of 95, Fig 2G).

CLS-2 and MEI-1, but not spindle bipolarity, are required for polar body extrusion

Because the relationship between spindle structure and polar body extrusion is unclear, we next took a comparative approach and also examined meiosis I polar body extrusion after using RNAi to knock down either kinesin-12/KLP-18 or katanin/MEI-1, with knockdown protocols that led to fully penetrant failures in oocyte chromosome segregation (see Materials and methods). As illustrated schematically in Fig 1B, klp-18 mutants assemble monopolar spindles while mei-1 spindles are apolar, and both fail to segregate chromosomes (see Introduction) [33]. We first simply assessed whether polar body extrusion was successful, again using live imaging with transgenic strains expressing either GFP::H2B or mCherry::H2B fusions to score extrusion (Fig 2G). In klp-18 mutants, chromosomes were successfully retained in a meiosis I polar body in 17 of 20 oocytes. In contrast, after MEI-1 knockdown, chromosomes were extruded and retained in a meiosis I polar body in only 5 of 27 oocytes. The absence of meiosis I polar body extrusion in mei-1 mutant oocytes was surprising because mei-1 mutants were originally described as typically having abnormally large polar bodies [41,42], but how often chromosome extrusion into a polar body succeeds or fails has not been reported. Our data indicate that meiosis I polar body extrusion usually fails and suggest that the abnormally large polar bodies observed in mei-1 mutants result from defects in meiosis II, consistent with previous work [16] (see Discussion).

Based on the frequent success of polar body extrusion in klp-18 mutants, we conclude that spindle bipolarity and chromosome segregation are not required for polar body extrusion. Thus, the failed extrusions in cls-2 and mei-1 mutants are not simply due to an absence of spindle bipolarity or a failure to segregate chromosomes.

Meiotic spindle-associated furrows are abnormal in cls-2 and mei-1 mutant oocytes

To better understand the polar body extrusion defects in oocytes lacking CLS-2 or MEI-1, we next examined the spindle-associated membrane furrows that mediate polar body extrusion in transgenic strains expressing mCherry fused to a plasma membrane marker (mCherry::PH) and GFP::H2B (Fig 3A and 3B, S2 Fig, S3 and S4 Movies). In 9 of 16 control oocytes, we observed early membrane furrows that ingressed until they pinched together to encapsulate and extrude chromosomes into the first polar body. In 6 of 16 control oocytes we observed early membrane furrows that were not as clearly resolved in our imaging data but eventually led to polar body extrusion, and in one oocyte furrows were not obvious but a polar body was nevertheless extruded.

Fig 3

Spindle-associated membrane furrowing during meiosis I in control and mutant oocytes.

Images show projections of five focal planes encompassing the chromosomes during meiosis I in oocytes expressing an mCherry fusion to a PH domain to mark the plasma membrane using sum projections and GFP::H2B using maximum projections. Representative examples of control (A, B), cls-2 mutant (C-E), klp-18(RNAi) (F, G) and mei-1(RNAi) (H, I) oocytes. Polar body extrusion failed in C-E and H, and was successful in all others. T = 0s corresponds to the timepoint immediately before cortical furrowing begins. See text for details.

In contrast, we observed extensive spindle-associated membrane furrowing defects in cls-2 mutants (Fig 3C–3E, S3 and S4 Figs, S5 and S6 Movies). In 7 of 19 oocytes we observed two furrows in cross-section that retracted before pinching together, one oocyte that formed two furrows that pinched together but failed late in polar body extrusion, and one oocyte that formed two furrows and successfully extruded a polar body (S3 Fig). One of 19 oocytes appeared to form three spindle-associated furrows in cross-section and extruded a polar body (S3 Fig). In 7 of 19 oocytes we observed only a single visible spindle-associated furrow in cross-section that ingressed either to one side of, or directly toward the oocyte chromosomes (Fig 3D, S4 Fig), suggesting that the contractile ring collapsed into a more linear ingressing structure rather than maintaining a ring-like shape. In some cases, when the single ingressing furrow moved directly toward the oocyte chromosomes, it appeared to push chromosomes apart (S4 Fig). Such late separations of chromosomes were observed only in association with ingressing furrows that appeared to be responsible for the chromosome movement. Finally, in one oocyte the membrane dynamics were indistinct, but chromosomes were extruded into a polar body (Fig 3E), and in one oocyte there was no obvious spindle-associated furrowing and polar body extrusion failed (S4 Fig).

In oocytes depleted of klp-18, we observed furrows that more nearly resembled those in control oocytes (Fig 3F and 3G, S5 Fig, S7 and S8 Movies). In 4 of 10 oocytes, we observed two furrows in cross-section that ingressed and then pinched together (Fig 3F), and only 1 of these 4 failed in polar body extrusion. In 6 of 10 oocytes, we observed shallow furrows adjacent to the oocyte chromosomes (Fig 3G), and only 1 of these 6 failed to extrude a polar body.

After MEI-1 knockdown, we observed furrows that initially resembled those in control oocytes but were more widely spaced and often failed late during constriction (Fig 3H–3J, S6 Fig, S9 and S10 Movies). In 2 of 11 oocytes, we observed two furrows in cross-section that ingressed and pinched together to extrude a polar body (Fig 3H). In 3 of 11 oocytes two furrows ingressed and pinched together but then regressed and released chromosomes back into the oocyte cytoplasm (Fig 3I). In 5 of 11 oocytes two furrows ingressed but retracted before pinching together and failed in polar body extrusion (Fig 3J), and finally in 1 of 11 oocytes we observed only a single spindle-associated furrow in cross-section that failed to extrude a polar body.

To summarize, in klp-18 mutant oocytes we observed spindle-associated furrows that usually encapsulated chromosomes and extruded polar bodies, although the oocyte chromosomes were often in close proximity to the membrane with furrows that were shallow and difficult to detect. In cls-2 and mei-1 mutants, meiosis I polar body extrusion frequently failed but we observed distinct defects. While membrane furrowing initially appeared relatively normal but eventually failed in most mei-1 mutant oocytes, cls-2 mutant furrows often appeared abnormal early during ingression and exhibited more severe defects as extrusion attempts progressed.

Polar body contractile ring dynamics are more severely defective in the absence of CLS-2 than in klp-18 or mei-1 mutant oocytes

We next examined assembly and ingression of the contractile ring during oocyte meiosis I, using live cell imaging with transgenic strains expressing both a GFP fusion to the non-muscle myosin II NMY-2 and mCherry::H2B. In 11 of 11 control oocytes, NMY-2::GFP foci initially assembled into discontinuous but discernible rings over the membrane proximal pole, after spindle rotation and before extensive chromosome segregation, and then became more continuous and prominent as they ingressed and constricted between the segregating chromosomes to extrude polar bodies (Fig 4A, S7 Fig, S11 and S12 Movies).

Fig 4

Contractile ring non-muscle myosin NMY-2 dynamics during meiosis I in control and mutant oocytes.

Three-dimensionally projected and rotated images of control (A), cls-2 mutant (B), klp-18(RNAi) (C), and mei-1(RNAi) (D) oocytes expressing NMY-2::GFP and mCherry::H2B. Z-stacks were rotated as to look down on contractile ring assembly and dynamics over time. t = 0 seconds (0s) corresponds to the end of meiosis I and beginning of meiosis II.

In cls-2 mutant oocytes, the assembly and stability of NMY-2::GFP contractile ring structures were severely defective (Fig 4B, S8 Fig, S13 and S14 Movies). In 7 of 11 oocytes, fragmented or partial contractile rings assembled and 6 of these oocytes failed to extrude a polar body, while 3 of 11 oocytes formed abnormal assemblies of NMY-2::GFP that were more linear and not ring-like, although 2 of these extruded a polar body. Finally, 1 of 11 oocytes formed a relatively normal looking contractile ring that extruded a polar body. The fragmented or partial contractile rings observed in cls-2 mutants often collapsed into single bright foci or bands during constriction.

Contractile ring assembly and dynamics appeared much more normal in klp-18 mutant oocytes (Fig 4C, S9 Fig, S15 and S16 Movies). In 10 of 10 oocytes after KLP-18 knockdown, NMY-2::GFP foci assembled into rings that ingressed and constricted with dynamics similar to those observed in control oocytes, and in 9 of the 10 oocytes chromosomes were stably extruded into polar bodies.

In MEI-1 knockdown oocytes, ring assembly and ingression were much more normal compared to cls-2 mutants, but we nevertheless observed a range of defects and eventual failures to extrude polar bodies (Fig 4D, S10 Fig, S17 and S18 Movies). In 11 of 13 oocytes, the NMY-2::GFP rings that initially formed appeared larger in diameter compared to control oocytes, and in 3 of these 11 oocytes the rings constricted and successfully extruded a polar body. In another 5 of these 11 oocytes, the rings constricted extensively but ultimately regressed and failed at polar body extrusion, while in 3 the rings ingressed and only constricted partially before regressing and failing to extrude polar bodies. Finally, in 2 of 13 oocytes, ring assembly and ingression were more defective and polar body extrusion failed.

To further characterize the polar body extrusion defects in cls-2 mutants, we also examined ring assembly dynamics in transgenic strains expressing mCherry::H2B and mNeonGreen fused to the anillin ANI-1 (mNG::ANI-1), which is dispensable for assembly of the actomyosin contractile ring but required for its conversion from a ring to a tube during constriction [46] (Fig 5A, S19 and S20 Movies). In 10 of 10 control oocytes, mNG::ANI-1 assembled into contractile rings that ingressed and constricted between segregating chromosomes to extrude a polar body, while in 10 of 10 cls-2 oocytes a fragmented contractile ring structure formed and failed to extrude a polar body. We also used two-color live imaging to examine NMY-2::mKate2 and mNG::ANI-1 simultaneously, and observed that these two contractile ring components were co-localized in both control and cls-2 mutant oocytes (Fig 5B, S21 and S22 Movies) (n = 11 control, n = 13 cls-2(or1948)). We conclude that CLS-2 is required for proper ring assembly and ingression dynamics of not only NMY-2 but also ANI-1.

Fig 5

Contractile ring anillin ANI-1 and non-muscle myosin NMY-2 dynamics during meiosis I in control and cls-2 mutant oocytes.

Three-dimensionally projected and rotated images of control and cls-2 mutant oocytes expressing mNeonGreen::ANI-1 and mCherry::H2B (A) or NMY-2::mKate2, mNeonGreen::ANI-1, and mCherry::H2B (B), with overlays shown in top row for each set. Z-stacks were rotated so as to look down on contractile ring assembly and dynamics over time. t = 0 seconds (0s) corresponds to the end of meiosis I and beginning of meiosis II.

CLS-2 negatively regulates membrane ingression throughout the oocyte cortex during meiosis I

Global contraction of the oocyte actomyosin cortex has been proposed to promote polar body extrusion by generating a hydrostatic cytoplasmic force that produces an out-pocketing of the actomyosin depleted membrane inside the meiotic contractile ring and pulls the membrane-tethered spindle partially into the extruded membrane pocket (see Introduction). To explore the relationship between spindle structure, global cortical contractility and polar body extrusion, we next examined membrane ingressions throughout the oocyte cortex during meiosis I in control and mutant oocytes, using transgenic strains expressing mCherry::PH and GFP::H2B fusions. To document these membrane ingressions, we used temporal overlays of a single central z-plane to portray simultaneously the membrane position at all time points throughout the period of global cortical furrowing. In control oocytes, we observed the spindle-associated furrows and a small number of additional furrows along the oocyte cortex (Fig 6A, S11 Fig) (n = 16).

Fig 6

Membrane ingressions throughout the oocyte cortex during meiosis I in control and mutant oocytes.

(A) Membrane temporal overlays for control, cls-2 mutant, klp-18(RNAi), and mei-1(RNAi) oocytes representing the membrane positions of a single focal plane during the period of meiosis I global cortical furrowing for a single oocyte of each genotype. Arrowheads indicate approximate location of the meiotic spindle and spindle-associated membrane. (B) Quantification of the number of global cortical furrows in control and mutant oocytes (see Materials and methods). t-Test results: Control vs cls-2(or1948) p = 0.0014 (**), cls-2(or1948) vs klp-18(RNAi) p = 3.14E-5 (***), cls-2(or1948) vs mei-1(RNAi) p = 0.054 (ns). (C and D) Control and cls-2 mutant oocytes expressing (C) NMY-2::GFP and mCherry::H2B or (D) mNeonGreen::ANI-1 and mCherry::H2B. t = 0 seconds (0s) corresponds to the end of meiosis I and beginning of meiosis II.

In contrast, cls-2 mutant oocytes exhibited more extensive cortical furrowing compared to control oocytes (n = 24), while oocytes depleted of either KLP-18 (n = 10) or MEI-1 (n = 14) more nearly resembled control oocytes (Fig 6A, S12 and S13 Figs, S3–S10 Movies). Quantification of global cortical furrowing showed that cls-2 oocytes had significantly more furrows compared to control and klp-18 oocytes (Fig 6B). We conclude that CLS-2 negatively regulates global cortical furrowing, and we suspect that the CLS-2::GFP patches detected throughout the oocyte cortex are responsible for this regulation (Fig 2A, S1 Fig, S1 and S2 Movies; see Discussion).

We next examined the dynamics of the cortical actomyosin cytoskeleton, which mediates the furrowing that occurs throughout the oocyte cortex during polar body extrusion. In control oocytes, NMY-2::GFP (n = 11) and mNG::ANI-1 (n = 10) localized to dynamic patches throughout the oocyte cortex during meiosis I contractile ring assembly and ingression, and then dissipated late in anaphase when global cortical furrowing ends (Fig 6C and 6D, S14 and S15 Figs, S23 and S24 Movies). To determine if the increased global cortical furrowing in cls-2 oocytes is caused by an increase in NMY-2 or ANI-1 patch size or duration, we examined the dynamics of NMY-2::GFP and mNG::ANI-1 and observed dynamics similar to those in control oocytes (Fig 6C and 6D, S16–S18 Figs, S25 and S26 Movies) and did not detect any difference in the area occupied by the cortical NMY-2::GFP or mNG::ANI-1 patches throughout the period of global cortical furrowing and polar body extrusion (S19 Fig). These data suggest that the excess global cortical furrowing observed in cls-2 oocytes is not due to altered NMY-2 or ANI-1 patch dynamics. In contrast, the increased global cortical furrowing observed after knocking down the casein kinase CSNK-1 was associated with altered NMY-2 and ANI-1 cortical patch dynamics and with extrusion of the entire meiosis I spindle into polar bodies [15] (see Discussion).

Loss of CLS-2 results in altered Aurora B/AIR-2 and MgcRacGAP/CYK-4 dynamics

Because (i) cls-2 mutant oocytes fail to assemble a central spindle or segregate chromosomes, (ii) CLS-2::GFP localizes to the central spindle, and (iii) the central spindle-associated proteins Aurora B/AIR-2 and the centralspindlin component MgcRacGAP/CYK-4 are required for polar body extrusion [6,14,26,47], we next considered whether the observed polar body extrusion defects in cls-2 oocytes might be due to altered localization of central spindle proteins to the disorganized spindle microtubules. To address this possibility, we used transgenic strains expressing GFP fusions to either AIR-2 or CYK-4 and examined their localization in control and cls-2 mutant oocytes during the final 360 seconds of meiosis I, when anaphase chromosome segregation, global cortical furrowing, and polar body extrusion occur.

As reported previously [14,26], AIR-2 in control oocytes (n = 12) initially localized to mid-bivalent ring structures before redistributing to the central spindle during anaphase (Fig 7A). In cls-2 mutants (n = 15), despite the lack of spindle organization, GFP::AIR-2 still localized to the mid-bivalent ring structures before redistributing throughout the dis-organized spindle as meiosis I progressed (Fig 7A). Moreover, quantification of the GFP::AIR-2 spindle to cytoplasm fluorescence ratio indicated that cls-2 mutants have increased levels of spindle-associated AIR-2 (Fig 7B).

Fig 7

cls-2 mutant oocytes have altered AIR-2 and CYK-4 dynamics during meiosis I.

(A) Control and cls-2 mutant oocytes expressing GFP::AIR-2 and mCherry::H2B. (B) GFP::AIR-2 spindle to cytoplasm fluorescence ratio over time for control (n = 12) and cls-2(or1948) (n = 12 @ -360s to -340s, n = 13 @ -330s to -310s, n = 14 @ -300s to -250s, and n = 15 @ -240s to 0s). (C) Control and cls-2 mutant oocytes expressing CYK-4::GFP and mCherry::H2B. (D) CYK-4::GFP spindle to cytoplasm fluorescence ratio over time for control (n = 12) and cls-2(or1948) (n = 9 @ -360s to -340s, n = 10 @ -330s to -200s, and n = 11 @ -190s to 0s). t = 0 seconds (0s) corresponds to the end of meiosis I and beginning of meiosis II.

The centralspindlin complex member CYK-4 localized to the central spindle during anaphase in control oocytes (Fig 7C; n = 12), as reported previously [6,48]. In cls-2 mutant oocytes, GFP::CYK-4 initially localized to the disorganized meiotic spindle, but the levels decreased rapidly over time compared to control oocytes (Fig 7C and 7D).

In summary, the central spindle proteins AIR-2 and CYK-4 show distinct alterations in their localization dynamics in cls-2 mutant oocytes during anaphase of meiosis I. While both are still detected in association with the disorganized mutant spindle, AIR-2 levels were increased and CYK-4 levels decreased relative to control oocytes, raising the possibility that these abnormal dynamics might be at least in part responsible for the contractile ring assembly and polar body extrusion defects in cls-2 mutant oocytes.

Discussion

Remarkably little is known about the relationship between spindle structure and contractile ring assembly and constriction during oocyte meiotic cell division. To gain insight into the cues that influence contractile ring dynamics during polar body extrusion, we have examined ring assembly and constriction in three different C. elegans spindle assembly-defective mutants. Our results indicate that the C. elegans CLASP family member CLS-2 is required not only for assembly of a bipolar meiosis I spindle and chromosome segregation, but also for oocyte meiosis I contractile ring assembly or stability. This requirement for CLS-2 is not due simply to a failure in assembling bipolar spindles or to a lack of chromosome segregation, because monopolar kinesin-12/klp-18 mutant spindles failed to segregate chromosomes but did assemble stable contractile rings that usually extruded chromosomes into a polar body. We have further shown that mei-1/katanin mutant oocytes, which assemble apolar and disorganized oocyte meiosis I spindles, assembled contractile rings that were abnormally large in diameter and usually failed to extrude polar bodies after some ingression, suggesting a later role for MEI-1. In addition, we observed increased cortical furrowing throughout the oocyte cortex during meiosis I in cls-2 mutant oocytes, but not in klp-18 or mei-1 mutants. In mutant oocytes lacking the casein kinase CSNK-1 [15], increased global cortical furrowing is associated with altered cortical actomyosin dynamics and often results in extrusion of the entire meiosis I spindle in C. elegans. However, the increased cortical contractility in cls-2 mutants was not associated with obvious alterations in non-muscle myosin dynamics and was usually associated with complete failures in polar body extrusion. We suggest that, in cls-2 mutant oocytes, altered cortical cytoskeleton dynamics decreases cortical stiffness and thereby disrupts contractile ring assembly and furrow ingression during polar body extrusion. An alternative and not mutually exclusive possibility is that altered relative levels of central spindle proteins disrupts spindle cues that promote ring assembly and ingression.

Using spindle assembly defective mutants to explore contractile ring dynamics during oocyte polar body extrusion

While the requirements for several factors that control oocyte meiotic spindle assembly in C. elegans have been described [1-3], the impact of the resulting spindle assembly defects on polar body extrusion has remained largely unexplored. Indeed, anecdotal observations have suggested that polar body extrusion can occur even in mutants with severe oocyte spindle assembly defects. For example, reducing the function of the microtubule severing complex katanin, comprised of MEI-1 and -2 in C. elegans, results in severely defective apolar spindles that have greatly reduced levels of microtubules and fail to organize or segregate chromosomes and yet often produce abnormally large polar bodies. Similarly, mutant oocytes lacking the kinesin-12 family member KLP-18 assemble monopolar spindles that fail to segregate chromosomes but often produce zygotes that completely lack an egg pronucleus, indicating that all of the oocyte chromosomes are sometimes extruded into polar bodies [33]. In mouse oocytes, DNA-coated beads have been shown to promote the assembly of a polar body-like cortical protrusion, which requires the small GTPase Ran that mediates chromatin signaling and, if allowed to assemble a bead-associated spindle structure, can lead to successful extrusion [17,18]. However, knockdown of the C. elegans Ran family member RAN-1 does not prevent chromosome segregation or polar body extrusion [19,20], suggesting that chromatin cues are not required for contractile ring assembly. Moreover, meiotic spindles that fail to translocate to the oocyte cortex induce the formation of membrane furrows that ingress deeply toward the spindle [6], and C. elegans mutant oocytes lacking central spindle proteins have been shown to produce abnormally large contractile rings that often fail to extrude chromosomes into a polar body [6], suggesting that the oocyte meiotic spindle does influence ring assembly and function.

To explore the relationship between oocyte meiotic spindle structure and membrane ingression during polar body extrusion, we compared polar body extrusion in three C. elegans mutants that are severely defective in oocyte spindle assembly. Because cls-2 mutant oocytes failed to assemble bipolar spindles or segregate chromosomes, we also examined polar body extrusion in klp-18/kinesin-12 mutant oocytes that assemble monopolar spindles and also fail to segregate chromosomes [33-35]. In contrast to cls-2 mutants, in which contractile ring assembly or stability and membrane ingression were severely defective, contractile ring assembly and ingression appeared much more normal in klp-18 mutant oocytes, and chromosomes were usually extruded into a polar body. These findings are consistent with work in cultured mammalian cells showing that cells with monopolar mitotic spindles can still undergo cytokinesis [49]. We conclude that the defects in cls-2 mutant oocytes are not due a failure to assemble a bipolar spindle or to segregate chromosomes, but rather reflect a more specific requirement for CLASP/CLS-2.

A specific requirement for CLS-2 is further supported by our analysis of oocyte meiotic contractile ring assembly and dynamics in katanin/mei-1 oocytes, which assemble spindles that lack any polarity and completely fail to organize the dispersed oocyte chromosomes throughout meiosis I [33,38,39]. Furthermore, similar to cls-2 oocytes, microtubule levels are substantially reduced in mei-1 mutant oocytes [50]. Nevertheless, stable contractile rings usually formed in mei-1 mutant oocytes, although the rings were larger in diameter compared to control oocytes, and we frequently observed extensive furrow ingressions that often enclosed the oocyte chromosomes but usually failed to complete constriction and regressed late in cytokinesis. In the absence of MEI-1, contractile rings can assemble and remain stable until late in meiosis I polar body extrusion, even when oocyte meiotic spindle assembly is at least as severely defective as in cls-2 mutant oocytes.

Contractile ring dynamics during meiosis I were more normal after mei-1 RNAi knockdown compared to cls-2 mutants, but the furrows nevertheless often regressed and polar body extrusion usually failed. Previous studies have shown that partial loss of function mutations in mei-1 result in abnormally large polar bodies that are produced after meiosis II, as a result of decreased microtubule severing that is required for complete disassembly of the meiosis II spindle [16,43]. Our results provide the first systematic examination of polar body extrusion during meiosis I after depletion of katanin/MEI-1, and it is possible that the late failures in polar body cytokinesis that we observed also reflect a requirement for microtubule severing. Alternatively, similar defects were observed in oocytes lacking the centralspindlin components CYK-4 and ZEN-4 [6,14,26,47], and it is possible that central spindle proteins are mis-regulated after MEI-1 knockdown. Further investigation of MEI-1 and its interactions with central spindle proteins should improve our understanding of this late requirement during polar body extrusion.

CLS-2 regulation of oocyte cortical stiffness and contractile ring dynamics

While our analysis indicates that CLS-2 is required early for the assembly or stability of the oocyte meiosis I contractile ring, we do not know if the defects reflect a direct or indirect requirement, or how CLS-2 functions at a molecular level to promote polar body extrusion. Nevertheless, our findings lead us to suggest that CLS-2 may influence polar body extrusion by positively regulating cortical stiffness throughout the oocyte cortex. Based on our observations that (i) the increased furrowing throughout the oocyte cortex is not associated with obvious change in cortical actomyosin dynamics, (ii) CLS-2 localizes to small patches distributed throughout the oocyte cortex, and (iii) CLASP orthologs in other organisms can promote cortical microtubule attachments, we suggest that the increased cortical furrowing in cls-2 mutant oocytes reflects a decrease in cortical stiffness, rather than an increase in cortical actomyosin contractility.

Consistent with our hypothesis that CLS-2 regulates cortical stiffness through regulation of the microtubule and possibly microfilament cytoskeleton, mutations in the Drosophila CLS-2 ortholog Orbit/Mast cause spermatocyte cell division defects associated with a loss of central spindle microtubules that normally promote contractile ring assembly [51,52]. Additionally, human CLASP proteins have been shown to associate with actin filaments and may cross-link microtubules and filamentous actin [25], and mammalian CLASPs have been proposed to link microtubule plus ends with the cell cortex [53,54]. Moreover, oocyte polar body extrusion has been described as a bleb-like process, with local weakening of the actomyosin cytoskeleton inside the contractile ring promoting an out-pocketing of the membrane to form a polar body [5,6]. Studies of bleb formation in other cellular contexts have shown that microtubule destabilization can result in bleb formation [55-57]. Finally, C. elegans CLS-2 has been previously shown to be required for a number of microtubule dependent cortical processes in oocytes, including cytoplasmic streaming and yolk granule packing [58,59]. While it is possible that CLS-2 may act through microtubules to influence cortical stiffness, we have not yet detected significant differences in the levels or organization of cortical microtubules in cls-2 oocytes. Higher spatial and temporal resolution imaging studies might detect subtle changes and prove informative.

Consistent with a role in regulating global oocyte cortical stiffness, we detected CLS-2::GFP in small patches, also referred to as linear elements [44] or rod-shaped structures [26], throughout the cortex in control oocytes. These patches were present early in meiosis I but dissipated before anaphase chromosome segregation, prior to initiation of the membrane ingressions that occur during anaphase in wild-type oocytes. The excessive global cortical furrowing in cls-2 mutants may result from the loss of these cortical patches. Because the patches are undetectable at the time of furrow ingression, we suggest that CLS-2 either acts prior to the initiation of global cortical furrowing or remains present at low and undetected levels to regulate membrane ingression as furrows ingress.

CLS-2 might promote oocyte contractile ring assembly and ingression more directly, through its regulation of microtubule stability during spindle assembly. Astral microtubules associated with this acentrosomal spindle are small and limited in number, but a recent study has proposed that they nevertheless can interact, through dynein, with cortical microtubules to engage pulling forces that move the spindle toward the cortex and rotate it from its initial parallel orientation relative to the oocyte cortex to a perpendicular orientation during polar body extrusion [60]. Astral microtubule interaction with the cortex might then also influence contractile ring assembly. Consistent with such a scenario, we observed CLS-2::GFP throughout the oocyte spindle at the time when contractile ring assembly begins. Higher resolution imaging of the spindle microtubules and their proximity to the cortex in cls-2 mutant oocytes might provide more insight.

Complex regulation of global cortical furrowing during polar body extrusion

Comparing the consequences of reducing the functions of the casein kinase CSNK-1 and of the CLASP family member CLS-2 indicates that the relationship between global cortical dynamics and polar body extrusion is complex. CSNK-1 also limits membrane ingressions throughout the oocyte cortex during meiosis I but appears to do so through negative regulation of actomyosin dynamics, and CSNK-1 knockdown often results in extrusion of the entire meiotic spindle and all of the oocyte chromosomes into the first polar body [15]. These observations support a model in which global cortical contraction generates a hydrostatic cytoplasmic force that promotes an out-pocketing of the plasma membrane that pulls the membrane-tethered spindle pole through the contractile ring and into the forming polar body [6]. While such a mechanism may operate, it also is clear from in utero imaging that the contractile ring and associated plasma membrane ingress substantially prior to constricting roughly midway along the axis of the spindle during polar body extrusion. These dynamics suggest that the spindle and the contractile ring interact to promote furrow ingression and constriction.

The different phenotypes of csnk-1 and cls-2 mutants indicate that negative regulation of global cortical membrane ingression during oocyte meiotic cell division may both promote and prevent the extrusion of chromosomes into polar bodies. These different outcomes presumably reflect differences in how CSNK-1 and CLS-2 influence the cortical cytoskeleton and its dynamics. CSNK-1 appears to regulate cortical actomyosin contractility, while CLS-2 might act through microtubules or microfilaments to promote cortical stiffness, with both influences being important for effective polar body extrusion.

Further investigation of cortical cytoskeleton dynamics, and the interactions of factors that regulate cortical structure and dynamics, should improve our understanding of the relationship between global cortical furrowing and oocyte meiotic contractile ring assembly. Multiple factors, including the kinesin-13 family member KLP-7, the TOG domain protein and XMAP215 ortholog ZYG-9, and Aurora A/AIR-1 have been shown to modulate cortical microtubule levels during oocyte meiotic cell division in C. elegans [20,48,61]. Investigation of how these different cytoskeletal regulators interact may further inform our understanding of polar body extrusion.

Central spindle protein dynamics and polar body extrusion

The abnormal dynamics of the central spindle proteins AIR-2 and CYK-4 in cls-2 mutant oocytes might also contribute to polar body extrusion defects. While extrusion has not been closely examined in oocytes depleted for AIR-2, the extrusion defects in oocytes lacking either CLS-2 or CYK-4 are very distinct. In cyk-4 mutant oocytes, membrane furrows and contractile rings are abnormally large in diameter but otherwise appear normal and ingress before failing to constrict relatively late in extrusion [6]. In cls-2 oocytes, we observed severely abnormal and unstable furrows throughout ingression, with highly defective contractile ring assembly or stability. Thus the cls-2 defects are probably not caused by loss of CYK-4 function, even though CYK-4 levels were substantially reduced during most of anaphase in cls-2 mutants. It seems more likely that either the increased AIR-2 levels, the altered CYK-4 dynamics at the meiotic spindle, or the altered relative levels of AIR-2 and CYK-4, might somehow disrupt contractile ring assembly. Further studies that manipulate AIR-2 or CYK-4 levels, and examine their dynamics in other spindle assembly-defective mutants, may improve our understanding of the relationship between central spindle proteins and oocyte contractile ring assembly.

Materials and methods

C. elegans strain maintenance

All C. elegans strains used in this study (S1 Table), were maintained at 20°C as described previously [62].

cls-2 CRISPR/Cas9 allele generation

Mutations in cls-2 were generated by injecting young adult N2 hermaphrodites with the following mixture [63]: 25μM cls-2 crRNA (ATCAGCCGATCGACTCCGGG), 5μM dpy-10 crRNA (GCTACCATAGGCACCAC GAG), 30μM trRNA, 2.1μg/μl Cas9-NLS, and 2.5μM dpy-10 single-strand DNA (ssDNA, CACTTGAACTTCAATACGGCAAGATGAGAATGACTGGAAACCGTACCGCATGCGGTGCCTATGGTAGCGGAGCTTCACATGGCTTCAGACCAACAGCCTAT). No homologous repair template was used for cls-2, and cls-2 DNA breaks were allowed to repair randomly. Before injection, the trRNA and crRNAs were mixed and incubated at 95°C for 5 minutes, before cooling at room temperature for 5 minutes. After cooling, Cas9-NLS (QB3-Berkeley MacroLab) was added to the annealed trRNA and crRNAs and allowed to incubate for another 5 minutes at room temperature before the dpy-10 ssDNA repair template was added. After injection, hermaphrodites were singled out and their broods were screened for dpy-10 roller or dumpy co-conversion worms, which were allowed to produce broods. Those broods were then evaluated for potential cls-2 phenotypes (embryonic lethality), and lines identified as potentially carrying mutations to cls-2 were balanced. PCR amplified fragments were Sanger sequenced to identify the CRISPR/Cas9-induced mutations.

Feeding RNAi Knockdown of mei-1 and klp-18

RNAi knockdown of mei-1 and klp-18 was achieved by plating hypochlorite synchronized L1 larvae onto E. coli (HT115) lawns induced to express dsRNA corresponding to mei-1 or klp-18 [64]. Plated worms were either maintained at 20°C until adults were imaged (mei-1), or maintained at 20°C and upshifted to 26°C 16 hours prior to imaging (klp-18) to ensure robust knockdown (as determined by the fully penetrant absence of chromosome segregation, indicative of the formation of monopolar meiotic spindles, during both meiosis I and II, after KLP-18 knockdown). The mei-1 RNAi vector was from the Ahringer RNAi library [65]. The klp-18 RNAi vector was made by amplifying a portion of the klp-18 coding sequence from isolated N2 genomic DNA (using primers 5’-ACCGGCAGATCTGATATCATCGATGAATTCTCCAACTTTCAA ATGCCACA-3’ and 5’-ACGGTATCGATAAGCTTGATATCGAATTCCTTCGATATGGAA GAA AGCGG-3’), which was inserted into the L4440 vector backbone using the NEBuilder HiFi DNA assembly cloning kit (NEB).

Live-cell imaging

All imaging was carried out using a Leica DMi8 microscope outfitted with a spinning disk confocal unit–CSU-W1 (Yokogawa) with Borealis (Andor), dual iXon Ultra 897 (Andor) cameras, and a 100x HCX PL APO 1.4–0.70NA oil objective lens (Leica). Metamorph (Molecular Devices) imaging software was used for controlling image acquisition. The 488nm and 561nm channels were imaged simultaneously every 10 seconds with 1μm Z-spacing (either 16μm or 21μm total Z-stacks depending on the fluorescent markers used, with the same stack size used for all movies utilizing the same fluorescent markers).

In utero live imaging of oocytes was accomplished by mounting adult worms with a single row or less of embryos in 1.5μl of M9 mixed with 1.5μl of 0.1μm polystyrene Microspheres (Polysciences Inc.) on a 6% agarose pad with a coverslip gently laid over top. Ex utero imaging of oocytes was carried out by cutting open adult worms with a single row or less of embryos in 4μl of egg buffer (118mM NaCl, 48mM KCl, 2mM CaCl2, 2mM MgCl2, and 0.025 mM of HEPES, filter sterilized before HEPES addition) on a coverslip before mounting onto a 2% agarose pad on a microscope slide.

Image analysis, quantification, and statistical analysis

General image analysis and quantification of microtubules and global cortical furrowing was carried out using FIJI software [66]. Three-dimensional projection and rotation of movies used to look at polar body contractile rings was carried out using Imaris software (Bitplane). Meiosis I polar body extrusion success was evaluated based on whether oocytes extruded any chromosomes marked by GFP or mCherry histone 2B (H2B) into a polar body that remained extruded for the period of imaging, either until meiosis I had obviously ended and meiosis II spindle assembly began, or until pronuclei began to decondense in the one-cell stage embryo after meiosis II. We did not assess polar body extrusion during meiosis II. The end of meiosis I and beginning of meiosis II was considered to be the time at which the chromosomes left in the oocyte cytoplasm began to visibly separate from each other. Projections for spindle-associated furrow examination were made by manually isolating the 5 most spindle-associated z-planes for each time point during the period of global cortical furrowing and then sum projecting the mCherry::PH membrane signal. Membrane temporal overlays were created by overlaying the outlined membrane regions of interest for the period of furrowing (detailed below) to create a single image.

Total spindle microtubule pixel intensity was determined using the following formula: (Mean Grey Value (spindle)/Mean Grey Value (cytoplasm)) × spindle area = total spindle microtubule pixel intensity. The mean grey values for both the meiotic spindle and cytoplasm were determined by drawing a region of interest around either the meiotic spindle or a portion of oocyte cytoplasm devoid of adjacent sperm in maximum projected Z-stacks and measuring the mean grey value of the selected region in ImageJ. Spindle area was determined by measuring the area of the region of interest encompassing the meiotic spindle, or the oocyte chromosomes if the spindle could not be clearly identified (cls-2 mutants).

AIR-2 and CYK-4 fluorescence was quantified similar to above, with the spindle to cytoplasm fluorescence ratio calculated for each time point with the following calculation: (Mean Grey Value (spindle/chromosome associated fluorescence)/Mean Grey Value (bulk cytoplasm)).

The area of cortex covered by NMY-2::GFP or mNG::ANI-1 patches over time was quantified for a subset of movies with low amounts of outside signal from nearby gonad or other embryos, as that signal interferes with image thresholding. Movies were maximum projected in FIJI, and regions of interest were drawn around each timepoint for each oocyte for the 360 seconds prior to the end of meiosis I and beginning of meiosis II (see above). A threshold was applied to each movie using either the Otsu (NMY-2::GFP) or Li (mNG::ANI-1) threshold method with dark background and stack histogram settings. Area of the NMY-2 or ANI-1 thresholded patches was then measured for the drawn regions of interest by limiting the measurements to the threshold pixels and calculating the area fraction.

Quantification of global cortical furrowing was accomplished by drawing regions of interest over the oocyte membrane signal (mCherry::PH) for a single central z-slice for the entire period of global cortical furrowing. Regions of interest were then converted to a high contrast stack of membrane positions over time, which were then analyzed using the ADAPT plugin [67] for ImageJ in order to determine curvature values across the oocyte membrane. A furrow was defined as being at least two consecutive membrane points with negative mean curvature values and a standard deviation of mean curvature at least two standard deviations above the average standard deviation of mean curvature value for the entire oocyte membrane. Membrane points fitting the criteria of a furrow (above) that were separated by a single membrane point not fitting the criteria were considered as part of the same furrow for the purposes of counting. For statistical analysis of global cortical furrowing (Fig 6B), one-way ANOVA was used to determine if there was any difference in the mean furrowing between genotypes, F-Tests to compare the variances, and two-tailed Student’s t-Tests between genotypes to compare the means directly (assuming either equal or unequal variances depending on the F-Test results). All statistical analysis and graphs were completed using Excel (Microsoft).

CLS-2 localizes to meiotic spindles and is required for their assembly.

(A) In utero time-lapse spinning disk confocal images of CLS-2::GFP and mCherry::H2B. (B) Protein domain maps of wild type CLS-2 and CRISPR-generated cls-2 alleles or1949, or1950, and or1951. Each mutation results in multiple early stop codons before the first TOG domain, with the first stop codon indicated. (C) In utero time-lapse spinning disk confocal images of control and cls-2 mutant oocytes with GFP::TBB-2 and mCherry::H2B. t = 0 seconds corresponds to nuclear envelope breakdown.

(PDF)

Click here for additional data file.

Control oocyte spindle-associated membrane furrows.

Time-lapse spinning disk confocal images of control oocytes expressing mCherry::PH and GFP::H2B; t = 0 seconds here and in subsequent Fig 4 related supplements (S3–S6 Figs) corresponds to the time point immediately before global cortical furrowing begins, unless otherwise stated.

(PDF)

Click here for additional data file.

cls-2(or1948) oocyte spindle-associated membrane furrows.

Time-lapse spinning disk confocal images of cls-2 mutant oocytes expressing mCherry::PH and GFP::H2B.

(PDF)

Click here for additional data file.

Time-lapse spinning disk confocal images of cls-2 mutant oocytes expressing mCherry::PH and GFP::H2B. Note that in a small number of cls-2(-) oocytes, we sometimes observe some separation of chromosomes. When examined in conjunction with the mCherry::PH membrane marker, such late separation of chromosomes was always associated with ingression of an oocyte meiotic cleavage furrow that appeared to push chromosomes apart (see rows 4 and 6).

(PDF)

Click here for additional data file.

klp-18(RNAi) oocyte spindle-associated membrane furrows.

Time-lapse spinning disk confocal images of klp-18(RNAi) oocytes expressing mCherry::PH and GFP::H2B.

(PDF)

Click here for additional data file.

mei-1(RNAi) oocyte spindle-associated membrane furrows.

Time-lapse spinning disk confocal images of mei-1(RNAi) oocytes expressing mCherry::PH and GFP::H2B.

(PDF)

Click here for additional data file.

Control oocyte NMY-2::GFP contractile rings.

Three-dimensionally projected and rotated spinning disk confocal time-lapse images of control oocytes expressing NMY-2::GFP and mCherry::H2B; t = 0 seconds in this and subsequent Fig 5 related supplements (S8–S10 Figs) corresponds to the end of meiosis I and beginning of meiosis II (see Materials and methods).

(PDF)

Click here for additional data file.

cls-2(or1948) oocyte NMY-2::GFP contractile rings.

Three-dimensionally projected and rotated spinning disk confocal time-lapse images of cls-2 mutant oocytes expressing NMY-2::GFP and mCherry::H2B.

(PDF)

Click here for additional data file.

klp-18(RNAi) oocyte NMY-2::GFP contractile rings.

Three-dimensionally projected and rotated spinning disk confocal time-lapse images of klp-18(RNAi) oocytes expressing NMY-2::GFP and mCherry::H2B.

(PDF)

Click here for additional data file.

mei-1(RNAi) oocyte NMY-2::GFP contractile rings.

Three-dimensionally projected and rotated spinning disk confocal time-lapse images of mei-1(RNAi) oocytes expressing NMY-2::GFP and mCherry::H2B.

(PDF)

Click here for additional data file.

Control oocyte membrane temporal overlays.

Control oocyte membrane temporal overlays depicting membrane positions over time at a single focal plane throughout meiosis I. Arrowheads indicate approximate location of the meiotic spindle and spindle-associated membrane.

(PDF)

Click here for additional data file.

cls-2(or1948) oocyte membrane temporal overlays.

cls-2 mutant oocyte membrane temporal overlays depicting membrane positions over time at a single focal plane throughout meiosis I. Asterisks indicate oocytes in which polar body extrusion failed. Arrowheads indicate approximate location of the meiotic spindle and spindle-associated membrane.

(PDF)

Click here for additional data file.

klp-18(RNAi) and mei-1(RNAi) membrane temporal overlays.

klp-18(RNAi) and mei-1(RNAi) oocyte membrane temporal overlays depicting membrane positions over time at a single focal plane throughout meiosis I. Asterisks indicate oocytes in which polar body extrusion failed. Arrowheads indicate approximate location of the meiotic spindle and spindle-associated membrane.

(PDF)

Click here for additional data file.

Control oocyte NMY-2::GFP cortical dynamics.

Time-lapse spinning disk confocal images of control oocytes expressing NMY-2::GFP and mCherry:H2B; t = 0 seconds corresponds to the end of meiosis I and beginning of meiosis II in this and subsequent Fig 7 related supplements (S15–S18 Figs).

(PDF)

Click here for additional data file.

Control oocyte mNG::ANI-1 cortical dynamics.

Time-lapse spinning disk confocal images of control oocytes expressing mNeonGreen::ANI-1 and mCherry::H2B.

(PDF)

Click here for additional data file.

cls-2(or1948) oocyte NMY-2::GFP cortical dynamics.

Time-lapse spinning disk confocal images of cls-2 mutant oocytes expressing NMY-2::GFP and mCherry::H2B. All oocytes shown succeeded in polar body extrusion.

(PDF)

Click here for additional data file.

Time-lapse spinning disk confocal images of cls-2 mutant oocytes expressing NMY-2::GFP and mCherry::H2B. All oocytes shown failed in polar body extrusion.

(PDF)

Click here for additional data file.

cls-2(or1948) oocyte mNG::ANI-1 cortical dynamics.

Time-lapse spinning disk confocal images of cls-2 mutant oocytes expressing mNeonGreen::ANI-1 and mCherry::H2B; t = 0s corresponds to the end of meiosis I and beginning of meiosis II. All oocytes shown failed in polar body extrusion.

(PDF)

Click here for additional data file.

NMY-2 and ANI-1 cortical dynamics.

Graphs showing the average percent of the oocyte cortex covered by NMY-2::GFP or mNG::ANI-1 in control or cls-2(or1948) oocytes. Error bars show the standard deviation, and t = 0s corresponds to the end of meiosis I and beginning of meiosis II.

(PDF)

Click here for additional data file.

Ex utero CLS-2::GFP localization.

Ex utero time-lapse spinning disk confocal movie of a maximum projected oocyte expressing CLS-2::GFP (green) and mCherry::H2B (magenta). Frame rate is 10 frames per second.

(AVI)

Click here for additional data file.

In utero CLS-2::GFP localization.

In utero time-lapse spinning disk confocal movie of a maximum projected oocyte expressing CLS-2::GFP (green) and mCherry::H2B (magenta). Frame rate is 10 frames per second.

(AVI)

Click here for additional data file.

Control oocyte membrane furrowing.

Ex utero time-lapse spinning disk confocal movie of a control oocyte expressing mCherry::PH (black) and GFP::H2B (magenta). In this and subsequent oocyte membrane furrowing videos, the 5 focal planes that encompassed most of the meiotic chromosomes were used; membrane images were sum projected, histones images were maximum projected. In this and all subsequent Fig 4 related movies (S4–S10 Movies), the frame rate is 5 frames per second.

(AVI)

Click here for additional data file.

Ex utero time-lapse spinning disk confocal movie of a control oocyte expressing mCherry::PH (black) and GFP::H2B (magenta).

(AVI)

Click here for additional data file.

cls-2(or1948) oocyte membrane furrowing.

Ex utero time-lapse spinning disk confocal movie of a cls-2(or1948) oocyte expressing mCherry::PH (black) and GFP::H2B (magenta).

(AVI)

Click here for additional data file.

Ex utero time-lapse spinning disk confocal movie of a cls-2(or1948) oocyte expressing mCherry::PH (black) and GFP::H2B (magenta).

(AVI)

Click here for additional data file.

klp-18(RNAi) oocyte membrane furrowing.

Ex utero time-lapse spinning disk confocal movie of a klp-18(RNAi) oocyte expressing mCherry::PH (black) and GFP::H2B (magenta).

(AVI)

Click here for additional data file.

Ex utero time-lapse spinning disk confocal movie of a klp-18(RNAi) oocyte expressing mCherry::PH (black) and GFP::H2B (magenta).

(AVI)

Click here for additional data file.

mei-1(RNAi) oocyte membrane furrowing.

Ex utero time-lapse spinning disk confocal movie of a mei-1(RNAi) oocyte expressing mCherry::PH (black) and GFP::H2B (magenta).

(AVI)

Click here for additional data file.

Ex utero time-lapse spinning disk confocal movie of a mei-1(RNAi) oocyte expressing mCherry::PH (black) and GFP::H2B (magenta).

(AVI)

Click here for additional data file.

Control oocyte NMY-2::GFP contractile ring dynamics.

Ex utero 3-dimensionally projected and rotated time-lapse spinning disk confocal movie of control oocyte expressing NMY-2::GFP (green) and mCherry:H2B (magenta). In this and all subsequent Fig 5 related movies (S12–S18 Movies), the frame rate is 5 frames per second.

(AVI)

Click here for additional data file.

Ex utero 3-dimensionally projected and rotated time-lapse spinning disk confocal movie of control oocyte expressing NMY-2::GFP (green) and mCherry:H2B (magenta).

(AVI)

Click here for additional data file.

cls-2(or1948) oocyte NMY-2::GFP contractile ring dynamics.

Ex utero 3-dimensionally projected and rotated time-lapse spinning disk confocal movie of cls-2(or1948) oocyte expressing NMY-2::GFP (green) and mCherry:H2B (magenta).

(AVI)

Click here for additional data file.

Ex utero 3-dimensionally projected and rotated time-lapse spinning disk confocal movie of cls-2(or1948) oocyte expressing NMY-2::GFP (green) and mCherry:H2B (magenta).

(AVI)

Click here for additional data file.

klp-18(RNAi) oocyte NMY-2::GFP contractile ring dynamics.

Ex utero 3-dimensionally projected and rotated time-lapse spinning disk confocal movie of klp-18(RNAi) oocyte expressing NMY-2::GFP (green) and mCherry:H2B (magenta).

(AVI)

Click here for additional data file.

Ex utero 3-dimensionally projected and rotated time-lapse spinning disk confocal movie of klp-18(RNAi) oocyte expressing NMY-2::GFP (green) and mCherry:H2B (magenta).

(AVI)

Click here for additional data file.

mei-1(RNAi) oocyte NMY-2::GFP contractile ring dynamics.

Ex utero 3-dimensionally projected and rotated time-lapse spinning disk confocal movie of mei-1(RNAi) oocyte expressing NMY-2::GFP (green) and mCherry:H2B (magenta).

(AVI)

Click here for additional data file.

Ex utero 3-dimensionally projected and rotated time-lapse spinning disk confocal movie of mei-1(RNAi) oocyte expressing NMY-2::GFP (green) and mCherry:H2B (magenta).

(AVI)

Click here for additional data file.

Control oocyte mNG::ANI-1 contractile ring dynamics.

Ex utero 3-dimensionally projected and rotated time-lapse spinning disk confocal movie of control oocyte expressing mNG::ANI-1 (green) and mCherry:H2B (magenta). In this and all subsequent Fig 6 related movies (S20–S22 Movies), the frame rate is 5 frames per second.

(AVI)

Click here for additional data file.

cls-2(or1948) oocyte mNG::ANI-1 contractile ring dynamics.

Ex utero 3-dimensionally projected and rotated time-lapse spinning disk confocal movie of cls-2(or1948) oocyte expressing mNG::ANI-1 (green) and mCherry:H2B (magenta).

(AVI)

Click here for additional data file.

Control oocyte NMY-2::mKate2 and mNG::ANI-1 contractile ring dynamics.

Ex utero 3-dimensionally projected and rotated time-lapse spinning disk confocal movie of control oocyte expressing NMY-2::mKate2 (magenta), mNG::ANI-1 (green), and mCherry:H2B (magenta).

(AVI)

Click here for additional data file.

cls-2(or1948) oocyte NMY-2::mKate2 and mNG::ANI-1 contractile ring dynamics.

Ex utero 3-dimensionally projected and rotated time-lapse spinning disk confocal movie of cls-2(or1948) oocyte expressing NMY-2::mKate2 (magenta), mNG::ANI-1 (green), and mCherry:H2B (magenta).

(AVI)

Click here for additional data file.

Three example time-lapse spinning disk confocal movies of ex utero control oocytes expressing NMY-2::GFP (green) and mCherry::H2B (magenta). In this and all subsequent Fig 7 related movies (S24–S26 Movies), the frame rate is 5 frames per second.

(AVI)

Click here for additional data file.

Three example time-lapse spinning disk confocal movies of ex utero cls-2(or1948) oocytes expressing NMY-2::GFP (green) and mCherry::H2B (magenta).

(AVI)

Click here for additional data file.

Three example time-lapse spinning disk confocal movies of ex utero control oocytes expressing mNG::ANI-1 (green) and mCherry::H2B (magenta).

(AVI)

Click here for additional data file.

Three example time-lapse spinning disk confocal movies of ex utero cls-2(or1948) oocytes expressing mNG::ANI-1 (green) and mCherry::H2B (magenta).

(AVI)

Click here for additional data file.

Table of C. elegans strains used in this study

(PDF)

Click here for additional data file.

2 Jun 2020

* Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. *

Dear Dr Bowerman,

Thank you very much for submitting your Research Article entitled 'C. elegans CLASP/CLS-2 negatively regulates membrane ingression throughout the oocyte cortex and is required for polar body extrusion' to PLOS Genetics. We apologize for the delay as your manuscript was fully evaluated at the editorial level and by independent peer reviewers. The reviewers appreciated the attention to an important topic but identified some aspects of the manuscript that should be improved.

We therefore ask you to modify the manuscript according to the review recommendations before we can consider your manuscript for acceptance. Your revisions should address the specific points made by each reviewer. In particular: 1) make sure to include quantification (i.e. numbers, sizes....) for all the data presented in your manuscript; 2) there are several points raised by the reviewers that require further clarifications in the text, expansion of the discussion to clearly state the advancements achieved by the current study, and inclusion of proper citations; and 3) include labeling of supplementary figures.

In addition we ask that you:

1) Provide a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.

2) Upload a Striking Image with a corresponding caption to accompany your manuscript if one is available (either a new image or an existing one from within your manuscript). If this image is judged to be suitable, it may be featured on our website. Images should ideally be high resolution, eye-catching, single panel square images. For examples, please browse our archive. If your image is from someone other than yourself, please ensure that the artist has read and agreed to the terms and conditions of the Creative Commons Attribution License. Note: we cannot publish copyrighted images.

We hope to receive your revised manuscript within the next 30 days. If you anticipate any delay in its return, we would ask you to let us know the expected resubmission date by email to plosgenetics@plos.org.

If present, accompanying reviewer attachments should be included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist.

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission.

PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process.

To resubmit, you will need to go to the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.

[LINK]

Please let us know if you have any questions while making these revisions.

Yours sincerely,

Mónica P. Colaiácovo

Associate Editor

PLOS Genetics

Gregory P. Copenhaver

Editor-in-Chief

PLOS Genetics

Reviewer's Responses to Questions

Comments to the Authors:

Please note here if the review is uploaded as an attachment.

Reviewer #1: In the present manuscript, Schlientz & Bowerman investigate the relationship between spindle assembly and polar body extrusion in C. elegans oocytes. Using novel alleles of the CLASP orthologue CLS-2, the authors show that CLS-2 and katanin (MEI-1) play different roles during polar body extrusion. I particularly liked the idea that late meiosis I events might not be completely linked to early ones. As the authors rightly point out, this is a hard topic to tackle because of early phenotypes obscuring the interpretation of the late ones. However, with a good combination of an accurate description of the results together with the combination of in utero and ex utero experiments, the authors provide very interesting insight into the different roles of key proteins during meiosis, specially CLS-2. Importantly, the experiments are performed using live oocytes, allowing for a proper dynamic assessment of spindle assembly, segregation, and polar body extrusion.

I was very impressed by the level of detail and transparency with which the phenotypes are described and the work the authors took to include all these in the supplementary material.

Overall, I think this work, together with the other recent preprint from the lab, provides very interesting insights into the dynamics of spindle assembly and polar body extrusion in C. elegans oocytes. I would therefore favour publication in PLOS Genetics after some revisions, listed below.

1) In Figure 2E, why does the tubulin quantif. only go back to -340 secs while the images shown go back to -840 sec?

2) Figure 3 needs some quantification. Specially in the case of CYK-4, the wild type and mutant look very different and the text only makes a general remark about this.

3) Specifically, in figure 3A it appears that CLS-2 depletion leads to a phenotype in which there seems to be some degree of chromosome segregation, but then polar body fails. While I am not sure how reproducible this phenomenon is, it would make a good case for stating that polar body extrusion can’t happen even when anaphase is not completely affected.

4) In general, the use of this new cls-2 allele is a nice addition that will also prove useful for other studies. As such, it would be good to have a comparison with RNAi and/or auxin-inducible degradation, because the allele used could have the downside of chronic CLS-2 depletion (i.e. early meiosis defects?).

5) One slightly confusing issue is how ‘time = 0’ is defined in the cls-2 mutant. While I acknowledge this will never be an easy task (we routinely have the same issue), the reader would benefit from some clarification to know that the time scales in some experiments are only good for internal reference of each movie and not to be used for comparison between movies.

6) We felt that the data on AIR-2 and CYK-4 really needs some quantitation. Specially in the case of CYK-4, the wild type and mutant look very different and the text only makes a general observation from this.

7) Is the klp-18(RNAi) phenotype 100% penetrant (i.e. are all spindles monopolar)? If so, then disregard. If it isn’t, it would make sense to explicit that the 17/20 cases with PB extrusion come from monopolar spindles and it is not a consequence of partial depletion.

8) ‘Based on the frequent success of polar body extrusion in klp-18 mutants, we conclude that spindle bipolarity and chromosome segregation are not required for polar body extrusion.’ This could be a bit of a stretch, since there is a form of segregation-like chromosome movement that could, in theory, provide with whatever mechanism is necessary for PB extrusion. Here again, as mentioned in 1), If you get to see a phenotype with attempt segregation followed by failed PB extrusion, that would be very useful, as it would prove your case.

9) For the NMY-2 and ANI-1 movies (which I have to admit I am no expert), it would be helpful to have a measure of chromosome segregation (as a reference only) together with time reference.

10) How do the other steps look in the cls-2 mutants that do extrude a PB? Spindle assembly, chromosome alignment, segregation, etc…? This relates to question 3). Could the authors compare spindle assembly defects in the 15/95 cls-2 mutants movies that do form a polar body vs the 80/95 that don’t, using a Fisher test maybe?

Reviewer #2: This manuscript is meant to address the mechanism of polar body formation during C. elegans meiosis. This is a significant problem because polar body formation is conserved in most animal species and because polar body failure results in polyploidy and death. Specifically this manuscript provides high quality phenotypic analysis of polar body formation by time-lapse imaging in a new CRISPR knockout of the microtubule-binding protein CLS-2 and in RNAi depletions of two other microtubule regulators, KLP-18 and MEI-1. Although the results are of high quality, most of the results have either been published previously [polar body failure in cls-2(RNAi) complemented with various RNAi-resistant point mutations (Laband 2017)] or are negative [no change in centralspindlin or acto-myosin in the cls-2 knockout]. In addition, there is no mechanistic hypothesis stated and there is no clear mechanistic conclusion drawn from the results. The use of “we explore” in the final sentence of the abstract suggests that no specific question was asked and that no definitive conclusion was reached in the paper. These issues could potentially be addressed by extensive rewriting of the manuscript. This would require stating a specific question or hypothesis and explaining how the results answer this question and how previously published results could not answer this question.

Detailed comments below are meant to help clarify the significance of the work to someone reading the manuscript.

Line 65: “During anaphase the contractile ring ingresses past both the membrane-proximal pole…” The only reference for this statement is Fig. 1 which is a cartoon with no reference to data in the legend. This statement is also made before the text has narrowed down to C. elegans as a species. In many organisms without an eggshell, the spindle pushes out through the contractile ring. In C. elegans in hyperosmotic conditions where the plasma membrane is pulled away from the eggshell, the spindle also pushes out (Dorn et al., 2011). In utero, the plasma membrane starts pressed against the eggshell and the contractile ring ingresses inward (Fabritius et al., 2011) as stated here. This statement needs to be clarified for both accuracy and proper citation.

Line 150: The nature of the CLS-2::GFP should be stated (CRISPRd?, complementing RNAi?) either here or referenced to someplace that it is stated.

Line 154, Fig. 2A: It is stated that metaphase-specific patches of CLS-2::GFP on the entire cortex might suggest that CLS-2 acts on the entire cortex. If this suggestion is going to be stated, it should be clarified whether the patches correspond to linear elements, myosin patches or perhaps clusters of cortical microtubules. If it is not possible to figure this out because of COVID-19, then removing the suggestion that this localization is indicative of global cortical activity might be appropriate.

Line 160: There should be a citation at the end of the first sentence.

Line 166: “fully penetrant maternal-effect embryonic lethality” would be clearer.

Line 194: What is new with the microtubule and chromosome phenotype? The results with the newly generated null allele appear to confirm the previously published RNAi phenotypes which were complemented with RNAi-resistant transgenes in Laband 2017. The new results are thus a second control showing that the phenotypes are not due to off target RNAi effects. The only thing these results show are that Dumont 2010 and Laband 2017 were likely looking at complete rather than partial RNAi depletion. I actually think it is important to reproduce the RNAi work of others using a CRISPR knockout but this needs to be clearly explained to the reader.

Line 201: What is new about the polar body phenotype? It seems like less of an advance than the Laband 2017 results which included polar body phenotypes with point mutations in specific TOG domains.

The description of the assay for polar body extrusion failure is in the Methods and makes it unclear whether there is a defect in extrusion of the second polar body. If this information can be gleaned from existing data, this would at least be a slight advancement over previously reported polar body failure phenotypes. Line 240 speculates that mei-1 mutants might have a meiosis II polar body defect which suggests that the time-lapse imaging in this study did not go through completion of meiosis II. This manuscript thus does not resolve the previously published large polar body phenotype with the current no polar body phenotype for mei-1. A standard in this field would be to report polar body number and size in mitotic embryos. This would be especially important for klp-18(RNAi) which is reported to succeed in polar body formation. An-1 knockdown polar bodies do not reveal their failure until very late. This manuscript also uses RNAi by feeding for mei-1 whereas previous studies have used allelic series of mei-1.

The AIR-2 and myosin dynamics results are all negative. Some negative results would be fine if a positive result was reported that yielded some clue as to why cls-2 knockouts do not make polar bodies.

Line 244: The conclusion that spindle bipolarity and chromosome segregation are not required for polar body extrusion because 15/20 klp-18(RNAi) embryos successfully extruded a polar body (Fig. 2G) could be a significant result but is only weakly supported. The successful polar body extrusion could be due to partial RNAi. Filming with transgenes (GFP::ASPM-1) that convincingly showed a lack of spindle bipolarity during late anaphase would be required to address this issue. Mullen and Wignall (2017) presented evidence that klp-15/16-depleted embryos have no bipolarity at metaphase but assemble a midzone during anaphase. Filming GFP:SPD-1 in klp-18(RNAi) might resolve whether this is happening during klp-18(RNAi) polar body formation. I am not suggesting that the authors do experiments during quarantine. I am just pointing out the brevity of the results supporting this conclusion in the manuscript. The novelty/lack of novelty of monopolar spindle polar body formation could be cited more extensively to Canman et al. (2003) and others have shown that monopolar spindles can induce mitotic cleavage furrows but there is no discussion of this.

Regarding the conclusion that CLS-2 directly suppresses global cortical furrowing. CLS-2 depletion reduces microtubule density in the spindle (this study) and CLS-2 depletion blocks microtubule-dependent cytoplasmic streaming (Yang et al., 2003) and microtubule-dependent yolk granule packing (McNally et al., 2010) throughout the embryo. There should be a clearer discussion of the possibility that reduced density of cortical microtubules causes the global increase in furrowing. Microtubule-dependent suppression of cortical furrowing has been reported many times including tubulin(RNAi) in C. elegans meiosis (Fabritius et al., 2011) and during mitosis and could be more clearly discussed. This is an area that could be developed into a hypothesis that is stated at the beginning of the paper.

Reviewer #3: Schlientz and Bowerman addressed the relationship between meiotic spindle assembly and polar body extrusion. They characterized three spindle assembly mutants, cls-2, klp-18, and mei-1. Mutants of CLS-2 fail to form bipolar spindles, had low levels of microtubules, and failed to segregate DNA. Previous work showed that mutants of KLP-18 form monopolar spindles and fail to segregate chromosomes. Mutants of MEI-1 form apolar spindles and fail to segregate chromosomes. Mutants of CLS-2 mostly do not extrude polar bodies. Live imaging shows that there are defects in ingression and they have abnormal assembly of the NMY2:::GFP contractile rings. The mei-1 mutants mostly do not form polar bodies, but the defect is later than in cls-2 mutants. The oocytes initially ingress but fail later. Many of the contractile rings assemble and initiate constriction but then fail. The klp-18 mutants mostly do form polar bodies, suggesting that bipolar spindle formation and chromosome segregation is not required for polar body formation. In the absence of CLS-2, there were more global cortical furrows, suggesting that CLS-2 negatively regulates furrowing.

This manuscript is mainly descriptive, and at times this can be a bit frustrating. For example, there are many defects in the cls-2 mutants and it is difficult to discern whether the later defects in contractile ring assembly are due to earlier defects in ingression. Or, even in understanding how these regulators of spindle assembly affect these processes and why the phenotypes are so variable.

But, overall the live cell analysis of the steps of polar body formation provide a nice and important understanding of how/when the processes fail in the different mutants. And, this study provides a foundation for future more mechanistic studies. The major findings of this study include: i) spindle bipolarity and chromosome segregation are not required for polar body contractile ring formation and chromosome extrusion; ii) CLS-2 is required for early contractile ring assembly; iii) MEI-1 is needed for full contractile ring constriction; and, iv) CLS-2 negatively regulates membrane ingression.

Overall, I have only minor suggestions for improvements to the manuscript:

1) The authors propose that CLS-2 prevent membrane ingressions at the oocyte cortex. Do the CLS-2::GFP patches co-localize with actin filaments?

2) Can the authors provide the data (in graph form) showing the dynamics of NMY-2::GFP and mNG::ANI-1 in control and mutant oocytes?

3) It seems interesting that the mutants can MEI-1 mutants can initiate polar body formation and then regress back to no polar body formation. Can the authors further speculate on the regulation of how this occurs?

4) For clarity, it would greatly help the reader if the figures were labeled with the mutants that are being described so that the reader does not need to refer back to the figure legends. This has been done in the main figures, but not in most of the supplementary figures (Figures S3- S12, S14-18).

5) In Figures 7A and S12-S13, it would be helpful to point out where the spindle was localized.

6) Correct typo on line 533.

**********

Have all data underlying the figures and results presented in the manuscript been provided?

Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Federico Pelisch

Reviewer #2: No

Reviewer #3: No

29 Jul 2020

Submitted filename: PLOSGenetics_reviews_w-responses_V2.docx

Click here for additional data file.

10 Aug 2020

Dear Dr Bowerman,

We are pleased to inform you that your manuscript entitled "C. elegans CLASP/CLS-2 negatively regulates membrane ingression throughout the oocyte cortex and is required for polar body extrusion" has been editorially accepted for publication in PLOS Genetics. Congratulations!

Before your submission can be formally accepted and sent to production you will need to complete our formatting changes, which you will receive in a follow up email. Please be aware that it may take several days for you to receive this email; during this time no action is required by you. Please note: the accept date on your published article will reflect the date of this provisional accept, but your manuscript will not be scheduled for publication until the required changes have been made.

Once your paper is formally accepted, an uncorrected proof of your manuscript will be published online ahead of the final version, unless you’ve already opted out via the online submission form. If, for any reason, you do not want an earlier version of your manuscript published online or are unsure if you have already indicated as such, please let the journal staff know immediately at plosgenetics@plos.org.

In the meantime, please log into Editorial Manager at https://www.editorialmanager.com/pgenetics/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production and billing process. Note that PLOS requires an ORCID iD for all corresponding authors. Therefore, please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field.  This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager.

If you have a press-related query, or would like to know about one way to make your underlying data available (as you will be aware, this is required for publication), please see the end of this email. If your institution or institutions have a press office, please notify them about your upcoming article at this point, to enable them to help maximise its impact. Inform journal staff as soon as possible if you are preparing a press release for your article and need a publication date.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Genetics!

Yours sincerely,

Mónica P. Colaiácovo

Associate Editor

PLOS Genetics

Gregory P. Copenhaver

Editor-in-Chief

PLOS Genetics

www.plosgenetics.org

Twitter: @PLOSGenetics

----------------------------------------------------

Comments from the reviewers (if applicable):

----------------------------------------------------

Data Deposition

If you have submitted a Research Article or Front Matter that has associated data that are not suitable for deposition in a subject-specific public repository (such as GenBank or ArrayExpress), one way to make that data available is to deposit it in the Dryad Digital Repository. As you may recall, we ask all authors to agree to make data available; this is one way to achieve that. A full list of recommended repositories can be found on our website.

The following link will take you to the Dryad record for your article, so you won't have to re‐enter its bibliographic information, and can upload your files directly:

http://datadryad.org/submit?journalID=pgenetics&manu=PGENETICS-D-20-00475R1

More information about depositing data in Dryad is available at http://www.datadryad.org/depositing. If you experience any difficulties in submitting your data, please contact help@datadryad.org for support.

Additionally, please be aware that our data availability policy requires that all numerical data underlying display items are included with the submission, and you will need to provide this before we can formally accept your manuscript, if not already present.

----------------------------------------------------

Press Queries

If you or your institution will be preparing press materials for this manuscript, or if you need to know your paper's publication date for media purposes, please inform the journal staff as soon as possible so that your submission can be scheduled accordingly. Your manuscript will remain under a strict press embargo until the publication date and time. This means an early version of your manuscript will not be published ahead of your final version. PLOS Genetics may also choose to issue a press release for your article. If there's anything the journal should know or you'd like more information, please get in touch via plosgenetics@plos.org.

28 Sep 2020

PGENETICS-D-20-00475R1

C. elegans CLASP/CLS-2 negatively regulates membrane ingression throughout the oocyte cortex and is required for polar body extrusion

Dear Dr Bowerman,

We are pleased to inform you that your manuscript entitled "C. elegans CLASP/CLS-2 negatively regulates membrane ingression throughout the oocyte cortex and is required for polar body extrusion" has been formally accepted for publication in PLOS Genetics! Your manuscript is now with our production department and you will be notified of the publication date in due course.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript.

Soon after your final files are uploaded, unless you have opted out or your manuscript is a front-matter piece, the early version of your manuscript will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting PLOS Genetics and open-access publishing. We are looking forward to publishing your work!

With kind regards,

Jason Norris

PLOS Genetics

On behalf of:

The PLOS Genetics Team

Carlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdom

plosgenetics@plos.org | +44 (0) 1223-442823

plosgenetics.org | Twitter: @PLOSGenetics