Proinflammatory cytokines and ARDS pulmonary edema fluid induce CD40 on human mesenchymal stromal cells-A potential mechanism for immune modulation.

Human mesenchymal stem/stromal cells (hMSCs) are a promising therapy for acute respiratory distress syndrome (ARDS) and other inflammatory conditions. While considerable research has focused on paracrine effects and mitochondrial transfer that improve lung fluid balance, hMSCs are well known to have immunomodulatory properties as well. Some of these immunomodulatory properties have been related to previously reported paracrine effectors such as indoleamine-2,3-dioxygenase (IDO), but these effects cannot fully account for cell-contact dependent immunomodulation. Here, we report that CD40 is upregulated on hMSCs under the same conditions previously reported to induce IDO. Further, CD40 transcription is also upregulated on hMSCs by ARDS pulmonary edema fluid but not by hydrostatic pulmonary edema fluid. Transcription of CD40, as well as paracrine effectors TSG6 and PTGS2 remained significantly upregulated for at least 12 hours after withdrawal of cytokine stimulation. Finally, induction of this immune phenotype altered the transdifferentiation of hMSCs, one of their hallmark properties. CD40 may play an important role in the immunomodulatory effects of hMSCs in ARDS and inflammation.

Introduction

Human mesenchymal stem/stromal cells (hMSCs) have emerged as a promising therapy for myriad inflammatory conditions including graft versus host disease, systemic lupus erythematosus, multiple sclerosis, sepsis, and acute respiratory distress syndrome (ARDS) [1, 2]. Our research group has focused on the potential role of hMSCs for treatment of the ARDS [3].

ARDS represents a state of immune activation in which inflammatory insults such as sepsis, transfusions and major trauma lead to increased activation of the innate immune system—particularly macrophages and neutrophils. Alveolar macrophage activation leads to secretion of inflammatory cytokines, including interleukin-1β (IL-1β), tumor necrosis factor (TNF), interleukin-6 (IL-6), and interleukin-8 (IL-8), which lead to additional neutrophil activation {Chollet-Martin, 1996 #139; Strieter, 1993 #134}. This combined activation of neutrophils and macrophages mediates some of the tissue injury in ARDS [4, 5]. While aberrations in innate immunity have been well described, the humoral immune system is also dysregulated. Activation of CD4+ T cells has also been reported in a murine model of lipopolysaccharide (LPS)-induced ARDS [6]; T regulatory (Treg) cells are also involved in resolution of acute lung injury in mice and humans [7].

hMSCs have many beneficial immunomodulatory effects. Through soluble mediators such as indoleamine-2,3-dioxygenase (IDO) [8] and prostaglandin E2 (PGE2) [9], hMSCs promote the M1 to M2 transition of activated macrophages. hMSCs also promote T cell suppression through the IL-1β mediated secretion of transforming growth factor-β (TGF-β) [10]. Despite the well-characterized paracrine effects, cell-cell contact is also required for induction of Treg cells [11] and some aspects of macrophage modulation [10].

Previously, our laboratory has demonstrated that a mixture of inflammatory cytokines, termed CytoMix (50 ng/mL TNF-α, interferon (IFN)-γ, and IL-1β) recapitulated the effects of ARDS pulmonary edema fluid on type II alveolar cells, including loss of tight junctions and impaired fluid clearance [12]. Re-analysis of prior microarray data revealed that CytoMix also induced hMSCs transcription of CD40 [13]. Here, we report the conditions under which CD40 is transcribed and importantly also report that CD40 upregulation develops after exposure of hMSCs to human ARDS pulmonary edema fluid.

Materials and methods

Mesenchymal stem/stromal cells

hMSCs were obtained from Dr. D.J. Prockop at the Institute for Regenerative Medicine in Texas A&M Health Science Center (IRM), Dr. Shibani Pati at the Blood Systems Research Institute (BSRI), and Dr. David McKenna at the University of Minnesota (UM). Cell lines were validated using qPCR for the presence of CD73, CD90, and CD105 expression, as well as the absence of CD11b, CD14, CD34, CD45, CD19, CD79A, CD54, and HLADRB expression (S1 Fig). Cells were cultured as previously described [14].

hMSC treatment with cytokines or LPS

For these experiments, hMSCs were plated at 1.6 x 105 cells/cm2 on 60mm untreated tissue culture plates in DMEM-F12 supplemented with antibiotics. TNF-α, IL-1β, and IFN-γ were obtained from R&D Systems. As previously described, CytoMix consisted of 50 ng/mL TNF-α, IFN-γ, and IL-1β [12]. For cytokine array experiments, TNF-α, IFN-γ, and IL-1β were used at 50 ng/mL in various combinations. LPS concentrations ranged from 5 pg/mL– 1 mg/mL (List Labs or Sigma). In all cases, the hMSCs were exposed to the experimental condition for 24 hours prior to harvesting, unless otherwise noted.

Human pulmonary edema fluid

Human pulmonary edema fluid was previously collected by our laboratory immediately after endotracheal intubation of patients with ARDS secondary to sepsis or hydrostatic pulmonary edema, with Institutional Review Board approval at the University of California, San Francisco [15]. Samples were frozen at -80°C until use in these studies. Undiluted pulmonary edema fluid from four donors with either ARDS or hydrostatic edema fluid was thawed, pooled, and centrifuged at 10,000 rpm for 2 minutes to remove cellular debris. The gender of all hMSC lines was determined by XIST levels; two male and two female lines were utilized to avoid gender confounding. hMSCs were plated at 1.5 x 104 cells/cm2 for 12 hours, washed with PBS and incubated with undiluted pulmonary edema fluid for 24 hours. RNA was isolated as described below.

Real Time PCR (RT-PCR) analysis

Total RNA from hMSCs was extracted using Qiagen® QiaShredder and either RNeasy mini or RNAeasy plus mini kits according to the manufacturer’s methods. RNA was quantified using a ND-1000 (ThermoFisher) and 260/280 absorbance; 1 μg RNA was converted to cDNA using the cDNA iScript synthesis kit (Biorad). RT-PCR was performed in technical triplicate on each biologic replicate using the Agilent platform, StepOnePlus System (Applied Biosystems) and Fast Sybr® Green Mastermix (Applied Biosystems); primers are shown in Table 1. Run cycle: PCR was activated at 95°C for 20 seconds followed by 40 cycles of 3 seconds at 95°C followed by 20 seconds at 60°C. All RT-PCR analyses for CytoMix and cytokine array were carried out on at least 5 biologic replicates; only four biologic replicates were conducted for the human pulmonary edema fluid samples due to limited reagents. Lipopolysaccharide (LPS) experiments were only conducted in biologic triplicate due to futility. ΔCT values were normalized to housekeepers TBP and EIF2E2.

Table 1

RT-PCR primers.

Target		Primer	#BP
CD73	F	GCCGCTTTAGAGAATGCAAC	116
	R	TTTCATCCGTGTGTCTCAGG
CD90	F	GGACTGAGATCCCAGAACCA	95
	R	TTAGGCTGGTCACCTTCTGC
CD105	F	GCACATCCTGAGGGTCCTG	102
	R	ATGAGGACGGCATCGAGA
CD11b	F	TCTACCAGTGCGACTACAGCA	75
	R	ACATGTTCACGGCCTCCAC
CD14	F	AAGCACTTCCAGAGCCTGTC	82
	R	CAGCAGCAACAAGCAGGAC
CD34	F	CACCCTGTGTCTCAACATGG	115
	R	GGACAGAAGAGTTTGTGTTTCCA
CD45	F	AGGAAATTGTTCCTCGTCTGA	76
	R	GAAGTCAGCCGTGTCCCTAA
CD19	F	TGGTCCTGAGGAGGAAAAGA	103
	R	ACGTTCCCGTACTGGTTCTG
CD79A	F	GGGGATCATCCTCCTGTTCT	79
	R	GAGCTTCTCGTTCTGCCATC
CD54	F	TGCTATTCAAACTGCCCTGA	80
	R	AGTTCCACCCGTTCTGGAGT
HLA-DRB1	F	TCTGCATTTCAGCTCAGGAA	79
	R	GCCAACATAGCTGTGGACAA
HLA-DRA1	F	GTTGGGCTCTCTCAGTTCCA	121
	R	TTGGCTTTCCTGCTGAGTCT
HLA-DPA1	F	CCCTGTTGGTCTATGCGTCT	96
	R	CCCTGTGGAGGTGAAGACAT
HLA-DQA1	F	CAGAGGGACCGTAAAACTGG	79
	R	TCTGCATTTCAGCTCAGGAA
CD68	F	TTCCCCTATGGACACCTCAG	86
	R	TTGTACTCCACCGCCATGTA
CD40	F	GTGTCCTGCACCGCTCAT	78
	R	GCTCGCAGATGGTATCAGAA
CD83	F	GGTGGTGAAGAGAGGATGGA	81
	R	AGAACCATTTTGCCCCTTCT
CD80	F	TTGTTCTGAAGTATGAAAAAGACG	84
	R	GGTGTAGGGAAGTCAGCTTTG
CD86	F	GCCCAGAATTCTAAGCTGGT	76
	R	CCACCCAGACTGAGGAGGTA
TSG6	F	GCTAGAGGCAGCCAGAAAAA	86
	R	GCTTCACAATGGGGTATCCA
PTGS2	F	CTAGAGCCCTTCCTCCTGTG	78
	R	TTGAATCAGGAAGCTGCTTTT
IL1RA	F	TTGCAAGGACCAAATGTCAA	79
	R	GGATTCCCAAGAACAGAGCA

hMSC differentiation

hMSC differentiation studies were conducted using the R&D Systems human mesenchymal stem cell functional identification kit according to the manufacturer’s directions using fatty acid binding protein 4 (FABP4), osteocalcin, and aggrecan as markers of adipocyte, osteoblast, and chondrocyte differentiation, respectively. Adipogenesis was further evaluated using oil red O staining [16]. Images were transmitted to a pathologist in blinded manner. Positive and negative cells were quantified in Image J; a minimum of 99 cells were counted per cohort.

Flow cytometry

Four-color flow cytometry was performed on a FACS-Calibur II instrument. KG-1 cells differentiated to dendritic cells with PMA and ionomycin [17] were used as positive controls for HLA-DR (ThermoFischer, MEM-12 clone) and CD40 (Novusbio, 5C3 clone). Two representative cell lines were harvested by incubation with Accutase (Gibco) for five minutes. Analyses were conducted with FlowJo version 10. Cells were gated on hMSCs by forward and side scatter. The CD40 positive gate was determined a priori on the unstained sample and then applied to the stained control and CytoMix-exposed cells.

Statistical analysis

Statistical analyses for all RT-PCR experiments were conducted in GraphPad Prism (V8.2.1). For all direct comparisons between experimental groups using cytokine mixtures (n = 6), Mann-Whitney U tests were utilized. Pulmonary edema fluid experiments (n = 4) were analyzed using unpaired two-tailed t test due to limited pulmonary edema fluid sample and reduced power. If multiple comparisons were performed, a Kruskal-Wallis ANOVA (KW) was performed first to determine if a difference was present across all groups and, if significant, Mann-Whitney U-tests were performed to determine which groups were statistically different. For flow cytometry, the geometric mean and standard deviation of positive populations and MFI are reported (FlowJo V10). Statistical comparisons between flow cytometry population frequencies were made using an unpaired t test (GraphPad Prism V8.2.1). Fisher’s exact tests were utilized to compare positive cell frequency for quantifications (https://www.graphpad.com/quickcalcs/contingency2/). P values < 0.05 were considered statistically significant. S1 Appendix includes raw data and additional statistical analyses in accordance to the minimal data set definition.

Results

CytoMix induces transcription of CD40, CD83, and HLA-DR in hMSCs

Prior microarray results indicated that the hMSCs differentiated into a dendritic cell-like phenotype with CD40, CD83, CD68, and MHC class II expression when exposed to CytoMix, but these studies were done with a single biologic replicate [13, 18]. To confirm these findings at a transcriptional level, hMSC were exposed to CytoMix. RT-PCR revealed markedly increased transcription of CD40, CD83, and HLA-DR (Fig 1). Additional studies of co-stimulatory molecules CD80, CD86, CD40L, and CD163 revealed no increased transcription. The transcription of CD40, CD83, and HLA-DR were not induced by any concentration of LPS (S2 Fig). Thus, the induction of these immune markers appeared to be due to stimulation with specific cytokine(s) rather than activation in general.

Fig 1

Quantitative RT-PCR results.

(A) Transcription of highlighted genes for hMSCs with and without CytoMix exposure. Cytokine arrays to elucidate the cytokine milieu required for transcription of (B) CD40 (KW p<0.001), (C) CD83 (KW p<0.001), (D) HLA-DRB (KW p = 0.003), (E) TSG-6 (KW p<0.001), and (F) PTGS2 (KW p<0.001) are also shown. mRNA expression levels were normalized to housekeeper genes EIF2E2 and TBPData shown as mean ± SEM, and *p < 0.05, †p < 0.01 compared to control using Mann-Whitney U-test.

CD40 transcription requires the same cytokine stimulation as IDO upregulation

Ren et al. previously reported that hMSCs exposed to IFN-γ plus TNF-α or IL-1β express IDO, and these conditions were associated with both paracrine and contact-mediated effects on T cells [19]. Thus, we carried out a cytokine array to determine the requisite cytokine exposure for induction of CD40, CD83 and MHC-class II transcription. hMSCs were exposed for 24 hours to a single cytokine (either TNF-α, IL1-β, or IFN-γ) or combinations of these three cytokines (Fig 1). Like IDO, CD40 was also strongly induced by IFN-γ plus one additional cytokine, although a small increase in transcription was noted for other conditions. CD83 was strongly induced by TNF-α + IFN-γ, but the increase induced by IL-1β + IFN-γ was not significant (p = 0.056). As expected, based on prior reports [20], transcription of HLA-DR was induced by IFN-γ alone. Paracrine effector molecule TSG-6 was expressed under similar conditions as IDO and CD40; PTGS2 was upregulated under all conditions except TNF-α monostimulation.

CD40 is expressed on the cell surface after CytoMix exposure

While the changes in mRNA expression for these immune markers are substantial, RNA transcription does not necessarily correspond to increased protein levels and transport to the cell surface. Flow cytometry demonstrated CD40 cell surface expression in a significant subset of cells (Fig 2A and 2B). While the MFI shift was not statistically significant, there was a trend towards increased MFI in the CytoMix exposed samples. (Fig 2C) In contrast, no surface expression of CD83 nor properly assembled HLA-DR with the MEM-12 anti-HLA-DR clone was demonstrated despite significant gene transcription. HLA-DR upregulation by transcriptional analysis has been observed in prior reports but was not previously correlated with analysis of surface expression [21].

Fig 2

Flow cytometry demonstrates cell surface expression of CD40 before (A) and after (B) exposure to CytoMix.

The CD40+ population increased from 3.2 ± 1.9% to 52.7 ± 7.4%, (p = 0.02). A representative histogram shows an increase in MFI from 2.3 ± 14.8 to 26.5 ± 118 after CytoMix stimulation is shown in panel C. Data reported as geometric mean ± SD, p values were determined using unpaired t tests.

CD40, TSG-6, and PTGS2 transcription is induced by ARDS pulmonary edema fluid

While CD40 could be reliably transcribed and expressed in an in vitro system of ARDS, using stimulation with a mix of inflammatory cytokines, we sought to determine if more in vivo-like conditions might be similar. hMSCs were exposed to undiluted pulmonary edema fluid from patients with either ARDS or hydrostatic pulmonary edema (e.g. heart failure). Exposure to either pulmonary edema fluid failed to induce CD83 or HLA-DRB transcription. CD40 transcription was not altered by exposure to hydrostatic pulmonary edema fluid; however, exposure to ARDS pulmonary edema fluid resulted in a 5-fold increase of CD40 mRNA levels in hMSCs (p-value 0.04). Confirmatory flow cytometry to examine CD40 protein expression could not be performed due to the small quantity of pulmonary edema fluid available. The paracrine molecules were similarly investigated. PTGS2 had increased transcription for both hydrostatic and ARDS pulmonary edema fluid (~20-fold and 1000-fold increase, p values 0.002 and 0.02, respectively), but TSG-6 transcription was induced solely by ARDS pulmonary edema fluid (6-fold increase, p value 0.02).

Induction of the immunologic phenotype affects pluripotency

Pluripotency is a key feature of mesenchymal stromal cells, and hMSCs are capable of differentiating into osteoblasts, adipocytes, or chondrocytes, and transdifferentiation is possible by changing the culture conditions [22]. Given the robust transcriptional changes induced by CytoMix, we questioned if CytoMix exposure would also alter hMSC pluripotency. Three representative cell lines were differentiated into chondrocytes, adipose tissue, and osteoblasts with or without a 24 hour pre-treatment with CytoMix using standard conditions. Successful differentiation was assessed by immunofluorescence for FABP4 (adipogenesis), osteocalcin (osteogenesis), and aggrecan (chondrogenesis). While the percent of aggrecan positive chondrocytes (7.1% v. 8.0%) and osteocalcin positive osteoblasts (87.0% v.83.8%) were unchanged after CytoMix exposure, CytoMix reduced FABP4 positivity from 35.4% to 5.5%, which indicates inhibition of adipogenesis. This finding was confirmed with oil red O staining by light microscopy, which also demonstrated a reduction in oil red O positive cells after CytoMix exposure (70.9% v. 16.7%) (Fig 3). Thus, preconditioning with CytoMix appears to result in reduction of pluripotency, albeit in an in vitro setting.

Fig 3

Pleuripotency of hMSCs before and after CytoMix exposure.

hMSCs were treated with 24 h DMEM-F12 medium or DMEM-F12 medium + CytoMix prior to exposure to standard differentiation conditions. 24 hour pre-treatment with CytoMix prevented adipogenesis as demonstrated by the lack of FABP4 staining by immunofluorescence (35.4% v. 5.5% positivity) and oil red O staining by light microscopy (70.9% v. 16.7% positivity). Differentiation of osteoblasts (87.0% v. 83.8%) or chondrocytes (7.1% v.8.0%) was unaffected.

Discussion

The main findings of our studies can be summarized as follows. The pro-inflammatory mixture CytoMix induces CD40 cell surface expression on hMSCs under the same conditions required for IDO expression, which is associated with a potent immunomodulatory phenotype with both paracrine and cell contact-mediated effects. Pulmonary edema fluid from ARDS patients, but not from hydrostatic edema fluid, also led to upregulation of CD40 gene expression. Furthermore, CytoMix upregulated the expression of several anti-inflammatory cytokines and paracrine effectors, which was also demonstrated with ARDS pulmonary edema fluid. Finally, CytoMix exposure decreased in vitro pleuripotency of hMSCs and inhibited hMSCs differentiation into adipocytes.

Previous studies of hMSCs have documented that they do not express standard immune markers such as MHC-class II, CD40, CD80/86, and others [23], although there is one mention of CD40 upregulation observed in hMSCs after IFN-γ exposure [24]. In our studies, small quantities of CD40 transcription were detected with IFN-γ alone, but CD40 transcription increased markedly when IFN-γ was combined with IL-1β or TNF-α. Ren et al. reported that hMSCs exposed to IFN-γ plus either IL-1β or TNF-α develop a potent immunomodulatory phenotype that partially relies on close cell-cell proximity [19]. While that study attributed the immunomodulation to IDO, we postulate that the expression of CD40 may contribute to this immunomodulatory phenotype.

CD40 is a key molecule in the immune system, and CD40+ hMSCs likely have a multimodal approach to modulating the inflammatory response of ARDS. Given the impressive pre-clinical data using hMSC treatment for ARDS [25, 26] and early clinical studies in systemic lupus erythematosus [27], it is clear that hMSC treatments can have significant immunomodulatory effects. Prior literature lends credence to the possibility of T cell modulation by CD40+ hMSCs. Interestingly, CD40L+/CD14+ peripherally circulating monocytes and CD40L+ T cells [28] have been reported in active systemic lupus erythematosus. While the majority of research efforts have focused on CD40 co-stimulation of B cells, CD40-CD40L binding also causes signaling in the CD40L expressing cell [29]. CD40L is important in the negative selection of auto-reactive thymocytes [30]. In CD4+ T cells, CD40-CD40L binding leads to increased level of IL-10 and IFN-γ [31]; in the presence of IFN-γ, CD40L binding can also lead to the generation of nitric oxide [32]. Additionally, low levels of CD40 expression on dendritic cells leads to marked expansion of Treg cells in a murine model of Leishmania donovani infection [33], and hMSCs promote the development of Treg cells in vitro [34]. Thus, CD40+ hMSCs may simultaneously decrease proliferation of activated T cells while promoting the expression of Treg cells.

Beyond direct CD40 mediated modulation of the T cell repertoire, hMSCs expressing CD40 could serve as a decoy receptor for soluble CD40L, which been implicated in patients with ARDS. Soluble CD40L has been implicated in the development of transfusion associated acute lung injury [35], sickle cell-related acute chest syndrome [36], and sepsis [37]. Once hMSCs lodge within the pulmonary microcirculation following intravenous administration, local reductions of CD40L could ameliorate endothelial dysfunction and possibly reduce inflammatory pulmonary edema.

A significant challenge in understanding hMSC biology is their significant pluripotency and differential responses to various conditions. In this study, the transcriptional response of hMSCs to clinically relevant stimuli (CytoMix or pulmonary edema fluid) was variable. Even for ARDS, a well characterized condition, our group has reported sub-phenotypes characterized by varying levels of inflammatory cytokines, which correlate with clinical course and mortality [38]. Thus, the in vivo behavior of hMSCs in individual patients may be variable and could represent a challenge in clinical trials.

One strength of this study is the robust and reproducible response of the hMSCs from multiple sources to the CytoMix stimuli to produce this potentially immunomodulatory phenotype. There was significant concern that this phenotype, although reproducible in technical replicates in a microarray, might not be reproducible among multiple human donors or might be a result of ex vivo expansion and manipulation of the hMSCs. For this reason, six human donors were used for the cytokine-exposed transcriptional studies from three independent sources; the gender ratio was four females to two males. Given the robust nature of this phenotype under specific conditions and the potential variability between patients and human disease states, preconditioning with CytoMix to induce an immunomodulatory phenotype may be useful to ensure a uniform hMSC functional phenotype in clinical trials, but determining the importance of this effect will require dditional in vivo experiemnts.

A limitation of our study is that we do not have direct evidence that CD40 is upregulated on hMSCs in patients treated with hMSCs for ARDS. One potential future avenue of research is to retrieve hMSCs from the bronchoalveolar lavage of patients with the ARDS, which is planned for subset of patients of an ongoing randomized clinical trial of hMSCs for ARDS (NCT03818854). We believe, however, that the upregulation of gene transcription of CD40 upon exposure to pulmonary edema fluid provides strong circumstantial evidence that CD40 may be relevant in ARDS patients receiving hMSCs. Future studies will need to more directly examine how hMSC CD40 expression contributes to the suppression of T cell and macrophage hyperinflammatory states.

Conclusions

A combination of inflammatory cytokines in the clinically relevant condition ARDS leads to upregulation of CD40 gene transcription and cell surface expression on bone marrow-derived mesenchymal stem/stromal cells. Expression of CD40 provides hMSCs with a new pathway to interact with other immune cells. CD40 expression is induced under the same cytokine conditions as IDO, which has previously been shown to be a potent immunomodulatory phenotype of hMSCs.

hMSC validation by quantitative RT-PCR.

(A) All hMSC cell lines expressed CD73, CD90, and CD105 and (B) did not express high levels of CD11, CD14, CD34, CD45, CD19, CD79A, CD54, CD40, or HLA-DRB. mRNA expression levels were normalized to housekeeper genes EIF2E2 and TBP.

(TIF)

Click here for additional data file.

CD40, CD83, and HLA-DR expression is not induced by LPS.

Quantitative RT-PCR failed to reveal any increased transcription of CD40, CD83, or HLA-DR after 24 hours of exposure to varying concentrations of LPS. mRNA expression levels were normalized to housekeeper genes EIF2E2 and TBP.

(TIF)

Click here for additional data file.

Underlying data and descriptive statistics for all figures and experiments in accordance with PlosONE data transparency standards.

(DOCX)

Click here for additional data file.

28 Jun 2020

PONE-D-20-17990

Proinflammatory cytokines and ARDS pulmonary edema fluid induce CD40 on human mesenchymal stromal cells – a mechanism for immune modulation

PLOS ONE

Dear Drs. Wilfong and Matthay,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please provide quantification of Fig 2 and Fig 3. Complete the the statistical analysis section and clarify some of the comments raised by reviewer 1. You don't have to provide new data.

Please submit your revised manuscript by Sept. 26, 2020. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

You-Yang Zhao

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.

Additional Editor Comments (if provided):

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: This observational paper describes some interesting phenotypes in hMSCs under inflammatory conditions, including the upregulation of CD40 by inflammatory cytokines or ARDS edema fluid. Given the potential for hMSC treatment in ARDS patients, these important findings could lead to further investigations of the regulation of hMSC function and efficacy in ARDS. However, given that the current data does not comprehensively describe any novel mechanistic regulation of hMSC function by each of the different inflammatory stimuli, the authors could include some further studies/explanations to further enhance the insight provided by their work.

MAJOR

1. Which cell markers were used to define the hMSCs? Given that the cells were obtained from 3 different locations/sources, how did the authors ensure that the cells were consistent?

2. Regarding the different cytokine combinations, text in the introduction states that secretion of IL1b, TNFa, IL6, and IL8 is increased. Later in the introduction, the cytomix of TNFa, IFNy, and IL1b is mentioned. In the methods, the cytomix is described and another stimulus is introduced, i.e. LPS. Do the concentrations of cytokines and LPS used compare similarly to the circulating levels found in ARDS patient samples? Data describing these levels would be useful. Alternatively, authors could provide a clear rationale describing why the respective cytokines and concentrations were used.

3. Similarly, were the cytokine levels measured in the hydrostatic and ARDS edema fluids? These levels could be provided for comparison, along with suggestions for future studies that would help elucidate the different mechanisms responsible for how/why ARDS but not hydrostatic edema fluid resulted in increased CD40 expression.

4. In terms of the potential for treatment of ARDS using hMSCs, and given the pluripotency demonstrated, which cell phenotype do the authors expect to be most beneficial? It may be useful to the reader if the authors could add data or an explanation describing how this immunomodulatory phenotype could be maintained in clinical studies, especially given that the cytokine levels in human ARDS will likely vary over time and between individuals at different stages of disease progression.

5. It would be useful to quantify the findings in Figure 3.

MINOR

6. A few sentences in the Introduction would benefit from references being added. For example, “Alveolar macrophage activation leads to secretion of inflammatory cytokines, including interleukin-1β (IL-1�), tumor necrosis factor (TNF), interleukin-6 (IL-6), and interleukin-8 (IL-8), which lead to additional neutrophil activation.”, “hMSCs have many beneficial immunomodulatory effects.”, and “Through soluble mediators such as indoleamine-2,3-dioxygenase and PGE2, hMSCs promote the M1 to M2 transition of activated macrophages.”

7. Regarding the hydrostatic pulmonary edema fluid, it may not be clear to the reader from whom this fluid was taken. For example, what were the demographics of these individuals/patients?

8. For consistency, the heading “Flow cytometry – “ in the Methods could be replaced with “Flow cytometry.”, and “CD40 is expressed on the cell surface after CytoMix Exposure” replaced with “CD40 is expressed on the cell surface after CytoMix exposure”.

9. For clarity, regarding the following sentence in the Discussion, it may be useful to expand this sentence by including an explanation of the type of methods/studies that would be used to investigate/induce preconditioning: “Given the robust nature of this phenotype under specific conditions and the variability among human disease states, preconditioning may be important to ensure a uniform hMSC exposure in clinical trials.”

10. Given the observational nature of the findings, it may be more suitable and reflective of the findings to remove the following phrase from the title: ” – a mechanism for immune modulation”

11. According to the Methods, Mann Whitney or T-tests were used throughout. It is my understanding, however, that ANOVA should be used for multiple group comparisons (i.e. when there are more than 2 groups being compared).

Reviewer #2: This is an interesting paper by Wilfong et al that shows upregulated CD40 on human mesenchymal stem/stromal cells (hMSCs) after exposure to proinflammatory cytokines or ARDS pulmonary edema fluid. Furthermore, the expression of several anti-inflammatory cytokines and paracrine effectors, on hMSCs was also up-regulated. Finally, proinflammatory cytokines have been shown to reduce pleuripotency of hMSCs and block hMSCs differentiation into adipocytes. Overall, this is a very well written and a complete study on the important role of hMSCs in immunomodulation in ARDS. I only have a few minor comments that will help to clarify a few points in the manuscript.

Minor comments:

1. In Figure 2 and 3, quantification is required.

2. Please check and define all abbreviations on the first occurrence in context.

3. In the Statistical Analysis section, The description “P < 0.05 was considered significant” is missing.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Colin E. Evans

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

21 Sep 2020

Editorial Office:

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

This has been done.

2. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.

We apologize for this oversight. This data has been added as a supplemental figure. We have also expanded the statistical analysis section and added a new S3 data appendix to improve data transparency in accordance with your statistical reporting guidelines.

Reviewer #1:

This observational paper describes some interesting phenotypes in hMSCs under inflammatory conditions, including the upregulation of CD40 by inflammatory cytokines or ARDS edema fluid. Given the potential for hMSC treatment in ARDS patients, these important findings could lead to further investigations of the regulation of hMSC function and efficacy in ARDS. However, given that the current data does not comprehensively describe any novel mechanistic regulation of hMSC function by each of the different inflammatory stimuli, the authors could include some further studies/explanations to further enhance the insight provided by their work.

MAJOR

1. Which cell markers were used to define the hMSCs? Given that the cells were obtained from 3 different locations/sources, how did the authors ensure that the cells were consistent?

We felt that using hMSCs from multiple sources demonstrated that the phenotype described was consistent and robust for , increasingly the likelihood of reproducibility if studies were to be repeated in other laboratories. Additionally, this avoided the problem of a finding that might be reflective of cells from a specific location/source, rather than broadly applicable to hMSCs. All cell lines were validated using qPCR for the presence of CD73, CD90, and CD105, as well as the absence of CD11b, CD14, CD34, CD45, CD19, CD79A, CD54, and HLADRB. This data is shown in supplemental figure S1. This has been added to the methods. (Lines 80-82)

2. Regarding the different cytokine combinations, text in the introduction states that secretion of IL1b, TNFa, IL6, and IL8 is increased. Later in the introduction, the cytomix of TNFa, IFNy, and IL1b is mentioned. In the methods, the cytomix is described and another stimulus is introduced, i.e. LPS. Do the concentrations of cytokines and LPS used compare similarly to the circulating levels found in ARDS patient samples? Data describing these levels would be useful. Alternatively, authors could provide a clear rationale describing why the respective cytokines and concentrations were used.

The CytoMix cytokine cocktail was selected as it has been shown to recapitulate the effects of acute lung injury pulmonary edema fluid on alveolar type II cells. This sentence has been added to the introduction. (Lines 66-69)

3. Similarly, were the cytokine levels measured in the hydrostatic and ARDS edema fluids? These levels could be provided for comparison, along with suggestions for future studies that would help elucidate the different mechanisms responsible for how/why ARDS but not hydrostatic edema fluid resulted in increased CD40 expression.

We agree that measure the cytoking levels in hydrostatic and ARDS edema fluids could be information. Unfortunately, due to very limited sample availability, cytokine levels from these pulmonary edema fluid samples were not measured.

4. In terms of the potential for treatment of ARDS using hMSCs, and given the pluripotency demonstrated, which cell phenotype do the authors expect to be most beneficial? It may be useful to the reader if the authors could add data or an explanation describing how this immunomodulatory phenotype could be maintained in clinical studies, especially given that the cytokine levels in human ARDS will likely vary over time and between individuals at different stages of disease progression.

Thank you for this recommendation. We have modified the discussion to say, “Given the robust nature of this phenotype under specific conditions and the variability among human disease states, preconditioning with CytoMix to induce an immunomodulatory phenotype may be important to ensure a uniform hMSC exposure in clinical trials, but this will require additional in vivo investigations.” (Lines 282-284) At present, we have not conducted any in vivo clinical trials to look at these immunomodulatory phenotypes after administration.

5. It would be useful to quantify the findings in Figure 3.

Thank you for this suggestion. These have been quantified within the Figure 3 legend, within the text, and in the S3 data appendix.

MINOR

6. A few sentences in the Introduction would benefit from references being added. For example, “Alveolar macrophage activation leads to secretion of inflammatory cytokines, including interleukin-1β (IL-1�), tumor necrosis factor (TNF), interleukin-6 (IL-6), and interleukin-8 (IL-8), which lead to additional neutrophil activation.”, “hMSCs have many beneficial immunomodulatory effects.”, and “Through soluble mediators such as indoleamine-2,3-dioxygenase and PGE2, hMSCs promote the M1 to M2 transition of activated macrophages.”

Thank you for this suggestion. Additional references have been added. The sentence stating ‘hMSCs have many beneficial immunomodulatory effects” is an introductory sentence to summarize the remainder of that paragraph that delineates these benefits.

7. Regarding the hydrostatic pulmonary edema fluid, it may not be clear to the reader from whom this fluid was taken. For example, what were the demographics of these individuals/patients?

While this would indeed be interesting, this information is not available.

8. For consistency, the heading “Flow cytometry – “ in the Methods could be replaced with “Flow cytometry.”, and “CD40 is expressed on the cell surface after CytoMix Exposure” replaced with “CD40 is expressed on the cell surface after CytoMix exposure”.

These changes have been made.

9. For clarity, regarding the following sentence in the Discussion, it may be useful to expand this sentence by including an explanation of the type of methods/studies that would be used to investigate/induce preconditioning: “Given the robust nature of this phenotype under specific conditions and the variability among human disease states, preconditioning may be important to ensure a uniform hMSC exposure in clinical trials.”

We have added that additional in vivo experiments would be required. We respectfully feel that a larger discussion would take away from the main finding of this report; namely the finding of CD40 positivity.

10. Given the observational nature of the findings, it may be more suitable and reflective of the findings to remove the following phrase from the title: ” – a mechanism for immune modulation”

We have added the word “potential” before mechanism, as these are observational studies and direct causation is not established.

11. According to the Methods, Mann Whitney or T-tests were used throughout. It is my understanding, however, that ANOVA should be used for multiple group comparisons (i.e. when there are more than 2 groups being compared).

ANOVA, or Kruskal-Wallis-given our data is non-parametric, evaluate if there are differences between any of the groups in a multiple comparison analysis, but cannot evaluate which groups were different. For the second portion of the analysis, we used Mann-Whitney U tests to ascertain between group comparisons. The Kruskal-Wallis ANOVA was <0.01 for panels B-F of Figure 2. This has been added to the caption.

Reviewer #2:

This is an interesting paper by Wilfong et al that shows upregulated CD40 on human mesenchymal stem/stromal cells (hMSCs) after exposure to proinflammatory cytokines or ARDS pulmonary edema fluid. Furthermore, the expression of several anti-inflammatory cytokines and paracrine effectors, on hMSCs was also up-regulated. Finally, proinflammatory cytokines have been shown to reduce pleuripotency of hMSCs and block hMSCs differentiation into adipocytes. Overall, this is a very well written and a complete study on the important role of hMSCs in immunomodulation in ARDS. I only have a few minor comments that will help to clarify a few points in the manuscript.

Minor comments:

1. In Figure 2 and 3, quantification is required.

We have now performed quantification for both Figure 2 and Figure 3.

2. Please check and define all abbreviations on the first occurrence in context.

We have reviewed abbreviations, and made updates as necessary to define upon first occurrence in the text.

3. In the Statistical Analysis section, The description “P < 0.05 was considered significant” is missing.

Thank you for noting this. We have expanded the statistical analysis section and included this.

Submitted filename: Response to Reviewers.docx

Click here for additional data file.

24 Sep 2020

Proinflammatory cytokines and ARDS pulmonary edema fluid induce CD40 on human mesenchymal stromal cells – a potential mechanism for immune modulation

PONE-D-20-17990R1

Dear Dr. Wilfong,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

You-Yang Zhao

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: (No Response)

Reviewer #2: The authors have addressed the detailed questions I raised in my previous review. I have no further comments regarding this manuscript.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Colin Evans

Reviewer #2: No

28 Sep 2020

PONE-D-20-17990R1

Proinflammatory cytokines and ARDS pulmonary edema fluid induce CD40 on human mesenchymal stromal cells – a potential mechanism for immune modulation

Dear Dr. Wilfong:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. You-Yang Zhao

Academic Editor

PLOS ONE