Metabolic profiling during malaria reveals the role of the aryl hydrocarbon receptor in regulating kidney injury.

Systemic metabolic reprogramming induced by infection exerts profound, pathogen-specific effects on infection outcome. Here, we detail the host immune and metabolic response during sickness and recovery in a mouse model of malaria. We describe extensive alterations in metabolism during acute infection, and identify increases in host-derived metabolites that signal through the aryl hydrocarbon receptor (AHR), a transcription factor with immunomodulatory functions. We find that Ahr-/- mice are more susceptible to malaria and develop high plasma heme and acute kidney injury. This phenotype is dependent on AHR in Tek-expressing radioresistant cells. Our findings identify a role for AHR in limiting tissue damage during malaria. Furthermore, this work demonstrates the critical role of host metabolism in surviving infection.

Introduction

Infection imposes metabolic challenges on hosts, including the generation of costly immune responses, repair of damaged tissues, and competition with pathogens for nutrients. Hosts cope with these pressures through systemic metabolic reprogramming, with varying effects on infection outcome. Metabolic alterations can be beneficial to hosts. For example, controlling circulating triglycerides and glucose minimizes tissue damage during sepsis (Luan et al., 2019; Weis et al., 2017); similarly, the switch from metabolic to immune transcriptional programs driven by the Drosophila transcription factor MEF2 during Mycobacterium marinum infection promotes survival (Clark et al., 2013). In contrast, some metabolic changes are detrimental to hosts, such as reduced insulin signaling in M. marinum-infected fruit flies, leading to wasting and death (Dionne et al., 2006). Metabolic changes have infection-specific outcomes; for example, infection-induced anorexia promotes survival in some infection contexts, but not others (Ayres and Schneider, 2009; Cumnock et al., 2018; Rao et al., 2017; Wang et al., 2016; Wang et al., 2018). Metabolic changes can mediate these pathogen-specific outcomes through two distinct host protection strategies: by affecting either pathogen killing, a process called resistance, and/or the degree of collateral damage to the host per microbe, called disease tolerance (Ayres and Schneider, 2009). Better understanding of how systemic infection-induced metabolic changes affect infection will inform therapeutics that intentionally alter metabolism to improve outcomes.

Over 400,000 people die annually from malaria, which is caused by mosquito-transmitted Plasmodium parasites (WHO, 2018). The effect of host metabolism on malaria outcome is poorly understood. Metabolic changes such as lactic acidosis occur during malaria (Miller et al., 2013) and a number of studies have reported metabolomics on in vivo Plasmodium infection (Abdelrazig et al., 2017; Gardinassi et al., 2017; Gardinassi et al., 2018; Ghosh et al., 2012; Ghosh et al., 2016; Gupta et al., 2017; Lee et al., 2014). Nevertheless, these experiments have important limitations. Field studies often do not capture events in early infection that occur prior to the onset of clinical symptoms. Furthermore, important metabolic alterations may occur on the scale of days, which would require the collection of densely spaced samples often infeasible outside of lab experiments.

Malaria can lead to pathology including severe anemia and acute kidney injury (AKI) (Haldar and Mohandas, 2009; Koopmans et al., 2015; Trang et al., 1992). During blood stage infection, parasites infect, proliferate within, and lyse red blood cells (RBCs). This hemolysis releases hemoglobin and then heme into plasma (Miller et al., 2013). Free heme can catalyze the formation of reactive oxygen species, damaging cells and tissues including the kidneys (Chiabrando et al., 2014; Tracz et al., 2007). To mitigate heme toxicity, heme levels are regulated in plasma by heme-binding proteins and intracellularly by the heme degradation enzyme heme oxygenase-1 (HO-1), among others (Chiabrando et al., 2014). During malaria, these mechanisms limit AKI (Ramos et al., 2019; Seixas et al., 2009). Clinically, the development of AKI during malaria correlates with high heme levels (Elphinstone et al., 2016; Plewes et al., 2017). Together, these data suggest that heme toxicity is an important cause of tissue damage during malaria.

Heme metabolism produces agonists of the aryl hydrocarbon receptor (AHR), a nuclear receptor transcription factor. AHR ligands include the environmental toxin 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), the heme metabolites bilirubin and biliverdin, tryptophan metabolites including kynurenine, and indoles produced by the commensal microbiota (Rothhammer and Quintana, 2019; Stockinger et al., 2014). AHR functions in a ligand- and cell-specific manner in processes such as the regulation of T cell differentiation, homeostasis in barrier tissues, and cell proliferation (Esser and Rannug, 2015; Rothhammer and Quintana, 2019; Stockinger et al., 2014). In the absence of AHR, mice are more susceptible to a variety of infections and inflammatory insults, including Plasmodium berghei ANKA, a rodent malaria parasite that causes lethal cerebral malaria (Bessede et al., 2014; Brant et al., 2014; Di Meglio et al., 2014; Kimura et al., 2014; Moura-Alves et al., 2014; Sanchez et al., 2010; Shi et al., 2007). As AHR has diverse functions in many cell types, including immune cells, endothelial cells, and hepatocytes, its precise role in a given infection is often undefined (Agbor et al., 2011; Boule et al., 2018; Chen et al., 2019; Chng et al., 2016; Jux et al., 2011; Metidji et al., 2018; Sekine et al., 2009; Walisser et al., 2005).

Here, we use metabolomics to systemically characterize metabolism in C57BL/6 mice infected with P. chabaudi (Pc). Pc is a rodent malarial parasite that recapitulates several key features of human malaria, including systemic inflammation and nonlethal anemia during acute infection, but does not cause severe complications like AKI in wild-type C57BL/6 mice (Stephens et al., 2012). We find that AHR ligands are most abundant during acute sickness and demonstrate that AHR signaling is an essential host protection mechanism to regulate plasma heme, limit kidney damage, and promote survival during malaria. Moreover, we determine that these functions are dependent on AHR signaling in Tek-expressing radioresistant cells.

Results

Malaria is characterized by stages with unique immune, metabolic, and tissue damage events

To identify connections between host metabolism and malaria pathogenesis, we first asked how well-known features of Pc malaria temporally relate to one another. We collected blood and plasma from Pc-infected C57BL/6 mice daily from 0 to 25 days post-infection (DPI) as well as mock-infected control mice on 5, 7, 10, 12, 15, 19, and 25 DPI. We divided this time series into early, acute, and late infection based on parasitemia; while early infection was marked by undetectable parasitemia, parasites infected up to one-third of RBCs during the acute stage, with a small recrudescence in parasitemia occurring during late infection (Figure 1A). As parasitemia rose during acute infection, mice developed pathology including liver damage, indicated by plasma levels of alanine aminotransferase (ALT), and anemia, which was not ameliorated until late infection (Figure 1B). We next evaluated the immune response throughout infection by analyzing peripheral blood for pro-inflammatory cells and cytokines with known functions in malaria pathogenesis and pathology (reviewed in Aitken et al., 2018; Angulo and Fresno, 2002; Dunst et al., 2017; Wolf et al., 2017). We observed that aspects of the immune response were activated prior to the onset of parasitemia and pathology. Interleukin 12 (IL-12p70) and interferon γ (IFNγ) increased in blood during early infection; acute infection was marked by elevated circulating natural killer (NK) cells, neutrophils, and B cells, as well as increased tumor necrosis factor (TNF) and IL-10 (Figure 1C, Figure 1—figure supplement 1). Circulating γδ T cells increased in peripheral blood during late malaria, when they control recrudescence (Mamedov et al., 2018; Figure 1C). This analysis revealed that each day of infection is marked by a unique combination of immune and pathological events, with the immune response both predating and outlasting the parasitemia and pathology of acute infection. Moreover, we established a timeline of many well-understood features of malaria to provide context to our metabolomic analysis.

Figure 1.

Dynamic multi-omic profiling of Pc-infected mice reveals broad immune and metabolic changes.

(A) Parasitemia, (B) liver damage and anemia, and (C) selected peripheral blood immune cells and cytokines during 25 days of malaria. (D) 370 metabolites with altered scaled intensity in plasma during malaria, arranged by super pathway. Fold change of scaled intensity of (E) stachydrine, BHBA, (F) arachidonate, and α-tocopherol in plasma during malaria, relative to day 0. (G) Schematic of metabolites and genes of heme metabolism. (H) Fold change of scaled intensity of heme-related metabolites in plasma during malaria, relative to day 0. (I) Fold change of metabolites (n = 77) that were significantly altered in the plasma of both Pc-infected mice and pediatric cerebral malaria patients, plotted by fold change relative to day 0 samples for mice and relative to convalescent values for patients. Data are fitted with a linear model. (J) Scaled intensity of heme-related metabolites during human malaria (n = 11 patients per condition). In A-C, E, F, and H, data are presented as mean + SEM and p-values were determined by comparing each infected time point to all uninfected values using two-way ANOVA with FDR correction (n = 5 mice on 0 DPI, five infected mice each day, and two uninfected mice each day). *p<0.05. In J, p-values were determined using a Wilcox test. **p<0.01. These experiments were performed once.

(A) Expression of heme metabolism genes in livers of Pc-infected mice. p-Values were determined by comparing each infected time point to all uninfected values using two-way ANOVA with FDR correction (n = 5 mice on 0 DPI, five infected mice each day, and two uninfected mice each day). *p<0.05. (B) Scaled intensity of arachidonate, BHBA, stachydrine, and heme in pediatric cerebral malaria patients (n = 11 per condition). p-Values were determined using a Wilcox test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. These experiments were performed once.

Figure 1—figure supplement 1.

Gating strategy used to define blood cell populations.

We next asked how host metabolism changes during each stage of malaria. Untargeted metabolomics identified 587 metabolites in plasma. We selected metabolites whose maximum or minimum scaled intensity was (a) at least twofold changed from baseline and (b) significantly different from uninfected samples (p<0.05 by t-test with FDR correction). Of the 370 metabolites we identified as altered according to these stringent criteria, 66% increased in scaled intensity during Pc malaria, most during acute infection (Figure 1D). These metabolites illustrate the significant alterations to host energy metabolism that occur during infection (Cumnock et al., 2018). For example, broad classes of lipids increased during acute infection, including acylcarnitines, glycerolipids, glycerophospholipids, and sphingomyelin (Figure 1D). Metabolites associated with food, including stachydrine, a glycine betaine analog found in grains (Filipčev et al., 2018), decreased in scaled intensity during acute infection (Figure 1E), indicative of reduced food intake. Ketone bodies also increased in scaled intensity during acute infection (Figure 1E), suggesting that mice entered ketosis, perhaps linked to decreases in food consumption (Cumnock et al., 2018). Acute infection was also characterized by increased scaled intensity of inflammation-induced metabolites like arachidonate, followed by antiinflammatory metabolites like α-tocopherol, a form of vitamin E, in acute and late infection (Figure 1F). Several γ-glutamyl amino acids increased in scaled intensity during acute and late infection (Figure 1D), suggesting flux through the γ-glutamyl cycle and potentially glutathione biogenesis. A subset of metabolites related to pyrimidine metabolism also increased in scaled intensity during acute and late infection (Figure 1D). Overall, this analysis showed that metabolic changes occurred primarily during acute infection, with relatively few changing only during early or late infection.

We were curious about the pathological and metabolic implications of hemolysis during malaria, which decreases circulating RBCs to just 10% of baseline levels (Figure 1B). Hemolysis releases heme into plasma, where it is bound by heme scavengers, imported into cells in heme-metabolizing organs including liver and kidney, and metabolized into biliverdin by heme oxygenase 1 (HO-1), then into bilirubin by biliverdin reductase (BVR) (Chiabrando et al., 2014). Light exposure converts Z,Z-bilirubin into isomers including E,E-bilirubin (Figure 1G; Rehak et al., 2008). The scaled intensity of heme remained constant during most of acute infection (Figure 1H) despite significant hemolysis (Figure 1B), indicating activation of systemic heme metabolism. However, biliverdin, Z,Z-bilirubin, and E,E-bilirubin increased in scaled intensity during acute and late infection (Figure 1H). This is consistent with increased transcription of Hmox1 and Blvra, the genes encoding HO-1 and BVR, in the liver during acute infection (Figure 1—figure supplement 2A), as well as HO-1 activation during malaria (Ramos et al., 2019; Seixas et al., 2009). Therefore, acute Pc malaria is characterized by stable plasma heme levels combined with an increase in heme breakdown products.

Figure 1—figure supplement 2.

Production of heme metabolites during malaria.

(A) Expression of heme metabolism genes in livers of Pc-infected mice. p-Values were determined by comparing each infected time point to all uninfected values using two-way ANOVA with FDR correction (n = 5 mice on 0 DPI, five infected mice each day, and two uninfected mice each day). *p<0.05. (B) Scaled intensity of arachidonate, BHBA, stachydrine, and heme in pediatric cerebral malaria patients (n = 11 per condition). p-Values were determined using a Wilcox test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. These experiments were performed once.

To determine how the metabolic changes we observed in our mouse malaria model compare to human malaria, we analyzed a metabolomics dataset describing the plasma of P. falciparum-infected pediatric patients during acute cerebral malaria (CM) and 30 days post-treatment (Gupta et al., 2017). While uncomplicated Pc malaria in mice and CM caused by P. falciparum in humans differ substantially in lethality and pathogenesis, the two forms of malaria do share similar features, such as massive RBC destruction and systemic immune activation. We identified 77 metabolites with significantly altered intensity in both acute CM and Pc malaria, and observed similar magnitude and directionality of malaria-induced changes (p-value=1.572e-14) (Figure 1I). For example, increased scaled intensity of ketone bodies (BHBA) was observed in CM (Figure 1—figure supplement 2B), just as in Pc malaria (Figure 1E), suggesting that both humans and mice enter ketosis during acute infection. Like in Pc malaria, acute CM was characterized by increased scaled intensity of inflammation-induced arachidonate, and a trend toward decreased intensity of food-derived stachydrine (Figure 1—figure supplement 2B). As in Pc malaria, the scaled intensity of biliverdin and both measured bilirubin isomers was elevated during acute CM (Figure 1J), while heme scaled intensity was not different between the acute and convalescent timepoints in the clinical samples (Figure 1—figure supplement 2B).

These data identify distinct malaria stages with unique physiological, immune, and metabolic events. Comparison of the plasma metabolome of clinical CM and mouse Pc malaria suggests that Pc infection recapitulates many metabolic changes observed clinically, including increases in heme metabolites during acute infection.

AHR ligands are more abundant during acute infection

Biliverdin and bilirubin activate AHR, an immunomodulatory transcription factor with agonists of dietary, microbial, and host origin (Rothhammer and Quintana, 2019; Stockinger et al., 2014). We therefore looked for other AHR ligands in our dataset. Tryptophan catabolism via the kynurenine pathway (Figure 2A) produces metabolites with varying affinities for AHR, including L-kynurenine, kynurenate, 3-hydroxy-DL-kynurenine, and quinolinic acid (Desvignes and Ernst, 2009; Rothhammer and Quintana, 2019). Tryptophan decreased in scaled intensity during acute infection, while downstream products including kynurenine, kynurenate, and quinolinate increased (Figure 2B), as observed previously in a P. berghei ANKA infection (Clark et al., 2005). Pc infection resulted in increased expression of Ido1 and decreased expression of downstream kynurenine pathway genes in the liver (Figure 2—figure supplement 1A), suggesting that these metabolites may be produced in other tissues during malaria. Moreover, in cerebral malaria patients, the scaled intensity of tryptophan, kynurenine, and kynurenate was elevated during acute infection relative to convalescence (Figure 2C).

Figure 2.

Malaria modulates AHR ligands in the plasma of mice and patients.

(A) Schematic of metabolites and genes of the kynurenine pathway. (B) Fold change of scaled intensity of kynurenine pathway compounds during Pc infection, relative to day 0 (mean + SEM). p-Values were determined by comparing each infected time point to all uninfected values using two-way ANOVA with FDR correction (n = 5 mice on 0 DPI, five infected mice each day, and two uninfected mice each day). *p<0.05. (C) Scaled intensity of kynurenine pathway compounds in pediatric cerebral malaria patients (n = 11 patients per condition). (D) Quantification of bilirubin (n = 12–13 mice per condition) and (E) kynurenine pathway metabolites (n = 5–6 mice per condition) at 9 days post Pc infection. p-Values were determined in C-E using a Wilcox test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. These experiments were performed once.

(A) Expression of kynurenine pathway genes in livers of Pc-infected mice (n = 2–5 mice per condition). (B) Scaled intensity of indoleacetate during Pc infection. p-Values were determined by comparing each infected time point to all uninfected values using two-way ANOVA with FDR correction n = 5 mice on 0 DPI, five infected mice each day, and (two uninfected mice each day). *p<0.05. Values are presented as mean + SEM. These experiments were performed once.

Figure 2—figure supplement 1.

Production of AHR ligands during malaria.

(A) Expression of kynurenine pathway genes in livers of Pc-infected mice (n = 2–5 mice per condition). (B) Scaled intensity of indoleacetate during Pc infection. p-Values were determined by comparing each infected time point to all uninfected values using two-way ANOVA with FDR correction n = 5 mice on 0 DPI, five infected mice each day, and (two uninfected mice each day). *p<0.05. Values are presented as mean + SEM. These experiments were performed once.

AHR ligands also include indoles, a class of metabolites derived from microbial metabolism of tryptophan (Rothhammer and Quintana, 2019). By untargeted metabolomics, the scaled intensity of indoleacetate trended towards decreasing during acute infection (Figure 2—figure supplement 1B) consistent with infection-induced anorexia during this time limiting energy input for both the host and microbiota (Figure 1E; Cumnock et al., 2018). Other AHR ligands, including the arachidonic acid derivatives PGE2, leukotriene B4, and lipoxin A4, were not measured in our metabolomics experiment (Denison and Nagy, 2003; Rothhammer and Quintana, 2019).

To confirm our metabolomics data, we quantified the plasma levels of select AHR ligands at 9 DPI in infected and uninfected mice. As in our metabolomics data, the concentration of plasma bilirubin was elevated during acute infection (Figure 2D). We measured tryptophan metabolites by targeted mass spectrometry and confirmed that plasma tryptophan decreased during infection, whereas the concentration of L-kynurenine, 3-hydroxy-DL-kynurenine, and quinolinic acid increased (Figure 2E). During acute malaria, bilirubin reached higher plasma concentration than any tryptophan metabolite by at least one order of magnitude. In summary, we observed that AHR ligands derived from heme and tryptophan metabolism increased in plasma of mice and humans during acute Plasmodium infection.

AHR signaling is protective during Pc infection

Given that AHR ligands were elevated in plasma during acute infection, we hypothesized that AHR signaling affects the outcome of Pc infection. We infected female littermate Ahr, Ahr, and Ahr mice with Pc and monitored parasite load and survival over a 15-day time course that captured both acute infection and recovery. Ahr mice developed higher parasitemia than Ahr and Ahr mice (Figure 3A). All genotypes had similar maximum parasite density, although parasite density in Ahr mice peaked a day earlier (Figure 3B). Ahr mice developed more severe anemia, indicated by RBC density (Figure 3C), at least partly due to increased parasite-mediated hemolysis. Ahr mice also had more severe sickness as measured by weight loss and temperature decrease (Figure 3D–E). While most Ahr and Ahr mice survived, all Ahr mice succumbed to infection between days 9 and 12 (Figure 3F). Because Ahr and Ahr mice had equivalent disease severity, we used either Ahr or Ahr mice as controls for subsequent experiments. We observed similar, if less pronounced, trends for male Ahr, Ahr, and Ahr mice (Figure 3—figure supplement 1).

Figure 3.

Ahr mice are susceptible to malaria.

(A) Parasitemia, (B) parasite density, (C) RBCs/μl blood, change in (D) body weight and (E) temperature relative to day 0, and (F) survival of Pc-infected Ahr, Ahr and Ahr mice (n = 10, 8, and 11, respectively). p-Values in A-E were determined using two-way ANOVA with FDR correction comparing Ahr and Ahr mice; values are mean ± SEM. p-Values in F were determined using a log-rank test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Data were combined from three independent experiments.

(A) Parasitemia, (B) parasite density, and (C) survival of male Pc-infected Ahr, Ahr, and Ahr mice (n = 7, 23, and 9, respectively). p-Values in A, and B were determined using two-way ANOVA with FDR correction; values are mean ± SEM. p-Values in C were determined using a log-rank test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Data were combined from three independent experiments.

(A) Quantification of kynurenine pathway metabolites in Pc- or mock-infected Ido1 and Ido1 mice on 9 DPI (n = 5 per condition). (B) Parasitemia, (C) parasite density, and (D) survival of Pc-infected Ido1 and Ido1 mice (n = 12–13 per condition). p-Values in A, B, and C were determined using two-way ANOVA with FDR correction; values are mean ± SEM. p-Values in D were determined using a log-rank test. *p<0.05. Data are representative of two independent experiments.

Figure 3—figure supplement 1.

MaleAhr-/-mice are susceptible to malaria.

(A) Parasitemia, (B) parasite density, and (C) survival of male Pc-infected Ahr, Ahr, and Ahr mice (n = 7, 23, and 9, respectively). p-Values in A, and B were determined using two-way ANOVA with FDR correction; values are mean ± SEM. p-Values in C were determined using a log-rank test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Data were combined from three independent experiments.

Our metabolomics data suggested that AHR signaling during malaria could be activated by tryptophan and/or heme metabolites. To ask whether susceptibility to malaria is dependent on tryptophan metabolism, we measured kynurenine and other tryptophan metabolites in Pc-infected mice lacking indoleamine 2,3-dioxygenase 1 (Ido1), one of two enzymes that catalyzes the rate-limiting step of the tryptophan pathway (Figure 2A; Fatokun et al., 2013). The concentrations of kynurenine and 3-hydroxy-kynurenine in Ido1 mice at 9 DPI were lower than infected Ido1 mice and statistically indistinguishable from uninfected mice of either genotype (Figure 3—figure supplement 2A). Nevertheless, Ido1 and Ido1 mice had similar parasite load and survival (Figure 3—figure supplement 2B–D). We conclude that AHR signaling, but not by kynurenine pathway metabolites, is required during Pc infection under our experimental conditions.

Figure 3—figure supplement 2.

Ido1-/-mice are not susceptible to malaria.

(A) Quantification of kynurenine pathway metabolites in Pc- or mock-infected Ido1 and Ido1 mice on 9 DPI (n = 5 per condition). (B) Parasitemia, (C) parasite density, and (D) survival of Pc-infected Ido1 and Ido1 mice (n = 12–13 per condition). p-Values in A, B, and C were determined using two-way ANOVA with FDR correction; values are mean ± SEM. p-Values in D were determined using a log-rank test. *p<0.05. Data are representative of two independent experiments.

Ahr mice develop AKI during malaria

To understand why Ahr mice were more susceptible to malaria, we asked which tissues were specifically injured in infected Ahr mice compared to Ahr mice. Liver damage is a common pathology during malaria, and Ahr mice had liver damage at 8 DPI, indicated by a 100-fold increase in plasma levels of alanine aminotransferase (ALT) relative to baseline (Figure 4A). Plasma ALT in Ahr mice increased by 8-fold above baseline. Additionally, livers from Pc-infected Ahr mice had more frequent histological evidence of parenchymal necrosis than Ahr mice, although both genotypes showed similar extent of inflammation and margination of leukocytes along the vascular endothelium (Figure 4—figure supplement 1A). Thus, Ahr mice develop less severe liver damage than Ahr mice during Pc malaria. Histological analysis of spleens revealed comparable red pulp extramedullary hematopoiesis and vascular leukocyte margination in both genotypes during infection (Figure 4—figure supplement 1B), while lungs from infected and uninfected Ahr and Ahr mice were within normal limits (Figure 4—figure supplement 1C).

Figure 4.

Acute kidney injury and inappropriate heme regulation in Ahr mice during malaria.

(A) ALT and (B) BUN in plasma of Ahr and Ahr mice during infection (n = 3–9 per group). (C) Gene expression in kidneys from Ahr and Ahr mice on 8 DPI (normalized to Arbp0 using the ddCT method, n = 5 per condition). (D) Representative images of H and E-stained kidney tissue from Ahr and Ahr mice (magnification: 40x, scale bar: 20 μm). Black asterisks indicate dilated renal tubules with eosinophilic proteinaceous fluid. (E) Total heme in plasma of Pc-infected Ahr and Ahr mice (n = 3–9 per group). (F) Correlation of heme and BUN from individual mice (also plotted in B and E) and fit with a linear model. (G) Total heme in urine of Pc-infected Ahr and Ahr mice (n = 3–8 per group). p-Values in A, B, E, and G were determined using two-way ANOVA with FDR correction; values are mean ± SEM. p-Values in C were determined using a Wilcox test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Each timepoint was collected in one to two independent experiments.

Black chevrons in A indicate margination of leukocytes along the endothelial lining. The black dotted line in A delineates an area of parenchymal necrosis. Data are representative of two independent experiments.

(A) Msp1 expression in perfused kidneys from Ahr and Ahr mice on 8 DPI (normalized to Hmbs using the ddCT method, n = 6 per group). (B) Representative images of Perls Prussian blue-stained kidney cortex from Pc-infected Ahr and Ahr mice on 8 DPI. The blue signal (arrows) indicates accumulation of iron. (C) Western blot showing levels of heme metabolism genes in liver and kidney tissue from Pc-infected Ahr and Ahr mice on 8 DPI. (D) qRT-PCR analysis of heme metabolism genes in liver tissue from Pc-infected Ahr and Ahr mice on 8 DPI (n = 3–5 per condition). p-Values in A and D were determined using a Wilcox test. *p<0.05. These experiments were performed once.

(A) Survival, (B) RBCs/μl blood, (C) plasma heme, and (D) BUN in phenylhydrazine-treated Ahr and Ahr mice (n = 9 per genotype). p-Value in A was calculated using a log-rank test. p-Values in B-D were determined using two-way ANOVA with FDR correction; values are mean ± SEM. *p<0.05. Data are representative of two independent experiments.

Figure 4—figure supplement 1.

Representative images of H and E-stained tissue showing (A) liver, (B) spleen, and (C) lung, and (D) kidney arcuate vein from Ahr and Ahr mice (magnification: 40x).

Black chevrons in A indicate margination of leukocytes along the endothelial lining. The black dotted line in A delineates an area of parenchymal necrosis. Data are representative of two independent experiments.

To evaluate kidney function, we measured blood urea nitrogen (BUN) levels. At baseline, mice of both genotypes had comparable BUN. During acute infection, BUN in Ahr mice increased by twofold above baseline, indicative of a mild to moderate decrease in kidney function; in Ahr mice, BUN increased by eightfold, indicative of a substantial decrease in function (Figure 4B; Ramos et al., 2019; Wei and Dong, 2012). The genes Kidney injury molecule 1 (Havcr1) and Lipocalin 2 (Lcn2), markers of kidney injury, were induced in both genotypes by Pc infection, and to significantly higher levels in Ahr mice at 8 DPI (Figure 4C; Han et al., 2002; Moschen et al., 2017). Histologically, kidneys from Ahr mice had evidence of leukocyte margination (most prominently in the arcuate vessels), frequent cortical tubular dilation (with or without luminal protein), and rare tubular epithelial cell necrosis with luminal sloughing, whereas kidneys from Ahr mice only show evidence of leukocyte margination (Figure 4D, Figure 4—figure supplement 1D). Together, these data show that Ahr mice have mild kidney injury during Pc malaria, whereas Ahr mice develop AKI.

We next aimed to determine the cause of kidney pathology in Ahr mice. Parasites sequestered in capillaries could obstruct vessels and cause kidney damage. To test this hypothesis, we measured expression of Merozoite surface protein 1 (Msp1) in perfused kidney tissue as a proxy for parasite abundance. We observed no difference in Msp1 gene expression in the kidneys of Ahr and Ahr mice (Figure 4—figure supplement 2A), suggesting that increased parasite sequestration within Ahr kidneys was not responsible for kidney injury. Kidneys can also sustain injury when exposed to free heme; during malaria and other hemolytic conditions, lysed RBCs release heme into plasma, and mice with impaired heme metabolism can suffer from heme-mediated AKI (Ramos et al., 2019; Seixas et al., 2009; Vinchi et al., 2013; Zarjou et al., 2013). Plasma heme levels in Ahr and Ahr mice were equivalent at baseline; however, at 8 DPI, plasma heme in Ahr mice was elevated sevenfold above baseline, compared to 1.8-fold in Ahr mice (Figure 4E). These findings are consistent with a previous observation of increased serum iron in P. berghei ANKA-infected Ahr mice (Brant et al., 2014). These data also demonstrate that kidney function during Pc infection is correlated with heme concentration. Plotting plasma heme and BUN values for 49 Ahr and Ahr mice on 0, 5, 7, and 8 dpi reveals a correlation with adjusted R2 = 0.694 (p-value=6.699×10−14) (Figure 4F). We conclude that Pc-infected Ahr mice suffered from AKI, likely caused by heme toxicity.

Figure 4—figure supplement 2.

Heme metabolism appears largely normal inAhr-/-mice during malaria.

(A) Msp1 expression in perfused kidneys from Ahr and Ahr mice on 8 DPI (normalized to Hmbs using the ddCT method, n = 6 per group). (B) Representative images of Perls Prussian blue-stained kidney cortex from Pc-infected Ahr and Ahr mice on 8 DPI. The blue signal (arrows) indicates accumulation of iron. (C) Western blot showing levels of heme metabolism genes in liver and kidney tissue from Pc-infected Ahr and Ahr mice on 8 DPI. (D) qRT-PCR analysis of heme metabolism genes in liver tissue from Pc-infected Ahr and Ahr mice on 8 DPI (n = 3–5 per condition). p-Values in A and D were determined using a Wilcox test. *p<0.05. These experiments were performed once.

Normal heme metabolism involves binding free heme in plasma with scavengers, intracellular import, and HO-1-mediated breakdown in the liver and other heme-metabolizing organs Chiabrando et al., 2014; during malaria, heme is also excreted in urine (Ramos et al., 2019). The elevated plasma heme observed in Pc-infected Ahr mice could be caused by excess heme release into plasma and/or issues with heme transport and breakdown subsequent to release in plasma. To discriminate between these possibilities, we measured urinary heme and found that Ahr and Ahr mice had similarly elevated heme levels in urine (Figure 4G). To test for inappropriate iron deposits in the kidneys of Ahr mice, we performed Perls Prussian blue staining, which revealed similar accumulation of iron-containing compounds in the cortical tubular epithelial cells and within the tubular lumina of both Ahr and Ahr infected mice (Figure 4—figure supplement 2B). We also evaluated levels of HO-1 and ferritin heavy chain (FTH), two key proteins involved in heme metabolism required for survival during malaria (Ramos et al., 2019), as well as the heme transporters divalent metal transporter 1 (DMT1) and heme carrier protein 1 (HCP1). We did not observe a defect in protein levels in Ahr mice (Figure 4—figure supplement 2C). Transcriptional analysis of an expanded set of heme metabolism genes in liver revealed comparable expression of most genes in infected Ahr and Ahr mice, with the notable exceptions of Heme responsive gene 1 (Hrg1 or Slc48a1) and Solute carrier family 40 member 1 (Slc40a1 or Ferroportin), which remained at baseline levels in infected Ahr mice (Figure 4—figure supplement 2D). Lastly, to determine if AHR is required to control plasma heme in other hemolytic conditions, we employed a model of phenylhydrazine-induced hemolysis (Dutra et al., 2014). Ahr and Ahr mice challenged with phenylhydrazine had equivalent survival, hemolysis, plasma heme, and BUN (Figure 4—figure supplement 3A–D). Overall, despite differences in two key heme metabolism genes, we did not uncover evidence of impaired heme metabolism in Ahr mice that could explain the degree of elevated plasma heme observed during Pc infection. We conclude that the loss of AHR leads to increased heme release during malaria, but not impaired heme metabolism or increased heme sensitivity.

Figure 4—figure supplement 3.

Control andAhr-/-mice are equally susceptible to phenylhydrazine-induced heme overload.

(A) Survival, (B) RBCs/μl blood, (C) plasma heme, and (D) BUN in phenylhydrazine-treated Ahr and Ahr mice (n = 9 per genotype). p-Value in A was calculated using a log-rank test. p-Values in B-D were determined using two-way ANOVA with FDR correction; values are mean ± SEM. *p<0.05. Data are representative of two independent experiments.

AHR is necessary in radioresistant cells to control parasitemia, plasma heme, and AKI during Pc infection

As Ahr mice mount altered immune responses during P. berghei ANKA malaria (Brant et al., 2014) and AHR signaling affects immune responses (Rothhammer and Quintana, 2019), we first sought to characterize the immune responses of Ahr mice during infection. Ahr mice had elevated neutrophil levels in blood during acute sickness (Figure 5—figure supplement 1A), in line with other studies linking inappropriate AHR activation to aberrant neutrophil responses in diverse models of inflammation (Di Meglio et al., 2014; Teske et al., 2005; Teske et al., 2008). We found that neutrophil depletion by anti-Ly6G antibody treatment did not affect survival of Ahr mice (Figure 5—figure supplement 1B–D), indicating that AHR-dependent control of neutrophil responses was not responsible for host protection under these conditions. We also observed increased plasma levels of the cytokine TNF in infected Ahr mice (Figure 5—figure supplement 2A), as observed in P. berghei ANKA-infected Ahr mice (Brant et al., 2014). We found that TNF neutralization did not alter infection outcome or kidney function in Ahr mice (Figure 5—figure supplement 2B–C). Thus, while we and others observed altered immune responses to malaria in Ahr mice, we did not identify a link between these differences and Pc infection outcome.

Figure 5—figure supplement 1.

Neutrophilia inAhr-/-mice during malaria does not cause increased susceptibility.

(A) CD11bhiLy6CintLy6G+ neutrophils/μl blood in Pc- infected Ahr and Ahr mice (n = 6 per genotype). (B) Representative FACS plots of mice at 7 DPI with indicated treatment. (C) Neutrophils/μl blood on 7 DPI in Ahr and Ahr mice after treatment with either Ly6G depleting antibody or isotype control (n = 4–5 per genotype). (D) Survival of Pc-infected Ahr and Ahr mice after treatment with either anti-Ly6G depleting antibody or isotype control (n = 4–5 per genotype). These experiments were performed once.

Figure 5—figure supplement 2.

Increased TNF production inAhr-/-mice during malaria does not cause increased susceptibility.

(A) TNF concentration in plasma of Pc-infected Ahr (n = 5) and Ahr (n = 3) mice at 8 DPI. (B) Survival and (C) BUN levels in Pc-infected Ahr and Ahr mice (n = 4–5 per condition) after treatment with either anti-TNF neutralizing antibody or isotype control. These experiments were performed once.

To more broadly test the role of AHR in the cellular immune response to malaria, we generated bone marrow chimeric mice. After transplantation and engraftment, chimeric mice had >85% replacement of all measured cell types except for T cells, which averaged 75% donor-derived (Figure 5—figure supplement 3). Chimeric mice lacking AHR in radiosensitive cells (- → +) had equivalent survival and parasitemia to wild-type chimeric mice (+ → +) (Figure 5A–B). In contrast, mice lacking AHR in radioresistant cells (+ → - and - → -) succumbed to infection and developed higher parasitemia relative to + → + mice (Figure 5A–B). We also looked for evidence of heme dysregulation and AKI in susceptible mice. At 8 DPI, + → - and - → - mice had elevated levels of both plasma heme and BUN compared to + → + mice, while - → + mice did not (Figure 5C–D). Therefore, during Pc infection, AHR in radioresistant cells is necessary to promote survival, limit parasitemia, control plasma heme, and prevent AKI.

Figure 5—figure supplement 3.

Efficiency of bone marrow transplantation measured by flow cytometry on peripheral blood 2 months after transplantation (n = 6–12 per condition).

Data are representative of two independent experiments.

Figure 5.

AHR is required during Pc infection in radioresistant cells.

(A) Survival, (B) parasitemia, and (C) total heme (8 DPI), and (D) BUN (8 DPI) in Pc-infected bone marrow chimeric mice (n = 6–12 per condition). p-Values in A were determined using a log-rank test. p-Values in B-D were determined using a Wilcox test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Data are representative of two independent experiments.

(A) CD11bhiLy6CintLy6G+ neutrophils/μl blood in Pc- infected Ahr and Ahr mice (n = 6 per genotype). (B) Representative FACS plots of mice at 7 DPI with indicated treatment. (C) Neutrophils/μl blood on 7 DPI in Ahr and Ahr mice after treatment with either Ly6G depleting antibody or isotype control (n = 4–5 per genotype). (D) Survival of Pc-infected Ahr and Ahr mice after treatment with either anti-Ly6G depleting antibody or isotype control (n = 4–5 per genotype). These experiments were performed once.

(A) TNF concentration in plasma of Pc-infected Ahr (n = 5) and Ahr (n = 3) mice at 8 DPI. (B) Survival and (C) BUN levels in Pc-infected Ahr and Ahr mice (n = 4–5 per condition) after treatment with either anti-TNF neutralizing antibody or isotype control. These experiments were performed once.

Data are representative of two independent experiments.

AHR is necessary in Tek-expressing cells to control parasitemia, plasma heme, and AKI during Pc infection

During Pc infection, the sequestration of infected RBCs to endothelial cells in the microvasculature leads to endothelial activation and disrupted barrier integrity (Miller et al., 2013). Foreign antigens in the blood interact with endothelial cells, which can promote innate and adaptive immune responses (Danese et al., 2007; Konradt and Hunter, 2018). AHR is also expressed in endothelial cells, where it regulates blood pressure and vascular development (Agbor et al., 2011; Walisser et al., 2005). Due to the intimate interactions between parasites and the endothelium, we hypothesized that AHR may be required in endothelial cells during malaria. We generated Ahr mice, in which AHR is deleted in Tek-expressing cells, including endothelial and hematopoietic cells (Kisanuki et al., 2001; Koni et al., 2001). Ahr mice were more susceptible to malaria than control Ahr mice (Figure 6A) and had elevated parasitemia (Figure 6B). Ahr mice also developed higher plasma heme and BUN than control mice (Figure 6C–D). These experiments reveal that AHR is required in Tek-expressing cells, and previous experiments ruled out a requirement for AHR in radiosensitive cells (Figure 5). Therefore, AHR is necessary in Tek-expressing, radioresistant cells for survival, control of parasitemia, and limiting AKI during Pc infection. Several cell types fit these criteria, including endothelial cells, pericytes, and embryonically derived tissue-resident macrophages (Kisanuki et al., 2001; Koni et al., 2001; Teichert et al., 2017). Our data cannot differentiate between these possibilities.

Figure 6.

AHR is required during Pc infection in Tek-expressing cells.

(A) Survival, (B) parasitemia, (C) plasma heme, and (D) BUN in Pc-infected Ahr and Ahr mice (n = 9 per genotype). p-Values in A were determined using a log-rank test. p-Values in B-D were determined using a two-way ANOVA with FDR correction. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Data are representative of two independent experiments.

Discussion

Altered systemic metabolism is a hallmark of infection. While several studies have dissected the roles of individual metabolic alterations and their effects on infection outcome, the impact of many metabolic changes remains unclear (Clark et al., 2013; Cumnock et al., 2018; Dionne et al., 2006; Ganeshan et al., 2019; Luan et al., 2019; Wang et al., 2018). In this study, we characterized host metabolism during infection by performing metabolomics on mouse plasma during malaria. Like others, we observed extensive reprogramming of host metabolism during infection, with the majority of measured metabolites altered during acute sickness. Mice develop anorexia during acute Pc infection (Cumnock et al., 2018), and we found altered energy metabolism during acute infection, such as decreases in food-derived compounds and increases in lipid subsets including glycerolipids, glycerophospholipids, and sphingolipids (Figure 1D). Compound identification in metabolomics requires known references; therefore, our dataset is biased toward well-studied compounds such as these lipid classes. Nevertheless, we identified nearly 400 metabolites of diverse functions with altered intensity during Pc infection.

We observed that each day of infection is marked by a unique combination of immune, metabolic, and pathological events. We propose that therapeutic interventions must be matched to the appropriate stage of infection. For example, antimalarials may be less effective than anemia-targeting interventions for a patient in the latter half of acute infection when parasitemia has dropped significantly. By linking metabolism to the pathology and immune responses occurring at each stage of infection, we developed a rich dataset that allows interrogation of links between metabolism, immune responses, and host physiology during infection.

To this end, we observed that several heme and tryptophan metabolites reached peak intensity in plasma during acute infection. These metabolites can activate AHR, an immunomodulatory transcription factor; in the absence of AHR, mice develop AKI and succumb to infection. While we hypothesized that AHR functions primarily during acute infection, Ahr mice develop increased parasitemia relative to control mice as early as 4 DPI. Metabolites are likely found at different concentrations in plasma and the functionally relevant microenvironment, which may explain this discrepancy. It is also possible that AHR has distinct roles in early and acute infection, but the effects of increased parasitemia overshadow other AHR-dependent phenotypes. Although the role of kynurenine signaling via AHR is important during certain infection contexts, we observed that survival during malaria under our experimental conditions is kynurenine-independent (Figure 3—figure supplement 2D; Bessede et al., 2014). Our data suggest that survival requires AHR signaling via one or more of AHR’s other endogenous agonists.

While global loss of AHR causes aberrant immune responses, we observed that AHR is dispensable in radiosensitive cells during malaria (Brant et al., 2014); instead, AHR in Tek-expressing radioresistant cells is required to control parasites and plasma heme, preventing AKI and death (Figures 5–6). This phenotype may be dependent on one or more of the multiple cell types that meet these criteria, such as endothelial cells and yolk sac-derived tissue-resident macrophages. Further experimentation is warranted to more precisely identify the relevant cell type(s).

The specific mechanism linking AHR, plasma heme, and AKI is unclear. Ahr mice infected with Pc or P. berghei ANKA show defects in immune responses and parasite control prior to any kidney pathology or defects in heme regulation (Figures 3 and 4, Figure 4—figure supplement 2; Brant et al., 2014). Our data suggest a role for AHR in pathogen recognition and/or innate immune responses in non-hematopoietic cells, two possibilities observed in other contexts (Di Meglio et al., 2014; Moura-Alves et al., 2014). Thus, a simple model suggests that the increased parasitemia in Ahr mice leads to increased hemolysis, in turn causing heme overload and AKI; AHR only functions to control parasite load. This model attributes plasma heme increases in Ahr mice solely to increased parasitemia and hemolysis, which may overlook other contributing factors. Nevertheless, if AKI is simply a function of parasitemia, hemolysis, and plasma heme, then increased parasitemia, caused by any mechanism, would also lead to AKI. Treating AKI during malaria would promote disease tolerance rather than resistance to Plasmodium (Ramos et al., 2019).

Alternatively, we considered a role for AHR in both pathogen control and heme metabolism. This model suggests that Ahr mice have impaired heme metabolism. In fact, we observed proper expression of heme metabolism proteins in the liver and kidney of Ahr mice (Figure 4—figure supplement 2C–D), although failure of infected Ahr mice to upregulate Hrg1 and Slc40a1 in the liver may merit future study. We also did not specifically evaluate radioresistant Tek-expressing cells that contribute to heme metabolism, such as endothelial cells or tissue-resident macrophages (Balla et al., 1993; Petrillo et al., 2018; Soares and Hamza, 2016). Further undermining this model, Ahr and Ahr mice fare equivalently when treated with phenylhydrazine, a model of sterile heme overload (Figure 4—figure supplement 3). While phenylhydrazine treatment recapitulates the acute hemolysis characteristic of malaria, it does not release PAMPs, which may be an important component of the AKI observed in Ahr mice. Overall, our data do not support a role for AHR in heme metabolism.

A third possibility is that AHR functions in kidney-intrinsic protection as well as pathogen control. In Pc-infected Ahr mice, impaired kidney function precedes increased plasma heme (Figure 4B and E). This suggests that the absence of AHR may initially impair kidney function; elevated plasma heme is a result, not a cause, of kidney injury. A strength of this model is that it links heme metabolism and the production of the AHR ligands biliverdin and bilirubin to AHR activation; it also explains the elevation of plasma heme in Pc-infected Ahr mice. Contrary to this model, however, Ahr mice and chimeric mice with Ahr radioresistant cells both develop AKI only after elevation of plasma heme (Figure 5, Figure 6, data not shown). Further studies will be crucial to understand the causal relationship between plasma heme and AKI during Plasmodium infection, as well as the role of AHR in tissue protection.

As our appreciation grows for the contribution of metabolic adaptation to survival of infection, an important priority is to understand the effects of the many metabolic changes that occur during infection. Recent studies have dissected the contribution of specific metabolic alterations to infection outcome (Bambouskova et al., 2018; Clark et al., 2013; Cumnock et al., 2018; Dionne et al., 2006; Ganeshan et al., 2019; Wang et al., 2016; Wang et al., 2018; Weis et al., 2017). Our longitudinal study characterized systemic host metabolism during both sickness and recovery. After observing that host-derived AHR ligands increase in concentration during acute infection, we demonstrated that AHR is critical in endothelial cells to limit parasitemia and control tissue damage during malaria, in addition to its better-established roles in immune cells. Overall, these findings suggest that AKI, a common complication of severe malaria, may be caused by heme toxicity, and that therapeutically targeting AHR and/or heme metabolism, rather than parasites, may improve malaria outcomes without driving drug resistance in Plasmodium. We also expect that other metabolites altered during infection have similarly important biological functions, and these relationships may be a rich area for future study.

Materials and methods

Mice

Mice were housed in the Stanford Research Animal Facility according to Stanford University guidelines. The Stanford Administrative Panel on Laboratory Animal Care approved all mouse experiments. Female mice were used unless otherwise indicated. C57BL/6N mice were from Charles River Laboratories were used for the cross-sectional metabolomics experiment. Ahr mice were originally obtained from Taconic (C57BL/6-Ahr; 9166) and crossed with Ahr mice (C57BL/6NTac; B6-F) to generate Ahr mice. Ahr x Ahr crosses produced Ahr, Ahr, and Ahr mice. For higher yields of Ahr mice, Ahr females were crossed to Ahr males. Female Ido1 and Ido1 mice were obtained from Jax (B6.129-Ido1/J; 005867 and C57BL/6J; 000664).

Ahr mice were generated by crossing C57BL/6J Ahr mice (Ahr/J; 006203) (Walisser et al., 2005) and C57BL/6J Tek mice (B6.Cg-Tg(Tek-cre)12Flv/J; 004128) (Koni et al., 2001). Only male Tek mice were used for breeding.

Infections

Age-matched littermates were separated by genotype and infected at 8–12 weeks old unless otherwise indicated. All Plasmodium chabaudi AJ strain parasites were obtained from the Malaria Research and Reference Reagent Resource Center (MR4) and were tested for contaminating pathogens prior to use. Female passage mice were given intraperitoneal (IP) injections of frozen stocks of Pc-infected RBCs (iRBCs). To measure parasitemia, 2 μl tail blood was collected via tail nicking of restrained mice using sterilized surgical scissors. A thin blood smear was prepared on microscope slides (Globe Scientific 1324), fixed in methanol (Fisher Scientific A454SK-4), and stained with Giemsa (Thermo Fisher Scientific 10092013), and the percentage of iRBCs was counted at 100x magnification. An additional 2 μl blood was diluted in 1 ml of Hanks' Balanced Salt Solution (Fisher Scientific 14185052) to count the number of RBCs/μl blood. Absolute counts were obtained on an Accuri C6 flow cytometer using forward and side scatter. Once parasitemia reached 10–20% (7–9 days), 105 freshly obtained iRBCs diluted in sterile Krebs saline with glucose (KSG; 0.1 M NaCL, 4.6 mM KCl, 1.2 mM MgSO4*7 H20, 0.2% glucose (w/v), pH 7.4) were IP injected into experimental animals. Uninfected control animals were injected with KSG alone.

Cross-sectional infection

Age-matched C57BL/6N mice were purchased from Charles River Laboratories and infected as one cohort. Five infected mice were sacrificed every day post-infection, five uninfected mice were sacrificed on 0 dpi, and two uninfected mice were sacrificed on days 5, 8, 10, 12, 15, 19, and 25 (a total of 19 uninfected samples across infection). Sample collection was performed as follows: After the collection of 4 μl of blood were collected from each animal (2 μl for thin blood smears and 2 μl for RBC counts), animals were euthanized by CO2 inhalation per Stanford University guidelines. Blood was then collected via cardiac puncture into 100 μl of 0.5 M EDTA, pH 8.0. Some of this blood was used for flow cytometry analysis (~5–12 μl), and the remainder was spun for 5 min at 1000 x g to collect plasma for ALT quantification, Luminex, and metabolomics analysis. All samples were stored at −80°C for later processing.

Metabolomics and analysis

100 μl of plasma were sent to Metabolon (http://www.metabolon.com), which performed a combination of gas and liquid chromatography techniques combined with mass spectrometry (GC/LC-MS). A table of 587 detected metabolites was returned with the raw area count, which were normalized by dilution and rescaled to set the median equal to 1 (‘scaled intensity’). Median fold change (MFC) for each metabolite at each timepoint was calculated relative to the median value of uninfected day 0 samples. Next, the greatest magnitude MFC was identified for each metabolite, and metabolites with absolute value MFC <2 were removed from further analysis. Lastly, 364 significantly changed metabolites were identified by comparing the time point with the greatest magnitude MFC to the day 0 time point (adjusted p-value<0.05 by t-test with FDR correction).

Luminex

This assay was performed in the Human Immune Monitoring Center at Stanford University. Mouse 38-plex kits were purchased from eBiosciences/Affymetrix and used according to the manufacturer’s recommendations with modifications as described below. Briefly, beads were added to a 96-well plate and washed in a Biotek ELx405 washer. 60 μl of plasma per sample were submitted for processing. Samples were added to the plate containing the mixed antibody-linked beads and incubated at room temperature for one hour followed by overnight incubation at 4°C with shaking. Cold and room temperature incubation steps were performed on an orbital shaker at 500–600 rpm. Following the overnight incubation, plates were washed as above and then a biotinylated detection antibody was added for 75 min at room temperature with shaking. Plates were washed as above and streptavidin-PE was added. After incubation for 30 min at room temperature a wash was performed as above and reading buffer was added to the wells. Each sample was measured as singletons. Plates were read using a Luminex 200 instrument with a lower bound of 50 beads per sample per cytokine. Custom assay control beads by Radix Biosolutions were added to each well. Each cytokine was normalized to its median value on each plate. Significance was calculated by comparing each infected timepoint to values from uninfected mice across infection.

Flow cytometry

In experiments assessing general immune cell classes in the blood, approximately 10 million cells were plated in FACS buffer (PBS, 0.2% fetal bovine serum (Sigma), 5 mM EDTA). Prior to staining, the cells were incubated in TruStain FcX amntibody (Biolegend) for at least 5 min at 4°C. A cocktail containing the Live/Dead Fixable Blue stain (Fisher L34962) and antibodies against the following antigens was added to the blocked cells: CD71 PerCP-Cy5.5 (clone RI7217), TER-119 PE-Cy7 (TER-119), TCRγδ PE (UC7-13D5), CD19 Brilliant Violet (BV) 785 (6D5), CD3 BV650 (17A2), CD8 BV510 (53–6.7), Ly6G BV421 (1A8), CD4 Alexa Fluor 700 (GK1.5), Ly6C Alexa Fluor 647 (HK1.4), CD335 FITC (29A1.4) (all from Biolegend); CD11b Alexa 780 (M1/70, eBioscience); CD41 BUV395 (MWReg30, BD Biosciences). All stains were performed for 12–15 min at 4°C. 5 μl of CountBright counting beads (Invitrogen) were added to each samples such that absolute counts per μl of blood could be back calculated. Data were acquired on an LSR Fortessa (BD Biosciences) and analyzed using FlowJo 10.0.8r1 (Tree Star). Significance was calculated by comparing each infected timepoint to values from uninfected mice across infection.

Mass spectrometry

The analytes were tryptophan (TRP), kynurenine (KYN), 3-hydroxykynurenine (3HK), kynurenic acid (KA), and quinolinic acid (QA) and the internal standards were tryptophan-d5 (TRP-d5), kynurenine-d4 (KYN-d4), 3-hydroxykynurenine-d3 (3HK-d3), kynurenic acid-d5 (KA-d5), quinolinic acid-d3 (QA-d3).

Individual analyte primary stock solutions (10 mM) were prepared in DMSO (KYN, KA); 0.1% formic acid in water (TRP, QA); or 0.45 N HCl in 0.1% formic acid water (3HK). Intermediate stock solution consisting of five analytes: TRP; KYN; KA; 3HK; QA, was prepared from individual primary stock solutions. This intermediate stock solution was serially diluted with 0.1% formic acid/0.02% L-ascorbic acid in water to obtain a series of standard working solutions which were used to generate the calibration curve. Standard working solutions were prepared freshly for sample analysis. Calibration curves were prepared by spiking 10 µl of each of the standard working solutions into 50 µl of PBS/0.02% ascorbic acid followed by addition of 10 µl internal standard solution consisting of five analytes (25 µM TRP-d5; 5 µM KYN-d4, 3HK-d3, KA-d5; 7.5 µM QA-d3). Because of interference due to endogenous tryptophan and metabolites, calibration curves were not prepared in the same matrix (plasma) as the study samples. Blank charcoal stripped plasma still contained quantifiable amounts of tryptophan and metabolites. A calibration curve was prepared fresh with each set of samples. Calibration curve ranges: for KYN and KA, 1 nM to 10 µM; for 3HK, 2.5 nM to 10 µM; for QA, 5 nM to 10 µM; for TRP, 10 nM to 200 µM.

Fifty µl aliquots of plasma were used for analysis. 10 µl internal standard solution was added to 50 µl plasma aliquot followed by vortexing. 200 µl ice cold solution of methanol/1% acetic acid/0.02% L-ascorbic acid was added to the sample, followed by vortexing, then centrifugation. Supernatant was transferred to a new vial, evaporated to dryness under nitrogen, reconstituted in 50 µl 0.1% formic acid/0.02% ascorbic acid in water and analyzed by LC-MS/MS. L-ascorbic acid and evaporation under nitrogen (N2) gas were used to prevent oxidation. For QA determination, standard samples and plasma samples were diluted 10-fold with 0.1% formic acid/0.02% ascorbic acid in water and 10 µl injected to LC-MS/MS.

All analyses were carried out by positive electrospray LC-MS/MS using an LC-20ADXR Prominence liquid chromatograph and 8030 triple quadrupole mass spectrometer (Shimadzu). HPLC conditions: Atlantis T3 2.1 × 100 mm, 3 µm particle size column was operated at 45°C at a flow rate of 0.25 mL/min. Mobile phases consisted of A: 0.2% formic in water and B: 0.2% formic acid in acetonitrile. Elution profile: initial hold at 0% B for 1 min, followed by a gradient of 0–30% in 6 min, then 30–95% in 2 min, equilibrating back to 0% B; total run time was 13 min. Injection volume was 10 μl.

Selected reaction monitoring (SRM) was used for quantification. Analyte mass transitions were as follows: TRP: m/z 205.0 → m/z 146.0 (quantifier) and m/z 205.0 → m/z 118.0 (qualifier); KYN: m/z 209.0 → m/z 94.1 (quantifier) and m/z 209.1 → m/z 146.0 (qualifier); 3HK: m/z 225.0 → m/z 208.1 (quantifier) and m/z 225.0 → m/z 110.1 (qualifier); KA: m/z 189.9 → m/z 89.1 (quantifier) and m/z 189.9 → m/z 116.1 (qualifier); QA: m/z 167.9 → m/z 78.1 (quantifier) and m/z 167.9 → m/z 105.9 (qualifier). For internal standards: TRP-d5: m/z 210.0 → m/z 150.1; KYN-d4: m/z 213.0 → m/z 98.2; 3HK-d3: m/z 228.0 → m/z 111.1; KA-d5: m/z 195.0 → m/z 121.1; QA-d3: m/z 170.9 → m/z 81.1. Dwell time was 20–30 ms.

Quantitative analysis was done with LabSolutions LCMS software (Shimadzu) using an internal standard approach. Calibration curves were linear (R > 0.99) over the concentration range using a weighting factor of 1/X2 where X is the concentration. The back-calculated standard concentrations were ±15% from nominal values, and ±20% at the lower limit of quantitation (LLOQ).

Longitudinal infection monitoring

Sampling was performed as described previously (Cumnock et al., 2018; Torres et al., 2016) between 7AM-12PM. Temperature was measured by rectal probe (Physitemp Instruments Inc BAT-12 and World Precision Instruments RET-3) and was recorded daily with weight. Mice were restrained and approximately 16 μl of tail blood was collected as described above. Thin blood smears were generated using 2 μl blood, and parasitemia and RBCs/μl blood were measured as described above. Parasite density was calculated by multiplying the percent parasitemia from the blood smears by the daily RBC counts. An additional 12 μl blood was collected for other purposes. Tails were bled gently to prevent hemolysis from pressure. Age-matched mice were sampled as described except that only 4 μl blood was collected (2 μl for parasitemia, 2 μl for measuring anemia).

Histology

Mice were euthanized and portions of liver, kidney, lung, and spleen were harvested for histology, fixed in 10% formalin (VWR 50-420-850), routinely processed, embedded in paraffin, sectioned, and stained with hematoxylin and eosin and Perls Prussian blue as indicated. Blinded slides were evaluated by a veterinary pathologist using an Olympus BX43 upright brightfield microscope. Photomicrographs were captured using an Olympus DP27 camera and the Olympus cellSens software.

RNA isolation and qRT-PCR

Mice were euthanized at the indicated timepoints. When indicated, perfusion was performed by cutting the vena cava and slowly introducing 10 ml of cold PBS into circulation via the heart. Tissues were dissected, snap-frozen in liquid nitrogen, and transferred to −80°C. RNA was isolated from thawed tissue (30–50 mg) using the RNeasy Mini kit (Qiagen 74104) and treated with DNAse (Qiagen 79256). cDNA was synthesized from 1 μg of RNA using SuperScript III First-Strand synthesis system (Fisher Scientific 18-080-051). Transcripts were amplified using FastStart Universal SYBR Green Master (Rox; Millipore Sigma 04913850001) and gene-specific primers (Table 1).

Table 1.

qRT-PCR primers used in this study.

Gene	Forward primer	Reverse primer	Source
Hp	GCTATGTGGAGCACTTGGTTC	CACCCATTGCTTCTCGTCGTT	PrimerBank 8850219a1
Hpx	AGCAGTGGCGCTAAATATCCT	CCATTTTCAACTTCGGCAACTC	PrimerBank 23956086a1
Hrg1	GACGGTGGTCTACCGACAAC	TCCTCCAGTAATCCTGCATGTA	PrimerBank 13385856a1
Hmbs	AAAGTTCCCCAACCTGGAAT	CCAGGACAATGGCACTGAAT
Hmox1	AAGGAGGTACACATCCAAGCCGAG	GATATGGTACAAGGAAGCCATCACCAG	Ramos et al., 2019
Fth	CCATCAACCGCCAGATCAAC	GCCACATCATCTCGGTCAAA	Ramos et al., 2019
Mfsd7b	TCTTCAGCCTTTACTCGCTGG	GAAGTCCTCGAACACGTTGCT	PrimerBank 124486924 c1
Mfsd7c	GGAGAAAGCGATTAGAGAAGGC	CTGATGGCTGCATTTCACAGT	PrimerBank 26340226a1
Slc40a1	TGCCTTAGTTGTCCTTTGGG	GTGGAGAGAGAGTGGCCAAG	Ramos et al., 2019
Tfrc	GTTTCTGCCAGCCCCTTATTAT	GCAAGGAAAGGATATGCAGCA	PrimerBank 11596855a1
Msp1	ACTGAAGCAACAACACCAGC	GTTGTTGATGCACTTGCGGGTTC	Cheesman et al., 2006
Havcr1	TGGTTGCCTTCCGTGTCTCT	TCAGCTCGGGAATGCACAA	Kulkarni et al., 2014
Lcn2	TGGCCCTGAGTGTCATGTG	CTCTTGTAGCTCATAGATGGTGC	PrimerBank 1019908a1
Arbp0	CTTTGGGCATCACCACGAA	GCTGGCTCCCACCTTGTCT	Ramos et al., 2019

Western blotting

Dissected tissues were snap-frozen in liquid nitrogen and transferred to −80°C. Approximately 100 mg of tissue was homogenized in RIPA buffer (50 mM Tris pH 8.0, 150 mM NaCl, 0.1% SDS (w/v), 0.5% sodium deoxycholate (w/v), 1% Triton X-100 (v/v)) with 1X protease inhibitors (Millipore Sigma 11836170001). Total protein content was measured by Bradford (Fisher Scientific PI23200) and 25 μg protein was diluted in 1X Laemmli Sample Buffer (Bio-Rad 1610747) containing β-mercaptoethanol. Samples were incubated at 95°C for 5 min, separated by SDS-PAGE on 4–12% polyacrylamide gels (Thermo Fisher Scientific NP0323BOX) and transferred to PVDF membranes (Bio-Rad 1704156) using the TransBlot Turbo System (Bio-Rad). Membranes were blocked in 5% nonfat milk dissolved 1X PBS (1 g NACl,. 2 g KCl, 1.44 g Na2HPO4 dibasic,. 24 g KH2PO4 monobasic dissolved in 1 L water, adjusted pH to 7.4 and autoclaved) containing 0.1% Tween-20 (Millipore Sigma P1379) at room temperature for 1 hr. Membranes were incubated with primary antibodies against HO-1 (Abcam ab52947, 1:2000), FTH (Abcam ab183781, 1:2000), DMT1 (Abcam ab55735, 1:400), HCP1 (Abcam ab25134, 1:1000), and β-Actin (Sigma A1978, 1:2000) overnight at 4°C, washed with PBST, and incubated with anti-rabbit IgG-HRP (Sigma GENA934, 1:10,000) or anti-mouse IgG-HRP (Bio-Rad 1706516, 1:3000) for 1 hr at room temperature. Membranes were again washed with PBST and HRP signal was detected using SuperSignal West Femto Chemiluminescent Substrate (Fisher Scientific PI34095) on a ChemiDoc imager (Bio-Rad).

Quantification of tissue injury markers and plasma compounds

Blood from cardiac punctures or tail bleeds were processed into plasma as described above. In the cross-sectional infection experiment, ALT was measured on a Dimension Xpand analyzer (Siemens). A medical technologist performed all testing and reviewed all data. For all other experiments, bilirubin, ALT, and BUN were measured using kits (bilirubin by Millipore Sigma MAK126-1KT, ALT by Millipore Sigma MAK052-1KT, and BUN by Fisher Scientific 50-107-8333). Plasma samples for bilirubin were collected in the dark and measured within 5 hr to minimize UV degradation (Rehak et al., 2008). Heme in plasma and urine were measured as described previously (Ramos et al., 2019). Plasma and urine were diluted between 1:1000 and 1:25 in water. 150 μl formic acid (Millipore Sigma F0507-100ML) was added and absorbance was measured at 405 nm. Urine samples were also measured at 355 nm and background absorbance was corrected using the formula λ405nm = λ405nmx (λ405nm/λ355nm). Absorbance was compared to a standard curve of hemin (Millipore Sigma H9039-1G) at 0,. 5, 1, 5, 10, and 20 uM. Day 0 samples were excluded from heme analyses if visual inspection revealed hemolysis caused by the bleeding process; this did not occur on subsequent bleeding. Values from cardiac puncture blood were corrected for the percentage of EDTA in the total volume of the cardiac puncture.

Bone marrow chimeras

CD45.1 Ahr (B6.SJL-Ptprc/BoyAiTac; 4007 F), CD45.2 Ahr (C57BL/6NTac; B6-F), and CD45.2 Ahr mice were lethally irradiated (2 × 6 Gy, 6 hr apart) at 5–7 weeks of age. Bone marrow from donor CD45.1 Ahr and CD45.2 Ahr mice was delivered by tail vein injection 1 hr after the second radiation dose. Mice were maintained for 2 weeks on autoclaved food and water containing 2 mg/ml neomycin sulfate (VWR 89149–866) and 1000 U/ml polymyxin B (Millipore Sigma P4932-5MU). Bone marrow engraftment was assessed 8 weeks after transplantation by processing 10 μl of tail vein blood as described above and staining with Live/Dead Fixable Blue stain (Fisher L34962) and the following antibodies: CD45.2 PerCP-Cy5.5 (Fisher/Invitrogen 45-0454-80), NK-1.1 FITC (Biolegend 108706), CD11c PE-Cy7 (Fisher/Invitrogen 25-0114-82), CD45.1 PE (Biolegend 110707), CD19 BV 785 (Biolegend 115543), CD3 BV 650 (Biolegend 100229), CD8a BV 510 (Biolegend). Mice were infected 9 weeks after transplantation. Sampling was performed as described in Longitudinal infection monitoring with the following modification: 12 μl of blood for BUN and heme quantification was collected on day 0, and 7–9 only. Flow panel used for validation.

Phenylhydrazine treatment

Phenylhydrazine (Sigma Aldrich P26252-100G) was dissolved in sterile PBS immediately before treatment. Mice were I.P. injected with 0.1 mg/g phenylhydrazine in 100 μl.

RNA-seq

Liver RNA was purified using TRIzol (Fisher 15596026). cDNA libraries were prepared using a TruSeq RNA Library Prep Kit v2 (Illumina RS-122–2001) with 500 ng RNA as input. A HiSeq 4000 (Illumina) was used for sequencing, with a paired-end sequencing length of 75 bp. Sequencing data can be accessed at GSE 150268.

Neutrophil depletion

Mice were IP injected with 250 μg of either anti-Ly6G clone 1A8 (Bio X Cell BE0075-1) or IgG2a isotype control (Bio X Cell BE0089) in 100 μl of sterile PBS on 5, 6, and 7 DPI. Each day, approximately 16 μl of tail blood was collected for assorted analyses, including flow cytometry as described above. Because treatment with Ly6G interferes with detection of neutrophils, we defined neutrophils as CD11bhiLy6CintLy6G+ using a gating strategy as described previously (Shi et al., 2011).

TNF neutralization

Plasma TNF was measured by ELISA (Fisher BMS607-3). To neutralize TNF, mice were IP injected with 500 μg anti-TNF clone XT3.11 (Bio X Cell BP0058) or IgG1 isotype control (Bio X Cell BE0088) in 100 μl of sterile PBS on 7 DPI.

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

This is a thorough time-resolved metabolomics study of mouse plasma over a 25-day course of Plasmodiumchabaudi infection. The data point to the key role of Ahr in mediating protection against acute kidney injury in a mouse model of malaria. Using untargeted metabolomics, they revealed that Ahr agonists including bilirubin, biliverdin and tryptophan metabolites are increased during infection in both mice and human patients. Using an mouse, they show that Ahr is necessary for protection from Plasmodium infection and that this protection is associated with acute kidney injury.

Decision letter after peer review:

Thank you for submitting your article "Metabolic profiling during malaria reveals the role of the aryl hydrocarbon receptor in regulating kidney injury" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by Dominique Soldati-Favre as the Senior and Reviewing Editor. The reviewers have opted to remain anonymous.

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

All three agree that this is a major step forward. However, all of them raise important points that need to be addressed in a revised version (with a point by point rebuttal letter), before a final decision can be reached. The points re detailed in the individual reviews below.

Most importantly the reviewers request to improve the presentation of the work, to have a more detailed Discussion and to consider alternatives to the model. While some additional experiments would make it a richer manuscript, I think with good edits on the manuscript, during the pandemics new experiments could be omitted.

In this context we would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). Specifically, when editors judge that a submitted work as a whole belongs in eLife but that some conclusions require a modest amount of additional new data, as they do with your paper, we are asking that the manuscript be revised to either limit claims to those supported by data in hand, or to explicitly state that the relevant conclusions require additional supporting data.

Our expectation is that the authors will eventually carry out the additional experiments and report on how they affect the relevant conclusions either in a preprint on bioRxiv or medRxiv, or if appropriate, as a Research Advance in eLife, either of which would be linked to the original paper.

Summary:

This is a thorough time-resolved metabolomics study of mouse plasma over a 25-day course of Plasmodiumchabaudi AJ (Pc) infection. The authors observe that the vast majority of metabolic alterations occur around the peak of parasitemia (acute phase), between days 5 to 10 post-infection, which coincides with the peak of hemolysis. They establish some solid parallels to human pediatric malaria as far as changes in metabolism are concerned, thereby lending credence to the use of Pc infection in mice as an experimental model of malaria with relevance to the human disease. They report how the Ahr is necessary for mediating protection against acute kidney injury in a mouse model of Plasmodium. Using untargeted metabolomics, they revealed that Ahr agonists including bilirubin, biliverdin and tryptophan metabolites are increased during infection in both mice and human patients. Using an Ahr mouse, they show that Ahr is necessary for protection from Plasmodium infection and that this protection is associated with acute kidney injury.

Essential revisions:

Reviewer #1:

Some of the conclusions drawn are not yet fully supported by the data, and important questions remain to be addressed, which would increase the overall value of this interesting study.

1) Related to Figure 3: In the third paragraph of the subsection “Malaria is characterized by stages with unique immune, metabolic, and tissue damage events”, please explain why the plasma heme level is decreased in acute infection phase. The authors show, using metabolomics, that heme levels in the plasma of Pc infected mice during the acute phase are lower than in uninfected controls (which should have virtually 0 heme in the plasma) (Figure 1H). Later, using a formic acid method, milimolar levels of heme were detected in the plasma of Pc infected mice in the acute phase (Figures 4E, 5C, 6C). This is contradictory to data in Figure 1H, and there is a wealth of data showing that heme concentration is elevated in the plasma during peak of Plasmodium infection, presumably due to intravascular hemolysis. Were the samples used for metabolomics treated/sampled in any way that could preclude heme mass detection? Were the mass spectrometers configured/setup in a way where heme mass could be detected? Please address.

2) The causal relationship between plasma heme and RBC counts warrants further investigation, and if this is not possible under the current circumstances, a more detailed Discussion could be provided.

3) Related to Figure 4—figure supplement 3: Although the hemolysis model used showed no apparent difference in lethality between AhR and AhR mice, at the PHZ dose used all the AhR mice succumbed and this might have masked a possible pathogenic effect of AhR deletion in this experimental model. The authors could use a sub-lethal dose of PHZ to allow the AhR or AhR mice to recover from the hemolysis and anemia (usually within day 12 post injection), monitor plasma heme, iron, RBCs count and kidney injury. If the AhR mice have a heme/iron recycling defect there should be an increase in heme accumulation in plasma, presumably explaining a similar observation during Pc infection.

4) Related to Figure 6: The authors conclude that AhR expression in the endothelium is responsible for the protective effect of AhR in Pc infection, based on bone marrow chimera and conditional AhR KO experiments, used to rule out hematopoietic (radiosensitive) cells, and to identify Tie2-expressing cells as responsible for the protection effect. Nevertheless, Tie2 also drives the expression of the Cre recombinase in subsets of yolk-derived tissue-resident macrophages (see https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2938310/), which are likely radioresistant and therefore cannot be ruled out entirely. The authors should address this point. Better characterisation of the cells expressing AhR, for example in the kidney, would be useful to address where the expression of this receptor may be operational to prevent the onset of AKI.

Reviewer #2:

In previous work by other groups, it's been suggested that heme increases in plasma and urine during Plasmodium infection in mice and that this increase in heme causes AKI. In the work presented by Schneider and colleagues, they show that heme plasma levels decrease and the metabolites increase. In their Ahr model, they do see an increase in plasma (but not urine) heme at day 8 post infection, but given the kinetics of this in relation to the AKI in their model, I suggest that the heme accumulation occurs secondary to AKI and possibly as a result of the AKI, and not that heme accumulation drives AKI. The authors did a very detailed analysis on characterizing heme. They do not see increased heme in urine, they do not see increased iron containing deposits in kidneys, they see basically no differences in Hmox or Fth in the kidney and no difference in plasma heme until after the AKI appears. The authors conclude that Ahr protects from AKI by detoxifying heme, but I do not think their data support this model. What this indicates is that the authors have potentially revealed a novel relationship between heme metabolism, Ahr and AKI in the context of a Plasmodium infection. This is important because most of the work in the Plasmodium field forces the model that heme detoxification is the answer for every Plasmodium phenotype relating to heme. This work suggests something different and exciting.

One possibility that the authors do not seem to consider is that Ahr is necessary for a tissue protective response that protects from AKI. For example, bilirubin, biliverdin and Ahr all exhibit antioxidant properties. One possibility is that the heme metabolites are necessary to signal through Ahr to promote these antioxidant responses that protect from AKI. Similarly, this signaling pathway may be mediating anti-inflammatory responses that protect from AKI. There are likely clues to possible tissue protective responses in their RNAseq data. Is there anything in their data set to suggest such a model?

In summary, I think the data are very interesting and robust, but I would like to see the authors consider the presentation of their work and whether there is a model that better fits with the data they presented. I think there is.

Reviewer #3:

In this manuscript by Lissner et al., authors share the results of an extensive well-executed analysis on the role of AHR receptors in progression of malaria. The project has a large scale and a broad scope encompassing genetic, metabolic, clinical, histopathologic and cellular studies. While this generates massive amounts of data that will be useful for researchers in this field, often times authors lose focus moving from one set of experiments to another and the continuity of story gets disrupted. Authors' claim about the kidney protective role of AhR is very convincing with carefully carried out knock out, heterozygous and WT experiments. On the other hand, majority of metabolomic analyses only point out the consequences of the known fact that malaria generates hemolysis and heme is released as a by-product. Furthermore, comparisons of CM and Pc is misleading and should be avoided as I mentioned in detail in relevant section of my comments. Endothelial cell based AHR expression being critical in AHR mediated protection is the most interesting section of the paper as it finally points out the attention to a single focus so it would have been nice if authors went deeper following that lead. This paper would benefit from a rewrite connecting the loose ends into a continuous story.

Introduction, second paragraph: I recommend using WHO data to refer to the up to date global disease burden of malaria rather than a manuscript published in 2012. WHO annually releases malaria reports (world malaria report) and these may provide more up to data and more widely accepted numerical values.

Introduction, second paragraph: I recommend removing the vague statement: "much is known about how immune responses affect malaria outcome".

Introduction, fourth paragraph: Referring Plasmodiumberghei as rodent malaria parasite that causes lethal cerebral malaria, while not incorrect, might be misleading. The only reference that mentions P. berghei among cited after this sentence is Brant et al. and there, it is used as P. berghei ANKA which is the sub-strain that causes Experimental Cerebral Malaria (ECM) in susceptible mice. P. berghei NK65, another sub-strain that is very closely related P. berghei ANKA never results in ECM. Please use the full strain name P. berghei ANKA.

Figure 1A: While no revision is required, hemoglobin measurements instead of RBC counts is a better way to monitor anemia.

Subsection “Malaria is characterized by stages with unique immune, metabolic, and tissue damage events”, fourth paragraph and Figure 1I-J: Comparison of Pc with human CM patients is not substantiated. First of all, Pc is an uncomplicated malaria causing rodent parasite. CM on the other hands is the most lethal complication for both human and mouse (ECM) malaria. I recommend removing this data set since a more reasonable comparison would have been non-complicated human Pf vs. mouse Pc or Human CM vs. mouse Pb ANKA. Unless authors wish to offer these comparisons instead, there is no value of Pc vs. CM comparison other than that they both cause hemolysis simply because of being intra RBC microorganisms that are destroying RBCs in order to spread. Pc is never used to recapitulate human CM. This parasite only recapitulates the immunity development angle of human malaria with antibodies and such. This entire paragraph and relevant figures need to be reworded. Rest of Figure 1 is informative and well carried out experiments.

Subsection “AhR ligands are more abundant during acute infection”, first paragraph: Please change to Pb ANKA (refer to my comment above).

Subsection “AhR signaling is protective during Pc infection”, first paragraph: This is an interesting finding. Gender bias has always been mentioned in mouse malaria experiments but has not been properly documented. This is a useful information.

Figure 4: Authors should discuss why they only focused kidney but not the other organs. Spleen, lung and liver may show damages related to sequestration, intravascular hemolysis, side products, cytokines and anemia. This needs to be discussed.

Figures 5 and 6: Figure 5 does not add much to the story since it only says that radiosensitive cells do not contribute to the AhR mediated protection. Yet it still sets the stage for Figure 6. I would shorten that part and put more emphasis on Figure 6. I found Figure 6 to be very informative focusing the attention onto endothelial cells. The endothelial cell specific knock out really has potential to generate high quality original data, however authors cut that story short by only limiting the analyses to 4 major parameters. Extending that section with more sophisticated analyses would make the manuscript more complete.

Materials and methods section: age of a mouse has a significant impact on disease progression. Therefore, age matching is critical. Authors should include a statement regarding to age matching practice between control and experimental groups, otherwise 8-12 weeks is a relatively broad range for this particular experimental model.

Essential revisions:

Reviewer #1:

Some of the conclusions drawn are not yet fully supported by the data, and important questions remain to be addressed, which would increase the overall value of this interesting study.

1) Related to Figure 3: In the third paragraph of the subsection “Malaria is characterized by stages with unique immune, metabolic, and tissue damage events”, please explain why the plasma heme level is decreased in acute infection phase. The authors show, using metabolomics, that heme levels in the plasma of Pc infected mice during the acute phase are lower than in uninfected controls (which should have virtually 0 heme in the plasma) (Figure 1H). Later, using a formic acid method, milimolar levels of heme were detected in the plasma of Pc infected mice in the acute phase (Figures 4E, 5C, 6C). This is contradictory to data in Figure 1H, and there is a wealth of data showing that heme concentration is elevated in the plasma during peak of Plasmodium infection, presumably due to intravascular hemolysis. Were the samples used for metabolomics treated/sampled in any way that could preclude heme mass detection? Were the mass spectrometers configured/setup in a way where heme mass could be detected? Please address.

We apologize for a typo in the manuscript – the line should read “…acute Pc malaria is characterized by stable plasma heme levels…” and has been fixed. Figure 1H demonstrates that heme levels don’t decrease until late infection. Apart from our error, the reviewer also notes discrepancies in heme concentrations between figures. In Figure 1H, we report plasma heme from uninfected and infected wild-type C57BL/6 mice; levels in infected mice are statistically comparable to uninfected mice during acute infection. Figures 4E, 5C, and 6C quantify plasma heme in control and AhR mice. In control mice, plasma heme remains similar to baseline levels (Figures 4E, 6C). Only in susceptible AhR mice, AhR mice, or chimeric mice with AhR radioresistant cells does plasma heme reach the millimolar levels pointed out by the reviewer. The appropriate comparison is infected mice from Figure 1H with infected control mice from the later figures (AhR mice, AhR mice, and chimeric mice with AhR radioresistant cells). This comparison reveals that control or wild-type mice from Figures 1H, 4E, 5C, and 6C all have heme levels similar to uninfected mice during acute infection. We do not see a contradiction in these data.

The reviewer also mentions that heme concentration is elevated in plasma during the peak of Plasmodium infection. While plasma heme concentration surely varies by model, our data indicates that increased plasma heme is not a universal feature of malaria—indeed, acute Pc infection in C57BL/6 mice does not lead to significantly increased plasma heme. We speculate that uncomplicated malaria may not lead to increased plasma heme; rather, plasma heme increases may be a cause and/or symptom of complicated malaria. Our study demonstrates that increased plasma heme during malaria can lead to pathology and we believe that the factors underlying this increase merit further study.

2) The causal relationship between plasma heme and RBC counts warrants further investigation, and if this is not possible under the current circumstances, a more detailed Discussion could be provided.

We agree with the reviewer that the relationship between RBC density and plasma heme is ripe for exploration. RBC counts and plasma heme are certainly related, as hemolysis releases heme into plasma. The relationship is not linear, however, since plasma heme levels are affected by both heme release into plasma and the multiple processes that remove heme from plasma, such as intracellular heme metabolism by HO-1. These pathways minimize plasma heme in control AhR mice during Pc infection (Figure 4E), despite substantial decreases in RBC density relative to baseline (Figure 3C). We believe the reviewer is interested in why this relationship breaks down in AhR mice, an interest that we share.

We did not observe a large defect in heme metabolism in AhR mice, through gene expression, protein analyses, and Phz-induced heme overload (Figure 4—figure supplement 2C, D, Figure 4—figure supplement 3). As the reviewer points out later, Pc-infected AhR mice fail to upregulate Hrg1 and Slc40a1 in the liver, two heme transporters which may affect plasma heme levels (Figure 4—figure supplement 2D). On the other hand, if AhR-dependent regulation of these genes affected heme overload, Phz treatment should cause different plasma heme levels or sensitivity in AhR and AhR mice, which we did not observe (Figure 4—figure supplement 3). We did find that AhR mice have slightly decreased RBC density than controls (Figure 3C); however, we suspect that this relatively minor difference is unlikely to cause the substantially increased plasma heme (Figure 4E).

We agree with the reviewer that the relationship between plasma heme and hemolysis during malaria is critical for the field to sort out. We have added clarifying sentences to the Discussion, where we propose several models that discuss hemolysis, plasma heme, and AKI (Discussion, fifth paragraph). We have also proposed an additional model, as mentioned by reviewer #2, that our data may also support (Discussion, sixth paragraph). We agree with the reviewers that further experimentation will be required differentiate between these possibilities, but believe that these studies are outside the scope of this manuscript.

3) Related to Figure 4—figure supplement 3: Although the hemolysis model used showed no apparent difference in lethality between AhR+/+ and AhR-/- mice, at the PHZ dose used all the AhR+/+ mice succumbed and this might have masked a possible pathogenic effect of AhR deletion in this experimental model. The authors could use a sub-lethal dose of PHZ to allow the AhR+/+ or AhR+/- mice to recover from the hemolysis and anemia (usually within day 12 post injection), monitor plasma heme, iron, RBCs count and kidney injury. If the AhR+/- mice have a heme/iron recycling defect there should be an increase in heme accumulation in plasma, presumably explaining a similar observation during Pc infection.

The reviewer is right that the lethal dose we chose may obscure the effect of AhR loss on Phz sensitivity. However, we selected this dose because it results in plasma heme levels that are comparable to what we observe in AhR mice infected with Pc, and at a similar time scale (plasma heme increases to above 1000 μm within one day). These features, we reasoned, faithfully recapitulate the hemolysis caused by malaria. While a lower dose would cause less lethality, it would also not model this aspect of malaria. Furthermore, we monitored several factors in response to Phz treatment in addition to survival, including plasma heme and kidney function, and did not see a difference in susceptibility in any metric. Due to these reasons, and experimental challenges imposed by the pandemic, we did not perform the experiment the reviewer suggested.

4) Related to Figure 6: The authors conclude that AhR expression in the endothelium is responsible for the protective effect of AhR in Pc infection, based on bone marrow chimera and conditional AhR KO experiments, used to rule out hematopoietic (radiosensitive) cells, and to identify Tie2-expressing cells as responsible for the protection effect. Nevertheless, Tie2 also drives the expression of the Cre recombinase in subsets of yolk-derived tissue-resident macrophages (see https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2938310/), which are likely radioresistant and therefore cannot be ruled out entirely. The authors should address this point. Better characterisation of the cells expressing AhR, for example in the kidney, would be useful to address where the expression of this receptor may be operational to prevent the onset of AKI.

We agree with the reviewer on this point and originally alluded to the fact that tissue-resident macrophages also fit the criteria of radioresistant Tie2-expressing cells. While future experiments to identify the Tie2-expressing radioresistant cells at play in this phenotype, we believe that such work is outside of the scope of this manuscript and should be addressed in future studies. However, we agree with the reviewer that clarification around this issue is necessary in the manuscript. We have provided more detail in the subsection “AHR is necessary in Tek-expressing cells to control parasitemia, plasma heme, and AKI during Pc infection” and throughout the Discussion.

Reviewer #2:

[…] One possibility that the authors do not seem to consider is that Ahr is necessary for a tissue protective response that protects from AKI. For example, bilirubin, biliverdin and Ahr all exhibit antioxidant properties. One possibility is that the heme metabolites are necessary to signal through Ahr to promote these antioxidant responses that protect from AKI. Similarly, this signaling pathway may be mediating anti-inflammatory responses that protect from AKI. There are likely clues to possible tissue protective responses in their RNAseq data. Is there anything in their data set to suggest such a model?

In summary, I think the data are very interesting and robust, but I would like to see the authors consider the presentation of their work and whether there is a model that better fits with the data they presented. I think there is.

We think the reviewer has raised a very insightful point. In the first model we proposed, AhR functions exclusively in pathogen control, and we have added sentences to clarify this point (Discussion, fifth paragraph). This model suggests that, in the absence of AhR, parasitemia is increased as early as 4 DPI (Figure 3A), leading to more hemolysis in AhR mice (Figure 3C). Despite equivalent plasma heme concentrations, intracellular heme concentrations could nevertheless be elevated in renal proximal tubule epithelial cells, which import and metabolize heme during malaria and are sensitive to heme toxicity (Ramos, 2019). This could explain impaired kidney function at 7 DPI (Figure 4B) despite equivalent plasma heme (Figure 4E).

In the second model we considered, AhR functions in both pathogen control and heme metabolism. We believe that our data do not support this model, as we did not detect any major deficits in heme metabolism in AhR mice. Nevertheless, we remained unable to pinpoint the source of such extremely elevated plasma heme (Discussion, sixth paragraph).

The reviewer suggests a third possibility in which AhR is required for both pathogen control and tissue protection in the kidney. This model orients elevated plasma heme as a consequence, rather than the initial cause, of impaired kidney function. Particularly tantalizing is the role of the heme metabolites bilirubin and biliverdin in activating AhR, suggesting a possible feedback loop in which AhR is activated by heme metabolism to protect from heme toxicity. As an important caveat to this model, impaired kidney function is observed prior to elevated plasma heme in AhR mice (Figure 4B, E), but not in AhR mice (Figure 6C, D) or chimeric mice with AhR radioresistant cells (Figure 5, longitudinal data not shown). Whether this is biologically relevant or simply an artifact of different mouse models will have important implications, since the relative timing of heme elevation and kidney impairment is critical. While we do not believe that our RNA-seq data, a time-course analysis of wild-type livers during Pc infection, provide insight into this pathway, we agree that the role of kidney-intrinsic AhR signaling during Pc infection merits further investigation. We are grateful to the reviewer for this insight and have included further discussion of each model in the Discussion. Additionally, when we previously referred to “heme-mediated AKI” in the manuscript, we now refer to the development of high plasma heme and AKI without any causal implications.

Reviewer #3:

In this manuscript by Lissner et al., authors share the results of an extensive well-executed analysis on the role of AHR receptors in progression of malaria. The project has a large scale and a broad scope encompassing genetic, metabolic, clinical, histopathologic and cellular studies. While this generates massive amounts of data that will be useful for researchers in this field, often times authors lose focus moving from one set of experiments to another and the continuity of story gets disrupted. Authors' claim about the kidney protective role of AhR is very convincing with carefully carried out knock out, heterozygous and WT experiments. On the other hand, majority of metabolomic analyses only point out the consequences of the known fact that malaria generates hemolysis and heme is released as a by-product. Furthermore, comparisons of CM and Pc is misleading and should be avoided as I mentioned in detail in relevant section of my comments. Endothelial cell based AHR expression being critical in AHR mediated protection is the most interesting section of the paper as it finally points out the attention to a single focus so it would have been nice if authors went deeper following that lead. This paper would benefit from a rewrite connecting the loose ends into a continuous story.

Introduction, second paragraph: I recommend using WHO data to refer to the up to date global disease burden of malaria rather than a manuscript published in 2012. WHO annually releases malaria reports (world malaria report) and these may provide more up to data and more widely accepted numerical values.

We thank the reviewer for this insight and have made the change suggested.

Introduction, second paragraph: I recommend removing the vague statement: "much is known about how immune responses affect malaria outcome".

We have made the suggested change.

Introduction, fourth paragraph: Referring Plasmodium berghei as rodent malaria parasite that causes lethal cerebral malaria, while not incorrect, might be misleading. The only reference that mentions P. berghei among cited after this sentence is Brant et al. and there, it is used as P. berghei ANKA which is the sub-strain that causes Experimental Cerebral Malaria (ECM) in susceptible mice. P. berghei NK65, another sub-strain that is very closely related P. berghei ANKA never results in ECM. Please use the full strain name P. berghei ANKA.

The reviewer raises a very good point and we have made this change throughout the manuscript.

Figure 1A: While no revision is required, hemoglobin measurements instead of RBC counts is a better way to monitor anemia.

We understand the reviewer’s point and agree that hemoglobin measurements offer complementary information.

Subsection “Malaria is characterized by stages with unique immune, metabolic, and tissue damage events”, fourth paragraph and Figure 1I-J: Comparison of Pc with human CM patients is not substantiated. First of all, Pc is an uncomplicated malaria causing rodent parasite. CM on the other hands is the most lethal complication for both human and mouse (ECM) malaria. I recommend removing this data set since a more reasonable comparison would have been non-complicated human Pf vs. mouse Pc or Human CM vs. mouse Pb ANKA. Unless authors wish to offer these comparisons instead, there is no value of Pc vs CM comparison other than that they both cause hemolysis simply because of being intra RBC microorganisms that are destroying RBCs in order to spread. Pc is never used to recapitulate human CM. This parasite only recapitulates the immunity development angle of human malaria with antibodies and such. This entire paragraph and relevant figures need to be reworded. Rest of Figure 1 is informative and well carried out experiments.

We thank the reviewer for this point. We agree that uncomplicated malaria caused by Pc and CM caused by P. falciparum are considerably different types of malaria and cannot be substituted for each other. In this sense, it is surprising that the plasma metabolomes are so similar (Figure 1I)! On the other hand, Pc and Pf are closely-related species that cause infections with many similar features, such as massive RBC destruction and systemic immune activation, as the reviewer points out.

Our mouse model of Pc-infected wild-type mice is most similar to uncomplicated Pf malaria, and the reviewer correctly suggests that an uncomplicated malaria dataset would be best for our comparative analysis. However, analysis is challenged by the fact that large untargeted metabolomics datasets are relatively rare, compared to targeted analysis; and when untargeted metabolomics analysis has been employed in the past, technical limitations at the time resulted in the identification of relatively few metabolites. For example, the most detailed dataset meeting the reviewer’s specifications that we have examined focused on uncomplicated Pf- or P. Vivax infected patients (found under MTBLS664). That study identified less than a third of the molecules found in our study (190 vs. 587 metabolites), and none of the heme-related metabolites that we discuss.

Metabolomics datasets that capture the ideal type of malaria in adequate detail remain elusive. For this reason, we performed our comparative analysis using metabolomics data from CM patients, which identified 432 metabolites. The reviewer is correct that a more ideal comparison would be preferable. However, given the limited data availability and the general similarities of malaria caused by all Plasmodium species, we disagree that the comparison is inappropriate. We have added a sentence to clarify the limitations of our analysis in the subsection “Malaria is characterized by stages with unique immune, metabolic, and tissue damage event”.

Subsection “AhR ligands are more abundant during acute infection”, first paragraph: Please change to Pb ANKA (refer to my comment above).

We have made this change.

Subsection “AhR signaling is protective during Pc infection”, first paragraph: This is an interesting finding. Gender bias has always been mentioned in mouse malaria experiments but has not been properly documented. This is a useful information.

We agree with the reviewer that gender bias in malaria is a rich area for future research.

Figure 4: Authors should discuss why they only focused kidney but not the other organs. Spleen, lung and liver may show damages related to sequestration, intravascular hemolysis, side products, cytokines and anemia. This needs to be discussed.

We agree with the reviewer’s point that other organs may also be relevant to this phenotype. For that reason, we originally analyzed all tissues mentioned by the reviewer—spleen, lung, and liver. We do mention that our histological analysis of liver tissue revealed less severe damage in AhR mice (subsection “AHR signaling is protective during Pc infection”). We have now added a sentence to indicate that spleen and lung tissue showed no significant differences between genotypes.

Figures 5 and 6: Figure 5 does not add much to the story since it only says that radiosensitive cells do not contribute to the AhR mediated protection. Yet it still sets the stage for Figure 6. I would shorten that part and put more emphasis on Figure 6. I found Figure 6 to be very informative focusing the attention onto endothelial cells. The endothelial cell specific knock out really has potential to generate high quality original data, however authors cut that story short by only limiting the analyses to 4 major parameters. Extending that section with more sophisticated analyses would make the manuscript more complete.

We agree that the role of AhR in Tie2-expressing cells merits further study. Thorough characterization of this phenotype, however, requires extensive experimentation and will likely warrant an entire story in the future. We feel that additional experimentation on this point is outside the scope of this paper.

Materials and methods section: age of a mouse has a significant impact on disease progression. Therefore, age matching is critical. Authors should include a statement regarding to age matching practice between control and experimental groups, otherwise 8-12 weeks is a relatively broad range for this particular experimental model.

We appreciate the reviewer’s point. For this reason, we have always carefully matched ages. By using littermates that fall within the 8-12 week old range, we ensure that our experiments have age-matched control and experimental mice. That said, we have not seen a difference in disease severity between mice that are 8 weeks versus 12 weeks old. To clarify this point in the manuscript, we have moved all discussion of mouse age to the subsection “Cross-sectional infection”.

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Antibody	TruStain FcX Antibody	Biolegend	BioLegend Cat# 101319, RRID:AB_1574973
Antibody	Mouse monoclonal CD71 PerCP/Cy5.5 (clone RI7217)	Biolegend	BioLegend Cat# 113815, RRID:AB_2565481
Antibody	Mouse monoclonal TER-119 PE/Cy7 (clone TER-119)	Biolegend	BioLegend Cat# 116221, RRID:AB_2137789
Antibody	Mouse monoclonal TCR γ/δ PE (clone UC7-13D5)	Biolegend	BioLegend Cat# 107507, RRID:AB_345265
Antibody	Mouse monoclonal CD19 BV 785 (clone 6D5)	Biolegend	BioLegend Cat# 115543, RRID:AB_11218994
Antibody	Mouse monoclonal CD3 BV 650 (clone 17A2)	Biolegend	BioLegend Cat# 100229, RRID:AB_11204249
Antibody	Mouse monoclonal CD8a BV510 (clone 53–6.7)	Biolegend	BioLegend Cat# 100751, RRID:AB_2561389
Antibody	Mouse monoclonal Ly-6G BV 421 (clone 1A8)	Biolegend	BioLegend Cat# 127628, RRID:AB_2562567
Antibody	Mouse monoclonal CD4 Alexa Fluor 700 (clone RM4-5)	Biolegend	BioLegend Cat# 100536, RRID:AB_493701
Antibody	Mouse monoclonal Ly-6C Alexa Fluor 647 (clone HK1.4)	Biolegend	BioLegend Cat# 128010, RRID:AB_1236550
Antibody	Mouse monoclonal CD335 FITC (clone 29A1.4)	Biolegend	BioLegend Cat# 137606, RRID:AB_2298210
Antibody	Mouse monoclonal CD11b APC-eFluor 780 (clone M1/70)	Thermo Fisher Scientific	Thermo Fisher Scientific Cat# 47-0112-82, RRID:AB_1603193
Antibody	Mouse monoclonal CD41 BUV395 (clone MWReg30)	BD Biosciences	BD Biosciences Cat# 565980, RRID:AB_2739432
Antibody	Human monoclonal Heme Oxygenase 1 (clone EP1391Y)	Abcam	Abcam Cat# ab52947, RRID:AB_880536	(1:2000 dilution)
Antibody	Mouse monoclonal Ferritin Heavy Chain (clone EPR18878)	Abcam	Abcam Cat# ab183781	(1:2000 dilution)
Antibody	Mouse monoclonal DMT1 antibody	Abcam	Abcam Cat# ab55735, RRID:AB_2239227	(1:400 dilution)
Antibody	Mouse polyclonal HCP1/PCFT antibody	Abcam	Abcam Cat# ab25134, RRID:AB_2270597	(1:1000 dilution)
Antibody	Mouse monoclonal β-Actin (clone AC-15)	Sigma Aldrich	Sigma-Aldrich Cat# A1978, RRID:AB_476692	(1:2000 dilution)
Antibody	Rabbit polyclonal IgG HRP	GE Healthcare	GE Healthcare Cat# GENA934, RRID:AB_2722659	(1:10,000 dilution)
Antibody	Mouse polyclonal IgG HRP	Bio-Rad	Bio-Rad Cat# 170–6516, RRID:AB_11125547	(1:3000 dilution)
Antibody	Mouse polyclonal CD45.2 PerCP-Cy5.5 (clone 104)	Thermo Fisher Scientific	Thermo Fisher Scientific Cat# 45-0454-82, RRID:AB_953590
Antibody	Mouse monoclonal NK-1.1 FITC (clone PK136)	Biolegend	BioLegend Cat# 108705, RRID:AB_313392
Antibody	Mouse monoclonal CD11c PE-Cy7 (clone N418)	Thermo Fisher Scientific	Thermo Fisher Scientific Cat# 25-0114-82, RRID:AB_469590
Antibody	Mouse monoclonal CD45.1 PE (clone A20)	Biolegend	BioLegend Cat# 110707, RRID:AB_313496
Antibody	Mouse monoclonal Ly6G (clone 1A8)	Bio X Cell	Bio X Cell Cat# BE0075-1, RRID:AB_1107721
Antibody	Rat monoclonal IgG2a, (clone 2A3)	Bio X Cell	Bio X Cell Cat# BE0089, RRID:AB_1107769
Antibody	Mouse monoclonal TNFα (clone XT3.11)	Bio X Cell	Bio X Cell Cat# BE0058, RRID:AB_1107764
Antibody	Rat monoclonal IgG1 (clone HRPN)	Bio X Cell	Bio X Cell Cat# BE0088, RRID:AB_1107775
Chemical compound, drug	Formic acid, reagent grade,≥95%	Sigma Aldrich	Cat. F0507-100ML
Chemical compound, drug	Hemin	Sigma Aldrich	Cat. H9039
Chemical compound, drug	Phenylhydrazine, 97%	Sigma Aldrich	Cat. P26252-100G
Chemical compound, drug	L-Tryptophan	Sigma Aldrich	Cat. T0254
Chemical compound, drug	Tryptophan-d5	Medical Isotopes	Cat. D34384
Chemical compound, drug	L-Kynurenine	Sigma Aldrich	Cat. K8625
Chemical compound, drug	L-Kynurenine-d4	Medical Isotopes	Cat. D37563
Chemical compound, drug	3-Hydroxy-DL-kynurenine	Sigma Aldrich	Cat. H1771
Chemical compound, drug	3-Hydroxy-DL-kynurenine-d3	Medical Isotopes	Cat. D34384
Chemical compound, drug	Kynurenic acid	Sigma Aldrich	Cat. 67667
Chemical compound, drug	Kynurenic acid-3,5,6,7,8-d5	Sigma Aldrich	Cat. 793477
Chemical compound, drug	2,3-Pyridinedicarboxylic acid	Sigma Aldrich	Cat. P63204
Chemical compound, drug	Quinolinic Acid-d3	Medical Isotopes	Cat. D18880
Commercial assay or kit	Bilirubin Assay Kit	Sigma Aldrich	Cat. MAK126-1KT
Commercial assay or kit	ALT Activity Assay	Sigma Aldrich	Cat. MAK052-1KT
Commercial assay or kit	Bioassay Systems Urea Assay Kit	Fisher Scientific	Cat. 50-107-8333
Commercial assay or kit	TruSeq RNA Library Prep Kit v2	Illumina	Cat. RS-122–2001
Commercial assay or kit	TNF alpha Mouse ELISA Kit	Thermo Fisher Scientific	Thermo Fisher Scientific Cat# BMS607/3, RRID:AB_2575663
Genetic reagent (Mus musculus)	Ahr-/- mice	Taconic	Cat. 9166, RRID:IMSR_TAC:9166
Genetic reagent (M. musculus)	Ahr+/+ mice	Taconic	Cat. B6, RRID:IMSR_TAC:b6
Genetic reagent (M. musculus)	Ido1-/- mice	Jax	Cat. 005867, RRID:IMSR_JAX:005867
Genetic reagent (M. musculus)	C57BL/6J mice	Jax	Cat. 000664, RRID:IMSR_JAX:000664
Genetic reagent (M. musculus)	AhRfl/fl mice	Jax	Cat. 006203, RRID:IMSR_JAX:006203
Genetic reagent (M. musculus)	Tekcre/+ mice	Jax	Cat. 004128, RRID:IMSR_JAX:004128
Genetic reagent (M. musculus)	CD45.1 mice	Taconic	Cat. 4007, RRID:IMSR_TAC:4007
Genetic reagent (M. musculus)	C57BL/6NCrl mice	Charles River	Cat. 027, RRID:IMSR_CRL:027
Genetic reagent (Plasmodium chabaudi)	Plasmodium chabaudi AJ	Malaria Research and Reference Reagent Resource Center	Cat. MRA-756
Commercial assay or kit	Bilirubin Assay Kit	Sigma Aldrich	Cat. MAK126-1KT
Commercial assay or kit	RNeasy Mini kit	Qiagen	Cat. 74104
Commercial assay or kit	Rnase-Free Dnase	Qiagen	Cat. 79256
Commercial assay or kit	SuperScript III First-Strand synthesis system	Fisher Scientific	Cat. 18-080-051
Commercial assay or kit	FastStart Universal SYBR Green Master (Rox)	Sigma Aldrich	Cat. 04913850001
Software, algorithm	FlowJo 10.0.8r1	Tree Star	https://www.flowjo.com/solutions/flowjo
Software, algorithm	R v3.4.0	R	https://www.r-project.org/
Software, algorithm	ggplot2 v3.1.0	ggplot2	https://github.com/tidyverse/ggplot2