Molecular diagnosis, genetic diversity and drug sensitivity patterns of Mycobacterium tuberculosis strains isolated from tuberculous meningitis patients at a tertiary care hospital in South India.

Tuberculous meningitis (TBM) is the most severe form of Mycobacterium tuberculosis (Mtb) infection in humans and is a public health concern worldwide. We evaluated the performance of GeneXpert MTB/RIF (GeneXpert) for the diagnosis of TBM. In addition, genetic diversity and drug susceptibility profiling of Mtb strains isolated from TBM patients were also investigated. A total of 293 TBM suspected cerebrospinal fluid (CSF) samples were collected and subjected to GeneXpert and Mycobacterial Growth Indicator Tube (MGIT 960) culture, respectively. Sensitivity and specificity of GeneXpert was 72.7% and 98.5%, respectively by using MGIT 960 as a gold standard (GeneXpert (n = 20, 6.8%) vs MGIT 960 (n = 22, 7.5%)). All Mtb positive cultures were subjected to 24-locus Mycobacterial Interspersed Repetitive Unit Variable Number Tandem Repeat (MIRU-VNTR) typing, Line probe assay (LPA) and MGIT 960- Drug Susceptibility Testing (DST). The rpoB gene was amplified and sequenced for selected isolates. Among our TBM patients, East African Indian (EAI) lineage (n = 16, 72.7%) was most predominant followed by Beijing (n = 3, 13.6%), S-family (n = 2, 9.1%) and Delhi/CAS (n = 1, 4.5%). Three Mtb strains were found to be Isoniazid (INH) resistant by MGIT 960; however LPA revealed that two strains were INH resistant and one strain was multi drug resistant (MDR) (Resistant to Isoniazid and Rifampicin (RIF)). We identified rifampicin resistant isolate with the mutation D516F in rifampicin resistance-determining region (RRDR) and observed discordant results between LPA, GeneXpert and MGIT 960. In addition, GeneXpert showing false RIF resistance was identified (no mutation in RRDR). We conclude that GeneXpert is useful for the diagnostic confirmation of TBM; however a GeneXpert negative sample should be subjected to MGIT 960 culture or LPA to rule out TBM. EAI lineage was the most predominant among TBM patients in South India and associated with drug resistance. The discordance between GeneXpert, MGIT 960 and LPA with respect to rifampicin resistance has to be ruled out to avoid TB treatment failure or relapse.

Introduction

Tuberculous meningitis (TBM) is the most severe form of extra pulmonary TB (EPTB) affecting the central nervous system (CNS) and it accounts for 1–5% of tuberculosis cases. TBM occurs when Mycobacterium tuberculosis (Mtb) released into the subarachnoid space, which could leads to the organization of inflammatory exudates in the basal cisterns that can produce obstruction to cerebrospinal fluid (CSF) flow, contributes to hydrocephalus and raised intracranial pressure [1]. Despite the accessibility of innovative health care, more than 50% of TBM patients may have neurological sequelae and the mortality ranged from 19.3% to 21.5% [2, 3]. The collective complications of multi drug resistance and HIV co-infection among TBM cases confer mortality close to 100% [4]. Hence, it is important for clinicians to diagnose TBM very early and choose the appropriate therapeutic options. Delay in TBM diagnosis may lead to poor outcomes and results in death. However, diagnosis of TBM remains challenge due to its pauci-bacillary nature of disease, especially in resource-constrained settings and TBM treatment is difficult due to the poor or incomplete penetration of anti-TB drugs across the blood–brain barrier and blood-CSF barriers. Generally, TBM diagnosis is based on a combination of clinical findings, various laboratory testing using CSF, and imaging findings. For TBM diagnosis, Ziehl–Neelsen (ZN) staining for Mtb is the most commonly available test, but without expert microscopists ZN staining has become insensitive and culture takes minimum two to three weeks to provide results with 30–60% sensitivity. The sensitivity of GeneXpert, a cartridge based rapid molecular test was still not high enough to rule out TBM (45–67% sensitivity to detect microbiologically proven TBM). GeneXpert Ultra has 70% sensitivity versus clinical case definition and misses up to 30% of cases [5]. However, a recent study from Donovan et al. reported that GeneXpert Ultra was not superior to GeneXpert for TBM diagnosis in both HIV-uninfected and HIV-infected adults [6]. This attracted our interest to validate the diagnostic performance of GeneXpert for the diagnosis of TBM by using Mycobacterial Growth Indicator Tube (MGIT 960) as a gold standard.

Mycobacterial interspersed repetitive units-variable number of tandem repeats (MIRU-VNTR) method have been used for studying the molecular epidemiology and transmission dynamics of Mtb. MIRU-VNTR defines the size and repeated number of units in each locus by amplification of interspersed repetitive units of mycobacteria and helps to study the diversity and clonal expansion of particular strain or lineages. Several studies suggest that the infecting Mtb strains from different lineages vary in their ability to obtain drug resistance, disease severity and pathogenesis [7, 8]. However, the influence of genetic factors that regulate the association of Mtb lineages with different level of disease including TBM remains unknown. Studies on Mtb lineages and drug resistance among TBM patients will highlight the molecular epidemiology of circulating bacteria and support in establishing the active control schemes. Delhi/CAS-type is the most predominant lineage of Mtb in North India followed by East African Indian (EAI) and Beijing [9-11]. However, EAI was predominant in South India as compared to Central and North India [12].

Earlier and accurate diagnosis of TBM continues to be a serious challenge for physicians and the consequences of delaying treatment are severe in India and worldwide. Although India has highest absolute number of tuberculosis cases including EPTB, there is paucity of data on prevailing genotypes and drug resistance profile of Mtb strains isolated from TBM cases in South India. Based on this knowledge, in this context, we aimed (i) to validate the diagnostic performance of GeneXpert to detect Mtb strains in CSF samples by using MGIT 960 as gold standard (ii) to understand the genetic diversity of circulating Mtb strains isolated from TBM patients from South India and (iii) to profile drug sensitivity patterns among Mtb strains isolated from TBM patients by using both phenotypic and genotypic methods

Methods

Study samples and Mtb cultures

We did an observational study to compare the performance of GeneXpert for the diagnosis of TBM by using MGIT 960 as a gold standard. A total of 293 CSF samples from TBM suspected cases were collected from a tertiary care hospital (JIPMER) during the study period from August 2018 to February 2020. A CSF volume of 2 ml was used for mycobacterial tests; 1.5 ml was used for GeneXpert and 0.5 ml for MGIT 960 culture. In addition, twenty two non-duplicate Mtb strains isolated from CSF samples were subjected to Mtb strain typing, MGIT 960 DST-SIRE [streptomycin (1.0 μg/ml), isoniazid (0.1 μg/ml), rifampicin (1.0 μg/ml) and ethambutol (5.0 μg/ml)] and Line Probe Assay (LPA).

GeneXpert

The CSF samples were subjected to GeneXpert assay (Cepheid, New Delhi, India) according to manufacturer’s instructions [13]. The 1.5 ml of CSF samples diluted with GeneXpert MTB/RIF sample reagent (1.5 ml) was vortexed for 30 seconds and incubated at room temperature for 10 minutes. The CSF-reagent mixture was vortexed again for 30 seconds and then incubated for 5 minutes. The 2 ml of CSF-reagent mixture was then transferred into the GeneXpert MTB/RIF cartridge and loaded into the GeneXpert equipment. After 2 hours, the results were reported as Mtb positive or negative, and RIF resistant or sensitive among those positives.

MGIT 960 culture

In this study, 500 μl of CSF sample was inoculated and incubated in the MGIT 960 system (Becton Dickinson India Private Limited, Gurgaon, India) till the tubes were flagged positive by the machine or till it was reported negative (42 days). The sterility of MGIT 960 positive cultures was checked on blood agar plates. MPT64 Ag test was performed for confirmation of Mycobacterium tuberculosis complex (MTBC) isolates recovered in MGIT 960 as per the manufacturer’s instructions. All isolates were preserved at -80°C for further studies

DNA extraction and multiplex PCR

The DNA extraction from MGIT 960 Mtb culture was carried out using QIAamp DNA mini Kit (QIAGEN India Private Limited, New Delhi, India) as per the instructions provided by the manufacturer. The multiplex PCR (MPCR) was carried out to identify MTBC by using specific pair of primers designed to amplify IS6110 (123bp), protein b antigen (419bp) and MPB64 (240bp) [14]. The positive (H37Rv) and negative (Nuclease-Free Water, Sigma) controls were run concurrently during each multiplex PCR (MPCR) assay. The sequence of primers used to amplify IS6110, protein b antigen and MPB64 are listed in the Table 1. DNA amplification was performed in thermocycler (Eppendorf India Private Limited, New Delhi, India) using the following parameters; initial denaturation at 94°C for 5 min, then 40 cycles of denaturation at 94°C for 1 min, annealing at 65°C for 1.5 min, extension at 72°C for 1.5 min and final extension at 72°C for 10 min. The amplified DNA products were analysed by 1.5% agarose gel electrophoresis, stained with ethidium bromide (1%) and examined under UV light.

Table 1

Multiplex PCR targets primers.

Primers	Sequence	Product	Reference
IS6110F	5'CTCGTCCAGCGCCGCTTCGG3'	123bp	[14]
IS6110R	5'CCTGCGAGCGTAGGCGT3'
MPb64 F	5'TCCGCTGCCAGTCGTCTTCC3'	240bp
MPb64 R	5'GTCCTCGCGAGTCTAGGCCA3'
PabF	5'ACCACCGAGCGGTTCGCCTGA3'	419bp
PabR	5'GATCTGCGGGTCGTCCCAGGT3'

MIRU-VNTR

The DNA extraction from MGIT 960 Mtb positive culture was carried out as per the manufacturer’s instructions using QIAamp DNA mini Kit. The extracted DNA from Mtb isolates were subjected to 24 locus MIRU-VNTR typing as described by Supply et al. [15]. For each isolate, individual PCRs using primer sets for each locus was run accordingly. The number of repeats for each locus was calculated by the amplicon size. The strain lineage was confirmed by using the MIRU-VNTRplus web resource [16].

Drug susceptibility testing (MGIT 960 DST-SIRE)

The Mtb positive cultures were sub-cultured onto MGIT 960 for drug susceptibility testing. Drug susceptibility to first-line anti-TB drugs including streptomycin (1.0 μg/ml), isoniazid (0.1 μg/ml), rifampicin (1.0 μg/ml) and ethambutol (5.0 μg/ml) were tested using SIRE Kit (Becton Dickinson India Private Limited, Gurgaon, India) in MGIT 960 liquid medium as per the manufacturer instructions. The susceptibility testing pattern was interpreted manually as fully susceptible, mono-resistant, or multidrug resistant. H37Rv was used as a control strain.

Line Probe Assay

The Line Probe Assay (LPA), based on strip technology was used to detect rifampicin (RIF) resistance due to mutations in rpoB (RNA polymerase B subunit), as well as isoniazid (INH) resistance due to mutations in kat G (catalase peroxidase) and inhA (inoyl coenzyme A reducatse) genes. The Mycobacterial DNA was extracted as per the manufacturer’s instructions using GenoLyse kit (Hain Lifescience, Nehren, Germany) from all MGIT 960 Mtb positive strains. The multiplex PCR was carried out for the detection of rpoB, katG, inhA genes using 35μl of primer nucleotide mix, 10 μl of Taq DNA polymerase-PCR buffer mix and 5 μl of supernatant in a final volume of 50 μl. The amplification was carried out using the following PCR parameters: Initial denaturation of 15 min at 95°C, followed by 10 cycles of 30 sec at 95°C and 2 min at 65°C, and 20 cycles of 25 sec at 95°C, 40 sec at 50°C and 40 sec at 70°C and the extension step of 8 min at 70°C (1 cycle). The automated GT Blot 48 device (Hain Lifescience, Nehren, Germany) was used for hybridization and the results were interpreted as per the manufacturer’s instructions.

rpoB gene amplification and sequencing

To analyse the mutations associated with RIF resistance, the rifampicin resistance-determining region (RRDR) was sequenced after amplification of rpoB gene by conventional PCR by using the primers, rpoBF (5’CAGACGTTGATCAACATCCG3’) and rpoBR (5’TACGGCGTTTCGATGAAC3’) to generate 305 bp that contains 81bp hot-spot RRDR. The extracted DNA (QIAamp DNA mini Kit) from the selected drug resistant Mtb strains including a reference strain (H37Rv) was subjected to PCR. The amplification was carried out using the following PCR parameters: Initial denaturation of 5 min at 94°C, followed by 35 cycles of 1 min at 94°C (denaturation), 30 sec at 50°C (annealing), 2 min at 72°C (extension) and the final extension step of 10 min at 72°C. The amplified product was subjected to 1.8% agarose gel electrophoresis and sequencing (ABI3500 Genetic analyser). The mutational analysis was carried out using BioEdit software [17].

Statistical analysis

The diagnosis of TBM cases, gene positivity and RIF or INH resistance were expressed as percentages. The sensitivity and specificity of GeneXpert was calculated using MGIT 960 culture as a gold standard. The SPSS software (Version 20) was used for the statistical analysis.

Ethical statement

The study was reviewed and approved by the Institute Ethics Committee (IEC) (Human studies) at Jawaharlal Institute of Postgraduate Medical Education and Research (JIPMER), Pondicherry (Approval No. JIP/IEC/2019/143). The IEC granted waiver of consent for this study. In this study, we utilized only the samples routinely sent to the mycobacteriology laboratory for diagnosis of TBM. The patient samples are not used for other purposes besides diagnosis of TBM and characterization of the Mtb isolates.

Results

Characteristics of the study population

Of the total 293 patients <1year were 4 (1.4%), 1 to 14 years were 32 (10.9%), 15 to 30 years were 85 (29%), 31–60 years were 137 (46.8) and >60 years were 35 (11.9%). Of the 293 patients, 164 (56%) were male and 129 (44%) were female.

Performance of GeneXpert and MGIT 960 culture on CSF samples

Of the total 293 patients, 20 (6.8%) were GeneXpert positive and 22 (7.5%) MGIT 960 culture positive (Fig 1). All MGIT 960 cultures were found to be positive for MPT64 Ag Immunochromatographic test and Mtb species specific Multiplex PCR assay. Of the total 20 GeneXpert positive samples, 16 and 4 were MGIT 960 culture positive and negative, respectively. Among 22 MGIT positive cases, 16 and 6 were GeneXpert positive and negative, respectively (Table 2). The sensitivity and specificity of GeneXpert was 72.7% and 98.5%, respectively by using MGIT 960 culture as a gold standard.

Fig 1

Diagnostic algorithm of the study.

Xpert—GeneXpert; MGIT—MGIT 960; +ve—Positive;–ve—Negative; S—streptomycin; I—isoniazid; R—rifampicin and E—ethambutol.

Table 2

Comparison of GeneXpert assay by using MGIT 960 as the gold standard.

		MGIT 960 culture		Total
		Positive	Negative
GeneXpert	Positive	16	4	20
	Negative	6	267	273
Total		22	271	293

Phenotypic and genotypic drug susceptibility profiling

Out of 22 MGIT positive cultures, three strains (GC6, GC13 and GC16) were found to be INH resistant by MGIT-DST. Line Probe Assay (LPA) assay revealed that among 22 MGIT positive cultures two Mtb strains (GC6 and GC13) were INH resistant and one (GC16) was multi drug resistant (INH and RIF resistant) (S1 Table in S1 File). The rpoB gene sequencing revealed that GC16 strain harbour detectable mutation GAC516TTC (D516F) in 81bp RRDR (S1-S3 Figs in S1 File). However, this MDR (GC16) strain was not detected by GeneXpert in CSF sample. Among 20 GeneXpert positive cases, one was detected as RIF resistant but Mtb (GC6) isolated from this sample was found to be rifampicin sensitive by both MGIT 960 and LPA and no mutation was observed in RRDR. In addition, we observed that this GC6 Mtb strain was found to be INH resistant by both MGIT and LPA. Hence, our results revealed the discordance results between GeneXpert, MGIT 960 and LPA with respect to rifampicin resistance (S1 Table in S1 File). Importantly, we observed that the LPA had a better performance to GeneXpert and MGIT-DST with regards to the detection of RIF resistance; however, LPA and MGIT-DST showed similar drug susceptibility patterns with respect to INH resistant.

In this tertiary care hospital from South India, the majority of Mtb strains were EAI lineage (n = 16, 72.7%) followed by Beijing (n = 3, 13.6%), S-family (n = 2, 9.1%) and Delhi/CAS (n = 1, 4.5%). The drug resistant strains, GC6 and GC16 belonged to EAI and G13 was Delhi/CAS lineage (S1 Table in S1 File).

Discussion

The diagnosis of TBM remains a challenge for clinicians worldwide due to paucibacillary nature of the disease [18]. In 2011, World Health Organization (WHO) recommended GeneXpert over CSF smear and culture as the initial diagnostic tests for patients suspected to have TB or drug resistant TB and for patients suspected to be having TBM [19-21]. Several studies have reported that GeneXpert is a useful diagnostic test to rule out TBM cases from CSF samples [22, 23]. In addition, numerous studies also reported that GeneXpert ultra was superior to GeneXpert for the diagnosis of TBM [24-26]; however, a recent study by Donovan et al., reported that GeneXpert Ultra was not superior to GeneXpert for the diagnosis of TBM in HIV-uninfected and HIV-infected patients [6]. In our study, we compared the diagnostic performance of GeneXpert for detecting Mtb in CSF samples by using MGIT 960 as a gold standard. Our results showed that GeneXpert had 72.7% sensitivity and 98.5% specificity for diagnosing TBM by using MGIT 960 as gold standard. We observed that of the total 293 samples, 22 were positive for MGIT 960 culture and 20 were GeneXpert positive (Table 2). Importantly, of the 20 cases detected by GeneXpert, four were not detected by MGIT culture and one rifampicin resistant Mtb detected by GeneXpert was found to be sensitive by both LPA and MGIT DST-SIRE and no mutation in rpoB gene. It’s unlikely, the false positive (GeneXpert positive but culture-negative) may have occurred due to cross-contamination, as GeneXpert cartridges have closed chambers [27]. Another reason for false GeneXpert positive may be due to commencement of empirical treatment for TBM patients before the culture results were known. Of the 22 cases detected by MGIT 960, six were not detected by GeneXpert. False negative results in GeneXpert may be due to the presence of less bacillary load (<100 CFU/ml) in CSF samples [22] or the presence of PCR inhibitors in CSF samples that may inhibits PCR considerably and cause false-negative GeneXpert results [28]. Interestingly, studies also reported that centrifugation and suspension of CSF samples is likely to remove PCR inhibitors [29]. An alternative reason for false negative GeneXpert results may be due to inappropriate capture or lysis of all bacteria within the cartridge during the process [22]. As recommended by WHO, TBM suspected patient who receive a negative result by GeneXpert should undergo further diagnostic tests.

The association between Mtb lineages and disease severity, emergence of drug resistance, host response and transmissibility in TBM are highly scarce and alarming. In the present study, we investigated the genome diversity of 22 Mtb strains isolated from CSF samples using 24 MIRUs (the 24 loci panel). MIRU-VNTR typing is a molecular genotyping method that uses counts of the number of times pre-specified loci repeat in a strain. This study gives an insight into the genetic diversity of Mtb strains isolated from CSF samples in South India. The predominant genotype among our TBM cases in South India was that of EAI lineage (n = 16, 72.7%) followed by Beijing (n = 3, 13.6%), S-family (n = 2, 9.1%) and Delhi/CAS (n = 1, 4.5%). A study from Varghese et al. reported that EAI displayed significant association to CNS TB (p-0.04) [30]. The EAI lineage strains are the most ancient Mtb strain found mostly in the southern part of India, particularly prevalent in tropical countries. EAI lineage contributes to 84% of Mtb isolates in South India [31]. A study from North India reported that EAI is the second most frequently isolated lineage (22.8%) from CSF samples [12]. Our study results depict an extreme geographical difference between South India and North India. In northern part of India, Delhi/CAS is predominant strain whereas in western India, the dominant strain is Beijing strain. Hence, understanding the genetic diversity of Mtb strains in a given clinical setting may play an important role to introduce more effective control measures and management strategies against PTB and EPTB including TBM.

Drug susceptibility profiles of Mtb strains isolated from CSF samples were analysed by phenotypic (MGIT-DST SIRE) and genotypic (GeneXpert, Line Probe Assay (LPA) and rpoB sequencing) methods. Our results highlighted that LPA had a better performance compared to GeneXpert and MGIT 960 with regards to the detection of RIF resistance. Of the total of 22 Mtb strains, three were INH resistant by both MGIT 960 and LPA. A CSF sample which was detected as RIF resistant by GeneXpert was found to be RIF sensitive by both MGIT 960 and LPA and no mutation was observed in RRDR of rpoB gene. Importantly, a GeneXpert negative CSF sample which was cultured in MGIT 960 was found to be INH and RIF resistant by LPA and mutation (GAC516TTC, D516F) was observed in RRDR. Interestingly, this isolate was RIF sensitive by MGIT-DST SIRE. Although, the association of D516F substitution with discordant susceptibility tests was reported in previous studies [32, 33], our data was not in agreement with the results of Tan et al., Berrada et al., and Aragon et al. [34-36]. The occurrence of mutation D516F has been proposed to cause low-level rifampicin resistance [32, 37]. Low level rifampicin resistance may influence the treatment; particularly phenotypic DST outcomes may vary from the actual effectiveness of anti-TB drugs in patients [38]. Although MDR Mtb strains are resistant to at least rifampicin and isoniazid, the key factor for treatment failure is rifampicin resistance. GeneXpert and LPA are the two WHO approved molecular diagnostic tests that detect mutations in the RRDR of the rpoB gene for the earlier diagnosis of rifampicin resistance in clinical specimens and culture isolates. However, these tests are not specific and they do not detect mutations outside of the 81bp RRDR of the rpoB gene of Mtb, which contains 95% of known rifampicin resistance-associated codons, leading to false-negative rifampicin resistance [13, 39, 40]. In addition, MGIT 960 culture, which is the current standard resistance test endorsed by the WHO to validate novel molecular assays may miss occult rifampicin resistance due to ‘disputed’ mutations [39]. This is due to the pre-set standard conditions of rifampicin critical concentration of 1 μg/ml. Hence, our results highlighted that the discordance between GeneXpert MTB/RIF, LPA and MGIT 960 culture may cause laboratory error in detecting rifampicin resistance in TBM, which leads to treatment failure or relapse. In addition, we highlighted that the drug resistant strains, GC6 and GC16 belonged to EAI and G13 was Delhi/CAS lineage.

In summary, although this study was limited by a relatively small sample size our study highlighted the diagnostic usefulness of GeneXpert for TBM. GeneXpert negative results do not rule out TBM and we strongly recommend that the CSF sample which was found to be negative by GeneXpert should be subjected to culture or LPA or other diagnostic assays. Genetic diversity of Mtb strains isolated from TBM patients from South India was highlighted; among different genotypes EAI was the most predominant and was associated with drug resistance among TBM patients followed by Delhi/CAS. In addition, our results revealed the discordance between GeneXpert MTB/RIF, LPA and MGIT 960 culture with respect to rifampicin resistance which may lead to treatment failure or relapse. Hence we suggest that further studies on these subjects may improve the diagnostic performance and patient management for TBM.

(DOCX)

Click here for additional data file.

25 Aug 2020

PONE-D-20-08897

Molecular diagnosis, genetic diversity and drug sensitivity patterns of Mycobacterium tuberculosis strains isolated from tuberculous meningitis patients at a tertiary care hospital in South India

PLOS ONE

Dear Dr. Joseph,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

==============================

ACADEMIC EDITOR: please confer to the minor modifications suggested by reviewer 1.. Reviewer 2 did accept the manuscript without changes.

==============================

Please submit your revised manuscript by Oct 09 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Christophe Sola, Pharm.D., Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2.Please include your tables as part of your main manuscript and remove the individual files. Please note that supplementary tables (should remain/ be uploaded) as separate "supporting information" files.

3.In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability.

Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.

Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.

We will update your Data Availability statement to reflect the information you provide in your cover letter.

4.PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

5. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: N/A

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Tuberculosis is a serious public health problem, especially for people living in poor and developing regions, and because of the ability of M. tuberculosis to infect virtually all organs of the human body, its diagnosis in cases of extra-pulmonary tuberculosis has played a challenge. In the present manuscript we are faced with a “challenge within a challenge” which is the diagnosis of tuberculous meningitis, a severe form of tuberculosis (paucibacillary) with a high rate (1 - 5%) of involvement, as shown by the authors. The manuscript's theme is of great importance for the control of tuberculosis, and the results in a way present guideline for a better management of cases of tuberculous meningitis, also using the detection of resistant isolates.

The manuscript is rather concise in their proposal and presents the results accurately, however is full of small mismatches, such as: a) MGIT 960 is presented in two ways: MGIT 960 and MGIT960; b) In the method section it is stated that the 2 mL of the CSF were divided into 1.5 mL for Xpert and 0.5 mL for MGIT, then it says that 2 mL were used for Xpert; c) To standardize the wording of units in relation to their values, or with space or without space, observe the recommendations of PLOS; d) Standardize the wording of the names of the drugs, or start with a capital letter or a small letter; e) Check if the parameters of the multiplex PCR for the rpoB, inhA and katG genes are correct; f) I recommend a careful review of the references, mainly related to how the species M. tuberculosis is being written; g) The highlighted isolates (GC3, GC13 and GC16) throughout the text and in the legends are spelled in different ways; h) The purpose of the presentation of Figure 2B is not clear, since the electropherograms do not correspond to the sequences presented for the M. tuberculosis H37Rv strain, and the clinical isolates GC6 and GC16; i) Figure 3 shows the scientific quality and accuracy of the results obtained in this study, however it does not contribute to a better understanding of the work, I recommend removing it; j) MIRU-VNTR is recognized as a fundamental tool for the molecular characterization of M. tuberculosis isolates and has been widely used for this purpose, therefore it is not necessary to include the table of primers used for PCR reactions, unless this work proposed some modifications in these sequences; k) Although it is not the objective of this work, I believe it is important to include in the discussion information that discards epidemiological links of the patients involved in this study; l) In this manuscript the authors refer to: “confirmation of isolates of MBTC” and “identify of MBTC” however this acronym is not defined throughout the text, if this acronym refers to the M. tuberculosis Complex, consider the adequacy as the publication by Riojas et al., Int J Syst Evol Microbiol 2018; 68: 324–332.

Reviewer #2: accept as is.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

4 Sep 2020

Reviewer #1:

Thank you so much for reviewing our manuscript and your suggestions are very helpful. As per the reviewer’s suggestions, we revised the manuscript accordingly and highlighted the corrections.

a) MGIT 960 is presented in two ways: MGIT 960 and MGIT960

We presented MGIT 960 as MGIT 960 throughout the manuscript

b) In the method section it is stated that the 2 mL of the CSF were divided into 1.5 mL for Xpert and 0.5 mL for MGIT, then it says that 2 mL were used for Xpert

We have written this protocol elaborately in GeneXpert methodology section. The 1.5 ml of CSF samples diluted with GeneXpert MTB/RIF sample reagent (1.5 ml) was vortexed for 30 seconds and incubated at room temperature for 10 minutes. The CSF-reagent mixture was vortexed again for 30 seconds and then incubated for 5 minutes. The 2 ml of CSF-reagent mixture was then transferred into the GeneXpert MTB/RIF cartridge and loaded into the GeneXpert equipment. Kindly find the revised sentence in the page no 4

c) To standardize the wording of units in relation to their values, or with space or without space, observe the recommendations of PLOS

As per the guidelines of PLOS, we provided the space to units in relation to their values. Kindly find the corrections in the page no’s 4, 5, 6 and 9

d) Standardize the wording of the names of the drugs, or start with a capital letter or a small letter

We started the names of all the drugs with a small letter. SIRE was written as streptomycin, isoniazid, rifampicin and ethambutol. Kindly find the changes in the page no’s 4 and 6

e) Check if the parameters of the multiplex PCR for the rpoB, inhA and katG genes are correct

As per the reviewer’s suggestion, we have checked the parameters of the multiplex PCR for the rpoB, inhA and katG genes and corrected appropriately. Please find the changes in page 6

f) I recommend a careful review of the references, mainly related to how the species M. tuberculosis is being written;

As per the reviewer’s suggestion, we revised the reference very carefully and italicised Mycobacterium tuberculosis throughout the reference section.

g) The highlighted isolates (GC3, GC13 and GC16) throughout the text and in the legends are spelled in different ways

Thank you so much for this comment. We corrected the isolates no’s as GC6, GC13 and GC16. Kindly find the changes in the supporting information in (S1-S3 Figs in S1File).

h) The purpose of the presentation of Figure 2B is not clear, since the electropherograms do not correspond to the sequences presented for the M. tuberculosis H37Rv strain, and the clinical isolates GC6 and GC16

To analyse the mutations associated with RIF resistance, the rifampicin resistance-determining region (RRDR) was sequenced after amplification of rpoB gene by conventional PCR by using the primers, rpoBF (5’CAGACGTTGATCAACATCCG3’) and rpoBR (5’TACGGCGTTTCGATGAAC3’) to generate 305 bp that contains 81bp hot-spot RRDR (Page No 6). The rpoB gene was sequenced using reverse primer and the electropherogram of RRDR sequence was presented as 3’ to 5’ (S2 Fig in S1 File). During mutation analysis, we have converted the sequence into 5’ to 3’ (S3 Fig in S1 File). We revised the figures accordingly. Kindly find the changes in the S1 File. We compared the rpoB sequence of GC6 and GC16 strains with H37Rv rpoB (KY702773.1)

i) Figure 3 shows the scientific quality and accuracy of the results obtained in this study, however it does not contribute to a better understanding of the work, I recommend removing it

As per the reviewer’s suggestion, we removed the figure 3 from the manuscript

j) MIRU-VNTR is recognized as a fundamental tool for the molecular characterization of M. tuberculosis isolates and has been widely used for this purpose, therefore it is not necessary to include the table of primers used for PCR reactions, unless this work proposed some modifications in these sequences

As per the reviewer’s suggestion, we removed the Primers list from the manuscript. However, we included the references in the MIRU-VNTR methodology section.

k) Although it is not the objective of this work, I believe it is important to include in the discussion information that discards epidemiological links of the patients involved in this study

Thank you so much for your comments. We aimed this study to validate the diagnostic performance of GeneXpert to diagnose TBM by using MGIT 960 as the gold standard, in addition to identify the genotypes and drug susceptibility profiling of circulating Mtb strains among TBM patients in south India. The discordant results between GeneXpert, MGIT 960 and Line probe assay with respect to rifampicin resistance was highlighted. Hence, we didn’t discuss the epidemiological link of the TBM patients. In the present study, we suggest that despite the presence of diverse genotypes of Mtb strains in south India, the EAI family is the most predominant Mtb genotype linked to drug resistant TB among south Indian TBM patients. We consider that the EAI family is driving drug resistant TB in south India and assume that its role in association with multi drug resistant TB will increase in the future. However, epidemiological surveillance of these cases in future may find new patients from their epidemiological links, predict risk factors and develop strategies to control and for the management of drug resistant TB in south India.

l) In this manuscript the authors refer to: “confirmation of isolates of MBTC” and “identify of MBTC” however this acronym is not defined throughout the text, if this acronym refers to the M. tuberculosis Complex, consider the adequacy as the publication by Riojas et al., Int J Syst Evol Microbiol 2018; 68: 324–332.

The acronym of Mycobacterium tuberculosis complex is MTBC. We made the changes in the manuscript and highlighted in the page 5.

Reviewer #2: accept as is.

Thank you so much for your valuable time and review

Submitted filename: Response to reivewers 04-09-2020.docx

Click here for additional data file.

23 Sep 2020

Molecular diagnosis, genetic diversity and drug sensitivity patterns of Mycobacterium tuberculosis strains isolated from tuberculous meningitis patients at a tertiary care hospital in South India

PONE-D-20-08897R1

Dear Dr. Joseph,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Christophe Sola, Pharm.D., Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

The minor changes were adequately made by the authors.

please take care to correct english spelling of some words: pathogenesis not pathogeneses

correct some remaining shells

et al. : italicized

use brand names only once, (first time only) with city and country of origin : genoLyse (Hain LifeSciences, Nehren, Germany) as an example, same for all commercial names

Eppendorf not eppendorf

verify carefully all sentences (grammar, orthograph)

Reviewers' comments: no more comment, to be accepted as is

25 Sep 2020

PONE-D-20-08897R1

Molecular diagnosis, genetic diversity and drug sensitivity patterns of Mycobacterium tuberculosis strains isolated from tuberculous meningitis patients at a tertiary care hospital in South India

Dear Dr. Joseph:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Pr. Christophe Sola

Academic Editor

PLOS ONE