Notch dimerization and gene dosage are important for normal heart development, intestinal stem cell maintenance, and splenic marginal zone B-cell homeostasis during mite infestation.

Cooperative DNA binding is a key feature of transcriptional regulation. Here we examined the role of cooperativity in Notch signaling by CRISPR-mediated engineering of mice in which neither Notch1 nor Notch2 can homo- or heterodimerize, essential for cooperative binding to sequence-paired sites (SPS) located near many Notch-regulated genes. Although most known Notch-dependent phenotypes were unaffected in Notch1/2 dimer-deficient mice, a subset of tissues proved highly sensitive to loss of cooperativity. These phenotypes include heart development, compromised viability in combination with low gene dose, and the gut, developing ulcerative colitis in response to 1% dextran sulfate sodium (DSS). The most striking phenotypes-gender imbalance and splenic marginal zone B-cell lymphoma-emerged in combination with gene dose reduction or when challenged by chronic fur mite infestation. This study highlights the role of the environment in malignancy and colitis and is consistent with Notch-dependent anti-parasite immune responses being compromised in Notch dimer-deficient animals.

Introduction

The evolutionarily con<span class="Chemical">served <span class="Gene">Notch receptors and ligands influence metazoan development and adult tissue homeostasis by directly translating an intercellular interaction into intracellular transcriptional outputs that control cell fate, proliferation, differentiation, and apoptosis [1-3]. Mammals possess 4 Notch receptors (N1 to N4) and 5 Delta/Jagged ligands; all of which are Type I transmembrane proteins. The Notch pathway stands out relative to other signaling pathways in lacking signal amplification: Canonical Notch signaling is initiated when a ligand on one cell engages a Notch receptor on a neighboring cell. This interaction unfolds the receptor’s juxtamembrane region enabling cleavage by the metalloprotease ADAM10. The truncated, cell-membrane-bound polypeptide is then cleaved by the γ-secretase complex freeing the Notch intracellular domain (NICD), which subsequently translocates into the nucleus [2, 4]. NICD associates with the DNA-binding protein CSL (CBF1/Suppressor of Hairless/LAG-1, also known as recombinant binding protein for immunoglobulin Kappa j region (RBPj) in vertebrates) and recruits the coactivator Mastermind-like (Maml), thereby assembling a Notch transcription complex (NTC) that activates Notch target gene expression [4-6].

The <span class="Gene">Notch pathway plays complex and context-dependent roles during development and adult tissue homeostasis. Perturbations in the <span class="Gene">Notch pathway are associated with developmental syndromes [7] and cancers [8, 9]. For example, Notch1 (N1) promotes T-cell development [10-12], whereas Notch2 (N2) is indispensable for marginal zone B-cell (MZB) development [13-20]. Accordingly, elevated Notch1 signaling is oncogenic in T cells driving acute lymphoblastic leukemia (T-ALL) [21, 22], whereas increased Notch2 signaling is associated with splenic MZB transformation [23-25]. Inversely, when Notch signals promote differentiation, the pathway can have a tumor suppressor function with diminished Notch signaling being associated with cancer [26, 27].

How can the <span class="Gene">Notch pathway control multiple, dissimilar outcomes? Because each <span class="Gene">Notch receptor is consumed as it generates a signal and cannot be reused, signal strength has emerged as a key in controlling outcome. Indeed, some Notch-dependent processes are exquisitely sensitive to dosage and manifest both haploinsufficient and triplomutant effects in tissues such as the fly wing [1, 28]. In mammalian tissues, signal strength, defined as the sum of NICD released from all ligand-bound Notch receptors on the cell surface, is a far more important determinant of Notch signaling outcomes than NICD composition (i.e., N1ICD versus N2ICD) [20, 29, 30]. Several mechanisms have been found to modulate signal strength, including receptor glycosylation [31, 32], force-generating ligand endocytosis [33, 34], the contact interface between cells [35], and the ratio of receptor/ligand constitution within the cell [36]. More recently, ligand-dependent signal dynamics were demonstrated to be another key determinant of signaling outcomes [37].

Interestingly, NICD can assemble into dimeric, cooperative NTCs [38] on sequence-paired sites (SPSs), first described in the regulatory regions of the <span class="Species">Drosophila enhancer of split [E(spl)] locus [39]. SPSs consist of 2 DNA-binding sites orientated in a head-to-head manner [39, 40] separated by 15–17 nucleotides [41]. NICD dimerization is facilitated via a conserved interface in NICD’s ANK (Ankyrin repeat) domain. In human N1ICD, this interface consists of Arg1985, Lys1946, and Glu1950. Dimerization in NOTCH1 is effectively abolished by mutating Arg1985 into Ala1985 (R1985A), Lys1946 into Glu1946 (K1946E) or Glu1950 into Lys1950 (E1950K), and loss of dimerization results in reduced activation of dimer-dependent targets [38, 41, 42].

Given the conservation of the dimer interface in most <span class="Gene">Notch receptors (Caenorhabditis elegans being the exception), the conservation of SPSs near known Notch targets [43-45], and the ability of synthetic SPSs to regulate NICD levels [46], we hypothesized that the precise mixture of agnostic and dimer-sensitive targets in a given cell will couple with Notch signal strength and dynamics to shape the responses to Notch signals and contribute to the context-specificity of Notch-related pathologies. To test this hypothesis in a mammalian species, we evaluated mice homozygous or hemizygous for dimerization-deficient alleles of Notch1 (N1) and Notch2 (N2) and found that dimerization contributes to context-specific Notch activity. We report that in the hemizygous state, dimer-deficient Notch molecules are haploinsufficient in the heart and intestine, with lethal consequences when modified by the presence of the ectoparasite, Demodex musculi (fur mites). Mice homozygous for a dimer-deficient N1 allele displayed a female-biased, mild cardiac phenotype consistent with Notch loss-of-function. Conversely, N2 mice displayed a striking over proliferation of MZBs in parasite-infested mice but not in mite-free mice. In time, the cell-type specific gain-of-function activity of N2 produced a splenic marginal zone lymphoma-like phenotype in mite-exposed mice. Mechanistically, these effects are consistent with a shift in target amplitude favoring monomer-driven targets and a potential reduction in negative feedback.

Results

Generation of N1 and N2 dimerization-deficient mice

To interrogate the physiological role of dimerization, we first quantified the effective binding cooperativity of NTC to <span class="Chemical">SPS and <span class="Gene">CSL sites using purified RBPj, the N1 RAM-ANK domain, and a MAML protein in electrophoretic mobility shift assays (EMSAs). We compared the mobility of NTC complexes containing either wild-type (WT) N1ICD or a mutant version with the substitution of a single critical Arginine residue (Arg1974) located in the mouse N1 ANK domain to alanine (Fig 1A and 1B, S1A–S1D Fig). Quantifying the intensity levels of the bands in the image and fitting the data to a binding model that takes into account cooperative binding (see methods), we measured the cooperativity contributed by NTC binding to either an SPS probe (1xSPS) or a CSL probe containing 2 sites (2xCSL). We find that both WT and mutant NTC had no cooperative binding to the 2xCSL probe. In contrast, when the first site was already bound, the WT NTC displayed a 5-fold stronger binding to the second site in the 1xSPS probe compared with binding to the first site. Importantly, NTC containing N1RAICD had no cooperative binding to the second site in the 1xSPS probe (Fig 1A, S1A–S1D Fig). Dimerization-dependent activity of N2ICD and its ability to heterodimerize with N1ICD suggests it too binds cooperatively to SPS (S1F Fig).

Fig 1

Generation of Notch dimerization-deficient mice.

A. Electrophoresis mobility shift assay for purified proteins binding to CSL (magenta) or SPS (green) probes. Balls mark occupancy of 1 or 2 sites. Note that cooperative binding by WT NTC, but not the RA mutant NTC, specifically depletes the SPS probe but not the CSL probe (compare lanes 8 and 13). See text and S1 Fig for detail. B-C. CRISPR-Cas9-mediated double-strand break was used to mediate homologous recombination of a short oligonucleotide into Exon 32 substituting Arg N1 (B-B”) and N2 into Ala (C-C”), generating N1 and N2 animals. To facilitate genotyping, 2 silent mutations (in red) were included in the oligo, abolishing the BglII restriction site while generating an XbaI site in Notch1 (B’). In Notch2, a silent mutation (in green) was included to create a BglII site (C’). Sequencing PCR products containing these regions confirmed the presence of the Arg to Ala substitution in founders; digestion of these PCR products with XbaI (for N1, B”) and BglII (for N2, C”) confirmed the presence of 1 (N1) or 2 (N2) mutant alleles. See S1 Data for raw data. CSL, CBF1/Suppressor of Hairless/LAG-1; MAML, mastermind-like; N1ICD, Notch1 intracellular domain; N1; N2, Notch1/Notch2 RA homozygous; NTC, Notch transcription complex; RA, Arg (N1/N2) to Ala substitution; RBPj, recombinant binding protein for immunoglobulin Kappa j region; SPS, sequence-paired site; WT, wild-type.

A. Electrophoresis mobility shift assay for purified proteins binding to <span class="Gene">CSL (magenta) or <span class="Chemical">SPS (green) probes. Balls mark occupancy of 1 or 2 sites. Note that cooperative binding by WT NTC, but not the RA mutant NTC, specifically depletes the SPS probe but not the CSL probe (compare lanes 8 and 13). See text and S1 Fig for detail. B-C. CRISPR-Cas9-mediated double-strand break was used to mediate homologous recombination of a short oligonucleotide into Exon 32 substituting Arg N1 (B-B”) and N2 into Ala (C-C”), generating N1 and N2 animals. To facilitate genotyping, 2 silent mutations (in red) were included in the oligo, abolishing the BglII restriction site while generating an XbaI site in Notch1 (B’). In Notch2, a silent mutation (in green) was included to create a BglII site (C’). Sequencing PCR products containing these regions confirmed the presence of the Arg to Ala substitution in founders; digestion of these PCR products with XbaI (for N1, B”) and BglII (for N2, C”) confirmed the presence of 1 (N1) or 2 (N2) mutant alleles. See S1 Data for raw data. CSL, CBF1/Suppressor of Hairless/LAG-1; MAML, mastermind-like; N1ICD, Notch1 intracellular domain; N1; N2, Notch1/Notch2 RA homozygous; NTC, Notch transcription complex; RA, Arg (N1/N2) to Ala substitution; RBPj, recombinant binding protein for immunoglobulin Kappa j region; SPS, sequence-paired site; WT, wild-type.

To ask whether loss of cooperativity impacts function in vivo, we used CRISPR-Cas9 to introduce <span class="Gene">amino acid substitutions at <span class="Chemical">Arg1974 and Arg1934 in N1 and N2, respectively. Following the generation of a double-strand break in Exon 32 of N1 or N2, a short oligonucleotide harboring 2 linked mutations was homologously recombined. Nucleotides coding for Arg1974 in N1 (N1R1974) and Arg1934 in N2 (N2R1934) were changed to code for Ala, creating the N1R1974A (N1RA) and N2R1934A (N2RA) mutations, respectively (Fig 1B and 1E). To facilitate genotyping of N mice, silent mutations were introduced to abolish a BglII restriction site while creating an XbaI restriction site in N1 (Fig 1B) or to generate a BglII restriction site in N2 (Fig 1E). Animals that carry 1 (N1 or N2) or 2 (N1 or N2) mutated chromosomes were first identified by digesting PCR products of the targeted chromosomal regions in Exon 32 with XbaI and/or BglII. XbaI cuts the N1 chromosome but not the WT PCR product; BglII cuts the N2 but not the N2 WT PCR products (Fig 1D and 1G). The presence of each respective RA mutation in N1 and N2 founders was subsequently confirmed by direct DNA sequencing (Fig 1C and 1F). Animals deficient for N1 dimerization (N1), N2 dimerization (N2), or both N1 and N2 dimerization (N1; N2) were generated by crossing founders. All were viable, fertile, and without any overt phenotype at P360 in mixed or C57BL6 background (unless otherwise stated, all subsequent results were generated in the mixed background). Because Notch1 signaling plays a central role in T-cell development [10], we expected that loss of Notch1 dimerization would negatively impact the T-cell compartment. However, an analysis of the T-cell compartments in the thymus and spleen as well as thymic T-cell subcompartments (CD4–/CD8– double negative [DN]; single positive [SP], and CD4+/CD8+ double positive [DP]), revealed a normal T-cell compartment in N1 mice relative to WT controls (S2 Fig). These findings and the normal life span of N1 and N2 animals was surprising because we anticipated many dimerization-dependent genes (e.g., Notch-regulated ankyrin repeat protein [Nrarp], Hes [Hairy and Enhancer of Split) 1, Hes5, and Myc; [38, 45]) would be negatively impacted as seen when constitutively active WT and dimer mutant Notch proteins lacking the extracellular domain (NΔE and NRAΔE) are overexpressed in cell culture (S1E Fig).

Homologous N1; N2 mice display barrier defects in the colon and reduced proliferation in the crypt when challenged with 1% DSS

<span class="Gene">Notch1 and <span class="Gene">Notch2 act redundantly during the development and maintenance of the gut to block Klf (Krüppel-like factor)4-induced niche exit of intestinal stem cells [47, 48] and Math1-induced differentiation of secretory cells [49, 50]. However, no pathology was revealed in histological examination of N1; N2 intestines. Several studies have shown that a chronic decrease in Notch signaling compromised the intestinal barrier and exacerbated colitis in different mouse models [51-53]. Under the assumption that a compromised barrier may increase sensitivity to dextran sulfate sodium (DSS)-induced colitis, we asked whether intestinal homeostasis and intestinal barrier were robust in N1; N2 by exposing mice to DSS. When given 2.5% DSS in their drinking water, WT mice developed colitis, as evident by a mild weight loss, whereas co-housed N1; N2 mice exhibited severe weight loss, necessitating euthanizing within 1 week (Fig 2A). To ask if N1; N2 mice were predisposed to develop colitis, we exposed them to 1% DSS, which does not affect the weight of control littermates, even after repeated exposures (Fig 2B and 2C). By contrast, co-housed N1; N2 mice experienced significant weight loss. Some had blood in their stool at end of the third and fourth DSS cycle, and one had to be removed during the first cycle of DSS following severe weight loss and bloody stool. However, all remaining mice recovered well when DSS was removed from the drinking water, even after multiple cycles of treatment (Fig 2B). Histological analysis of the colons revealed injury in WT mice and a complete disruption of colonic epithelium of N1; N2 mice treated with 2.5% DSS (Fig 2D, top). After 4 periods of 1% DSS exposure N1; N2 mice had a more severe injury than controls or 2.5% DSS exposed WT mice (Fig 2D). Relative to baseline (Fig 2E), proliferation in WT crypt epithelia (Krt8/18 positive) was elevated in 1% or 2.5% DSS-treated controls (Fig 2F). By contrast, we noticed a surprising decrease in proliferation competence (less Ki67) and mitosis (Phospho-H3 positive cells) in colonic epithelium following the fourth 1% DSS treatment in crypts of N1; N2 mice (Fig 2G) relative to WT or untreated crypts, suggesting a role for Notch cooperativity within colonic stem cells recovering from injury. Finally, although RA-specific changes in barrier markers were not detected, an upward trend in IL17a and a significant increase in IL4 and IL1ß was observed in DSS-treated N1; N2 relative to WT (Fig 2H), consistent with enhanced inflammatory responses driving colitis in these animals. Thus, these results are consistent with N1; N2 alleles being hypomorphic loss-of-function alleles in maintaining intestinal homeostasis and immune response.

Fig 2

Notch dimerization-deficient mice are sensitized to DSS-induced colitis.

A. All N1; N2 mice exposed to 2.5% DSS treatment had to be euthanized due to severe weight loss before day 7. B. Daily weight measurements of WT (blue) or mutant (red) mice treated with alternate cycles of 1% DSS (gray sections) or no DSS (white sections). C. Survival curve of 1% DSS-treated mice. Three of 4 mutant mice had to be euthanized due to severe weight loss by the fourth cycle. D. Hematoxylin-eosin staining of colonic tissue from DSS-treated mice. Dashed black boxes are enlarged below. Yellow dashed box showed a section with crypts in an otherwise injured colon in 1% DSS-treated N1; N2 mice. E. Ki67 staining of untreated mice with the indicated genotypes, crypt regions (Ki67+) are boxed. F. Increased proliferation competence in colon of DSS-treated WT mice (Krt8/18+, Ki67+ staining outside the box). G. Decreased proliferation competence in colon of N1; N2 mice exposed to 4 rounds of 1% DSS. (H) qPCR on RNA extracted from distal colon of N1; N2 and WT mice treated for 11 days with 1% DSS; n = 3. (*p < 0.05), S1 Data for raw data. DSS, dextran sulfate sodium; H/E, hematoxylin/eosin stain; N1; N2, Notch1 Arg1974Ala Notch2 Arg1934Ala homozygous qPCR, quantitative polymerase chain reaction; WT, wild-type.

A. All N1; N2 <span class="Species">mice exposed to 2.5% <span class="Chemical">DSS treatment had to be euthanized due to severe weight loss before day 7. B. Daily weight measurements of WT (blue) or mutant (red) mice treated with alternate cycles of 1% DSS (gray sections) or no DSS (white sections). C. Survival curve of 1% DSS-treated mice. Three of 4 mutant mice had to be euthanized due to severe weight loss by the fourth cycle. D. Hematoxylin-eosin staining of colonic tissue from DSS-treated mice. Dashed black boxes are enlarged below. Yellow dashed box showed a section with crypts in an otherwise injured colon in 1% DSS-treated N1; N2 mice. E. Ki67 staining of untreated mice with the indicated genotypes, crypt regions (Ki67+) are boxed. F. Increased proliferation competence in colon of DSS-treated WT mice (Krt8/18+, Ki67+ staining outside the box). G. Decreased proliferation competence in colon of N1; N2 mice exposed to 4 rounds of 1% DSS. (H) qPCR on RNA extracted from distal colon of N1; N2 and WT mice treated for 11 days with 1% DSS; n = 3. (*p < 0.05), S1 Data for raw data. DSS, dextran sulfate sodium; H/E, hematoxylin/eosin stain; N1; N2, Notch1 Arg1974Ala Notch2 Arg1934Ala homozygous qPCR, quantitative polymerase chain reaction; WT, wild-type.

N1; N2 hemizygotes display impaired intestinal cell proliferation and fate allocation in the crypt and cause ventricular septum defects in the heart

Both the WT and monomeric <span class="Disease">RA NICD proteins form NTC complexes on <span class="Gene">CSL sites as shown by EMSA (Fig 1A, S1 Fig) and chromatin immunoprecipitation (ChIP) (S4 Fig in [45]), supporting the hypothesis that the signal generated in N1; N2 mice activated sufficient non-SPS gene targets to a level needed to support Notch-dependent decisions. If the Notch RA alleles are hypomorphic, challenging RA mutant mice by lowering protein levels might reveal additional phenotypes. To test this idea, we generated an allelic series in which 1 copy of N1 or N2 was deleted in the N1; N2 or N1; N2 backgrounds, respectively, as well as deleting 1 copy of N1 and 1 copy of N2 in the N1; N2 background. Single N1 or N2 RA hemizygotes resembled RA mutants; however, crossing N1; N2 with N1; N2animals generated significantly fewer N1; N2pups at birth than expected (p < 3×10−9, Chi-squared distribution analysis, S1 Table).

N1; N2double hemizygous animals have a normal life span and no overt phenotype under normal housing conditions but have been reported to develop mild cardiac phenotypes [54, 55]. Given the critical role the circulatory system plays during gestation, we suspected that the poor representation of N1; N2pups at birth was due to defects in cardiac development. Analysis of E16.5 embryos born to mite-free d<span class="Gene">ams revealed highly penetrant and severe <span class="Disease">ventricular septal defects (VSDs) in the hearts of N1; N2 embryos (Fig 3), consistent with heart defects compromising viability. Milder VSDs were also observed with lower penetrance in N1; N2 embryos (Fig 3). Around this time, the colony became infected with fur mites, but the infestation was not immediately detected on the sentinels. Strikingly, when we retroactively segregated the fecundity data in our colony, we observed a significant (p = 0.02, χ2) skewing of the gender ratio in C57BL6 N1 carriers, with a male:female ratio nearing 4:1 in fur mite–infested mice, as opposed to the normal 1:1 ratio in mite-free mice (S2 Table).

Fig 3

Notch1R1974A substitution compromised ventricular septum development.

A. Normal heart with complete septum. B. N1; N2heart with a severe, highly penetrant VSD. The penetrance by age shown below the image. C. N1; N2 heart with a milder, less penetrant VSD. E, embryonic day; N1; N2, Notch1 Arg1974Ala Notch2 Arg1934Ala hemizygous; VSD, ventricular septal defect.

A. Normal heart with complete septum. B. N1; N2heart with a severe, highly penetrant <span class="Disease">VSD. The penetrance by age shown below the image. C. N1; N2 heart with a milder, less penetrant <span class="Disease">VSD. E, embryonic day; N1; N2, Notch1 Arg1974Ala Notch2 Arg1934Ala hemizygous; VSD, ventricular septal defect.

The longest-lived N1; N2pup born to mite-infested, mixed-background d<span class="Gene">ams was much smaller than its litter mates and was euthanized at postnatal day 30 (P30) when it became moribund. Necropsy revealed a striking and complete loss of the intestinal crypts and villi [48, 56–58]. Because complete failure to form an intestine would have not permitted survival outside the womb, we assumed this phenotype reflected loss of intestinal stem cells (Fig 4A and 4A’), consistent with the loss of Ki67 in DSS-challenged N1; N2 mice (Fig 2G). To investigate this phenotype further, we assessed proliferation and fate allocation in the developing intestine of E18-P1 animals with various allele combinations. To examine fate allocation, we stained sections with Alcian blue and analyzed the number of secretory goblet cells, which are known to expand in Notch hypomorphic backgrounds [50, 56]. The small intestines of control or N1; N2P0 pups were indistinguishable (Fig 4B and 4C). By contrast, Alcian blue staining revealed a significant expansion in the goblet cell compartment at P0 in N1; N2pups born to fur mite–infested dams (Fig 4D). In mice free of mites, the overall morphology appeared normal with few regions displaying excess goblets. To assess proliferation, we stained adjacent intestinal sections with antibodies against Ki67 and Phospho-H3. Strikingly, whereas trans-hemizygote N1; N2intestines resembled WT (Fig 4E and 4F), the N1; N2 intestine from mite-infested dames contained very few Ki67 positive cells (Fig 4G and 4H). We also noted a reduction in the number of cells undergoing DNA replication in particular, and competence to self-renew in general, in N1; N2 intestines (S3C, S3C’, S3G and S3G’ Fig). However, upon eradication of D. musculi with permethrin, all E18.5 and all but 1 of 8 surviving P0 N1; N2pups had at least some regions within the small intestine in which Ki67-positive tissue could be observed (Fig 4J, the percentage of Ki67+ crypts; S3I–S3J’ Fig; note reduced proliferation in Ki67-positive crypts of a P1 pup post-mite eradication but coinciding with microbiome colonization). Overall, these data reflect an impaired ability to maintain intestinal stem cells in N1; N2mice, which was exacerbated by D. musculi infestation. Because these phenotypes can reflect complex interactions between multiple tissues in the N1; N2 and N1; N2mice, we deferred the mechanistic analysis of this gene-environment interaction in intestinal stem cells (ISC) maintenance to future investigation.

Fig 4

Notch dimerization-deficient mice are hypomorphic for Notch activity in the gut.

A. Deletion of one N1 and one N2 allele in the RA background (N1; N2) caused lethality; loss of the intestine (presumably due to stem cell exhaustion) was evident in the longest surviving pup at P30. B-C. Alcian blue staining of N1; N2 and N1; N2adult intestines. D. Alcian blue analysis of P0 intestines detected an increase in goblet cell numbers in N1; N2(E-H) Ki67 staining in P0 intestine from control N1; N2(E, F) or N1; N2(G, H) newborn. J. Quantification of Ki67-positive area at the indicated age, among surviving N1; N2pups during (n = 2) and after (n = 12) fur mite infestation; raw data in S1 Data. E, embryonic day; H/E, hematoxylin/eosin stain; N1; N2, Notch1 Arg1974Ala Notch2 Arg1934Ala hemizygous; P, postnatal day; WT, wild-type.

A. Deletion of one N1 and one N2 allele in the RA b<span class="Gene">ackground (N1; N2) caused lethality; loss of the intestine (presumably due to stem cell exhaustion) was evident in the longest surviving pup at P30. B-C. <span class="Chemical">Alcian blue staining of N1; N2 and N1; N2adult intestines. D. Alcian blue analysis of P0 intestines detected an increase in goblet cell numbers in N1; N2(E-H) Ki67 staining in P0 intestine from control N1; N2(E, F) or N1; N2(G, H) newborn. J. Quantification of Ki67-positive area at the indicated age, among surviving N1; N2pups during (n = 2) and after (n = 12) fur mite infestation; raw data in S1 Data. E, embryonic day; H/E, hematoxylin/eosin stain; N1; N2, Notch1 Arg1974Ala Notch2 Arg1934Ala hemizygous; P, postnatal day; WT, wild-type.

The N2 allele drives expansion of MZBs in D. musculi–infested mice

<span class="Chemical">MZBs are exquisitely sensitive to N2 dosage [13–17, 19, 20]. Even a mild reduction in <span class="Chemical">N2ICD can generate a noticeable decline in MZB cell numbers [20]. We used fluorescence-activated cell sorting (FACS) to analyze the splenic B-cell population and asked if N2 displayed haploinsufficient phenotypes in the dose-sensitive MZ compartment. Intriguingly, we observed a significant increase in the MZB compartment in N2 spleens in a mixed-background mouse exposed to D. musculi (Fig 5A). The size of other splenic B-cell subsets, including the MZB precursors (MZPs), follicular B-cells (FoB) and transitional type-2 cells (T2) did not change significantly in either N2 (Fig 5A), N2or N2(Fig 5B), inconsistent with a fate switch.

Fig 5

Loss of Notch2 dimerization expands the splenic MZB compartment in the presence of mites.

A. FACS analysis of N2 fur mite–infested mouse spleens revealed an expansion the MZB compartment relative to WT (+/+). Values for MZP, F0, and T2 splenic B-cell populations were not significantly different; n = 11. B. The MZB cell compartment in heterozygotes. C. LPS-induced differentiation and IgM production in vitro and serum levels of IgM in vivo; n = 4. D. Peritoneal B1a B-cell compartment in mite-infested WT and N2 mice (n = 2). E. The MZB cell compartment in N2 mice after treatment with permethrin, an immunosuppressant used to manage fur mite infestation (PP), after LPS, or after 6 weeks of treatment with HDM extract. (*p < 0.05). Note, although a slight trend is seen in mite-free animals, power analysis indicates it would take 212 mice displaying this trend to reach significance. For LPS-treated mice, it would take 41 animals displaying this trend to reach significance. Only 4 mice were sufficient to reach significance after treatment with HDM. In (A-E) p-values generated by 2-tailed t-test. Error bars represent SD. F. Proliferation in the splenic marginal zone of mite-infested mice: (Fa) The spleen from a mite-infested control animal or (Fb) from N2 mice. Boxed region magnified in Fc and again, in Fc’, asterisk and dot provided for orientation. Magnification noted. (Fd, d’) 60× view of marginal zone from control and HDM-treated N2 mice. Raw data in S1 Data. F0, Filial generation 0; FACS, fluorescence-activated cell sorting; FoB, follicular B-cell; HDM, house dust mite; IgM, immunoglobulin M; LPS, lipopolysaccharide; MZB, marginal zone B-cell; N2, Notch 2 Arg1934Ala homozygous; ns, not significant; P, postnatal day; PP, post-permethrin; T2, type 2 cell; WT, wild-type.

A. FACS analysis of N2 <span class="Chemical">fur mite–infested <span class="Species">mouse spleens revealed an expansion the MZB compartment relative to WT (+/+). Values for MZP, F0, and T2 splenic B-cell populations were not significantly different; n = 11. B. The MZB cell compartment in heterozygotes. C. LPS-induced differentiation and IgM production in vitro and serum levels of IgM in vivo; n = 4. D. Peritoneal B1a B-cell compartment in mite-infested WT and N2 mice (n = 2). E. The MZB cell compartment in N2 mice after treatment with permethrin, an immunosuppressant used to manage fur mite infestation (PP), after LPS, or after 6 weeks of treatment with HDM extract. (*p < 0.05). Note, although a slight trend is seen in mite-free animals, power analysis indicates it would take 212 mice displaying this trend to reach significance. For LPS-treated mice, it would take 41 animals displaying this trend to reach significance. Only 4 mice were sufficient to reach significance after treatment with HDM. In (A-E) p-values generated by 2-tailed t-test. Error bars represent SD. F. Proliferation in the splenic marginal zone of mite-infested mice: (Fa) The spleen from a mite-infested control animal or (Fb) from N2 mice. Boxed region magnified in Fc and again, in Fc’, asterisk and dot provided for orientation. Magnification noted. (Fd, d’) 60× view of marginal zone from control and HDM-treated N2 mice. Raw data in S1 Data. F0, Filial generation 0; FACS, fluorescence-activated cell sorting; FoB, follicular B-cell; HDM, house dust mite; IgM, immunoglobulin M; LPS, lipopolysaccharide; MZB, marginal zone B-cell; N2, Notch 2 Arg1934Ala homozygous; ns, not significant; P, postnatal day; PP, post-permethrin; T2, type 2 cell; WT, wild-type.

<span class="Chemical">MZB cells reside in the splenic m<span class="Chemical">arginal zone where they surveil for blood-borne pathogens. Upon encountering antigens, they rapidly differentiate into immunoglobulin M (IgM)-producing plasmablasts that secrete vast amounts of IgM before undergoing apoptosis [59]. To test IgM levels in vivo, we performed ELISA on serum collected from unstimulated N2 and littermate controls and detected no significant difference in the levels of circulating IgM (Fig 5C). To test for the possibility that loss of N2 dimerization negatively impacted differentiation into IgM-producing plasmablasts upon stimulation, we FACS isolated MZB and FoB cells from mite-exposed N2 and WT spleens. We then stimulated these cells in vitro with lipopolysaccharide (LPS) for 5 days followed by imaging to assess for proliferation and by ELISA to quantify the IgM levels secreted into the medium. Relative to WT MZB cells, there was no appreciable difference in the ability of N2 MZB cells to respond to LPS stimulation (S4A Fig), and ELISA analysis detected no significant difference in the amount of IgM secreted by N2 MZB cells relative to WT controls (Fig 5C). Finally, we tested whether loss of dimerization affected the development of B1 B cells, which predominantly reside in the peritoneal cavity [16]. Together, these data suggest that MZB cell numbers did not increase because of a fate switch or a failure to differentiate properly and are consistent with a proliferative phenotype triggered by the N2 mutation. Notably, FACS analysis also revealed a significant expansion of B1a subset of B1 B-cells between N2 and WT animals but no changes in the levels of the B1b subset (Fig 5D).

In the course of these experiments, the <span class="Species">D. musculi infestation was eradicated with permethrin. Within a few months, as we saw with other phenotypes, mite-free N2 animals no longer showed significant MZB expansion (Fig 5E; post-permethrin [PP]). Because permethrin has been reported to suppress the immune system in mice [60, 61], we assumed permethrin transiently suppressed MZB proliferation. Multiple subsequent analyses over many months, however, failed to detect a significant difference in MZB numbers between permethrin-treated N2 and control mice post eradication, suggesting that this allele was indistinguishable from WT in untreated and pathogen-free animals. Accordingly, we compared MZB numbers between N2spleens (which have decreased MZB numbers due to haploinsufficiency) with N2spleens and found no further reduction in MZB numbers [13, 20]. These data suggest that the N2 allele has neither a haploinsufficient character for the N2 allele in the MZB lineage (Fig 5B) nor a proliferative phenotype triggered cell-autonomously by the N2RA protein. To ask whether environmental stimuli interacted with N2RA within the spleen, mice were exposed to bacterial lipopolysaccharide (LPS) or to dermatitis, produced by twice weekly exposure of the ear epidermis to house dust mite extract (HDM, Dermatophagoides farinae) for 6 weeks (see Methods). MZB numbers were analyzed 8 weeks after the first LPS injection or HDM extract application. LPS-induced transient IgM production but did not significantly change MZB census in the spleen at 8 weeks (Fig 5E, note a trend towards increase was observed in the N2 LPS-treated mice). Importantly, HDM-induced dermatitis elevated MZB numbers only in the N2 mice but not in controls (Fig 5E, HDM). Collectively, these experiments establish that specific gene-environment interactions produce the MZB phenotype in N2 mice.

To assess the rate of splenic B-cell proliferation in mite-infested <span class="Species">mice, we stained C57BL/6J N2 and WT (WT) spleen sections with antibodies against <span class="Gene">Ki67, B220 (to mark the B-cells), and Moma-1 (to mark the marginal zone). We detected defuse B220 staining with elevated Ki67 in marginal zone cells in the N2 spleen (Fig 5F), as well as in germinal centers (rich in FoB cells and strongly B220 positive, S4 Fig), not seen in WT spleen of co-housed animals (S4B–S4D Fig). Increased marginal zone proliferation in N2 relative to WT controls was also detected in spleens after 6 weeks of HDM treatment (Fig 5F, 5D and 5D’). Combined, these data suggest that mite infestation or prolonged HDM exposure lead to enhanced MZB proliferation.

Aged N2 mice have enlarged spleens but only D. musculi–infested mice progress to a splenic MZB lymphoma–like state

As noted here, we ob<span class="Chemical">served no change in life span in N2 or N1; N2 animals. However, as old animals were culled, we noticed enl<span class="Chemical">arged spleens in animals carrying the N2 allele post mite eradication (S5A Fig). Spleens from mice infested by D. musculi were much larger, the most severe splenomegaly exhibited by N2; N1 (Fig 6A–6E), perhaps because they contained a higher contribution of the inflammation-prone Friend virus B–susceptible (FVB) strain [62, 63]. Histologically, spleens from mite-infested N2 carriers lost their typical architectures with N2; N1 spleens showing the greatest disruption. Splenic morphology showed an expansion of the white pulp at the expense of the red pulp. In the most severe cases, the spleens appeared to consist of white pulp only (Fig 6F–6K). In addition, 2 N2; N1 animals had multiple enlarged abdominal lymph nodes. H/E staining revealed a striking morphological similarity to the enlarged spleens from the same animals, suggesting infiltration by a splenic population, or lymphoproliferation within the LN (Fig 6L–6L”). To further characterize the nodes, we stained the enlarged spleens and lymph nodes for the B-cell markers B220 and Pax5. Both were positive for the B-cell markers (Fig 6M–6N’). These features are reminiscent of human splenic MZB lymphoma (SMZL), a clonal B-cell neoplasm that manifests itself in elderly patients and consists of small lymphocytes that infiltrate the lymph nodes and other organs [23-25]. As would be expected, the enlarged lymph nodes and spleens were highly proliferative as indicated by Ki67 and phospho-H3 staining (S5B and S5D Fig). Paradoxically, human SMZL has been associated with hyperactive NOTCH2 signaling due to an N2ICD-stabilizing truncation upstream to the WSSSP sequence in the Pro-Glu-Ser-Thr–rich (PEST) domain of NOTCH2 [64-66], whereas the N2 alleles are hypomorphic in expression assays and in the context of the heart, crypt, and gut barrier. To confirm that this line of CRISPR-modified mice did not inherit a truncated Notch2 allele, we sequenced Exon 34 DNA isolated from lymph node filled with B-cells and found a perfect match to the WT Notch2 allele (ENSMUSG00000027878).

Fig 6

Aged N2 and N2 mice develop severe splenomegaly and tumors reminiscent of SMZL.

A-E. Images of spleens from mice P600-P700 with indicated genotypes. F-K. Severely enlarged spleens are associated with disorganized morphology and the appearance of cells with large nuclear:cytoplasmic ratio (genotypes indicated, see low magnification image in S6E Fig). L. Large enteric lymph nodes detected in the individual shown in (J.), densely populated with cells with large nuclear:cytoplasmic ratio (L’-L”.). Staining the spleen (M.) and lymph node (N.) with Ki67 and the B-cell markers B220 and Pax5 identifies infiltrating cells as spleen-derived B cells. Magnification: 10×. N2, Notch1/Notch2 RA homozygous; RA, Arg (N1/N2) to Ala substitution; SMZL, splenic marginal zone B-cell lymphoma.

A-E. Images of spleens from <span class="Species">mice P600-P700 with indicated genotypes. F-K. Severely enl<span class="Chemical">arged spleens are associated with disorganized morphology and the appearance of cells with large nuclear:cytoplasmic ratio (genotypes indicated, see low magnification image in S6E Fig). L. Large enteric lymph nodes detected in the individual shown in (J.), densely populated with cells with large nuclear:cytoplasmic ratio (L’-L”.). Staining the spleen (M.) and lymph node (N.) with Ki67 and the B-cell markers B220 and Pax5 identifies infiltrating cells as spleen-derived B cells. Magnification: 10×. N2, Notch1/Notch2 RA homozygous; RA, Arg (N1/N2) to Ala substitution; SMZL, splenic marginal zone B-cell lymphoma.

Recently, we identified an unanticipated consequence of increasing the number of <span class="Chemical">SPS sites in the <span class="Species">Drosophila genome, namely, accelerated degradation of phospho-NICD [46]. Further, we demonstrated that this enhanced degradation affects some, but not all, Notch-dependent decisions in Drosophila. Bristle precursor cells requiring a pulse of Notch were refractory to the destabilizing effect, whereas wing margin cells reliant on prolonged Notch signals were sensitive to NICD degradation [46]. To test whether the similarity of our phenotype to SMZL might in part be reflective of N2ICD stabilization, we assessed N2ICD levels in nuclear extracts from WT and N2 MZB cells. Although we see high variability between replicates, we find no evidence for a significant accumulation of nuclear N2ICD in sorted N2 MZBs (S6 Fig). These findings suggest that the gain-of-function phenotypes observed in N2 MZB cells are not due to enhanced N2ICD stabilization. Thus, unlike stabilization seen in many human SMZL patients, increased N2ICD stability is unlikely to be the cause of the SMZL phenotype in the N2 mice.

Loss of Notch dimerization does not impact chromatin accessibility

In N2 <span class="Species">mice, <span class="Gene">Notch pathway activity in T cells and skin is intact, as it relies on Notch1. Assuming the MZB effect is cell autonomous, we asked if the mechanism involved in enabling a haploinsufficient allele to drive MZB expansion involves changes in chromatin accessibility. We performed ATAC-Seq on MZB cells isolated from WT and N2 mice in the absence of fur mites (4 biological replicates each). We mapped reads under the peaks and used EdgeR (https://bioconductor.org/packages/release/bioc/html/edgeR.html) to identify differential accessibility across the genome between samples (see Methods for details). A total of 89,059 peaks were mapped, of which 87,575 were present in both N2 and WT MZB cells with all 8 samples being highly related (R > 92%; Spearman Correlation; Fig 7A). Hence, genome accessibility changed minimally between these MZB cells with only 984 peaks (1.1%) enriched in N2 and 500 (0.56%) in wild type. We next used GREAT to assign genes to all peaks. Based on these assignments, only 108 were unique to WT, and 122 were unique to N2. Importantly, none of the differently enriched peaks were present at the Myb or FoxM1 loci, which are known to drive of B-cell proliferation [67] or next to a known Notch target Dtx1 [13] (Fig 7B). Next, we analyzed DNAse hypersensitive peak upstream of the Myb locus in the ENCODE datasets and identified an enhancer accessible in several cell types, including the kidney. The genome of a kidney-derived cell line used to overexpress constitutively active NΔE and a dimer-deficient version, NΔERA (S1 Fig) was examined by SplitDamID [45]. We detected strong binding to the Myb enhancer using Notch/RBP complementing pairs but not by Notch dimers. These data suggest that the Myb enhancer can respond to monomeric NTC and is insensitive to loss of dimeric NTC activity. Collectively, these data suggest that the changes in MZB gene expression in the N2 animals are not due to changes in chromatin accessibility but may reflect changes in gene expression caused by the loss of Notch dimer NTC complexes at some other loci, most likely the SPS-dependent negative regulators Hes1, Hes5, and Nrarp [45, 68].

Fig 7

Mite-infested N2 activate a proliferation module in MZB.

A. Spearman correlation table measures ATAC-Seq peaks similarity matrix between 8 mice (4 in each genotype). All are >92% similar. B-C. ATAC-Seq data reveal that DNA accessibility was not altered near the Notch target Dtx1 that is down-regulated in expression in N2 animals (B.). WT in blue, N2 in red. Location of validated enhancers containing SPSs are shown. Note, each dimer-dependent site can be composed of either 2 canonical sites (red arrows) or 1 canonical and 1 noncanonical site (blue arrow). Close inspection of ATAC peaks and the proliferation drivers FoxM1i (B.) or Myb (C.) loci. D. The Myb locus was analyzed for chromatin accessibility (Encode DHS and ATAC-seq data generated in this study) and DNA methylation by DAM methyl transferase complementation (SplitDAM). The methylation patterns generated by control D/AM halves are compared to methylation patterns generated by Notch-D/RBPj-AM pairs (which recognizes both dimer-dependent and dimer-independent sites) and Notch-D/Notch-AM pairs (which recognizes only dimer-dependent sites). See text and [45] for additional details. ATAC-Seq, Assay for Transposase Accessible Chromatin sequencing; D/AM, complementing halves of DAM; DAM, DNA adenine methyltransferase; DHS, DNAse hyper sensitive; MZB, marginal zone B-cell; N2, Notch-D, Notch1 fused to the D half of DAM; Notch2 Arg N2to Ala substitution, homozygous; RBPj-AM, recombinant binding protein for immunoglobulin Kappa j region fused to AM half of DAM; SPS, sequence-paired site; TSS, transcription start site; WT, wild-type.

A. Spearman correlation table measures ATAC-Seq peaks similarity matrix between 8 <span class="Species">mice (4 in each genotype). All are >92% similar. B-C. ATAC-Seq data reveal that DNA accessibility was not altered near the <span class="Gene">Notch target Dtx1 that is down-regulated in expression in N2 animals (B.). WT in blue, N2 in red. Location of validated enhancers containing SPSs are shown. Note, each dimer-dependent site can be composed of either 2 canonical sites (red arrows) or 1 canonical and 1 noncanonical site (blue arrow). Close inspection of ATAC peaks and the proliferation drivers FoxM1i (B.) or Myb (C.) loci. D. The Myb locus was analyzed for chromatin accessibility (Encode DHS and ATAC-seq data generated in this study) and DNA methylation by DAM methyl transferase complementation (SplitDAM). The methylation patterns generated by control D/AM halves are compared to methylation patterns generated by Notch-D/RBPj-AM pairs (which recognizes both dimer-dependent and dimer-independent sites) and Notch-D/Notch-AM pairs (which recognizes only dimer-dependent sites). See text and [45] for additional details. ATAC-Seq, Assay for Transposase Accessible Chromatin sequencing; D/AM, complementing halves of DAM; DAM, DNA adenine methyltransferase; DHS, DNAse hyper sensitive; MZB, marginal zone B-cell; N2, Notch-D, Notch1 fused to the D half of DAM; Notch2 Arg N2to Ala substitution, homozygous; RBPj-AM, recombinant binding protein for immunoglobulin Kappa j region fused to AM half of DAM; SPS, sequence-paired site; TSS, transcription start site; WT, wild-type.

Discussion

The possibility that DNA-binding site architecture contributes to <span class="Gene">Notch signaling outcomes has been considered in past studies [43, 44]. NTCs can bind to enhancers with <span class="Gene">CSL binding sites as monomers that function independently of one another. In such a model, the probability of target activation will depend upon the relative abundance of nuclear NICD and the number of CSL sites at a given enhancer [69-71] and/or burst size [72, 73]. SPSs are found in enhancer regions of up to 30% of mammalian Notch targets including Nrarp/NRARP, Hes1/HES1, Hes5, and Myc [30, 38, 42, 74] We have previously documented that approximately 2,500 SPSs were bound by N1ICD dimers in the mouse genome and that dimerization-deficient Notch molecules bind poorly to SPSs in vivo, even at high NICD concentrations [45]. In the murine kidney cell line, mK4, about 15% of Notch targets required NICD dimerization. SPSs and cooperativity also proved critical for the oncogenic activity of N1ICD in murine T cells, where NICD dimerization at a distant enhancer was required for Myc activation [42]. Thus, Notch targets are either agnostic to dimerization or sensitive to its presence, leading to the hypothesis that cooperativity may modulate Notch responses at physiological NICD concentrations. Recently, evidence that SPSs contribute to an increased probability of transcriptional activation and increased transcriptional burst duration during Drosophila embryonic development was reported [72].

Although our study concludes that embryonic development in the <span class="Species">mouse proceeds normally in the presence of <span class="Gene">Notch receptors lacking cooperativity, it nonetheless uncovered important contributions of cooperativity to mammalian development and homeostasis under environmental stress. NotchRA phenotypes are greatly enhanced by reduced gene dosage in Notch1, which causes VSDs ([75-77]) or in both Notch1 and Notch2 in the gut. The developmental phenotype uncovered when N1 dose is reduced (in N1) resembles other Notch pathway deficiencies known to cause a wide range of heart defects, including VSDs, and are milder than a weak hypomorphic Notch1/2 allele on the B6 background [20]. Interestingly, dosage alone did not impact the ability of the N2 allele to control development and homeostasis of the dosage-sensitive MZBs in parasite-free mice, even in the hemizygote state (N2).

Strikingly, loss of cooperativity-dependent contributions to homeostasis becomes acute when mutant animals are burdened with exoparasites, n<span class="Gene">amely, <span class="Chemical">fur mites. Interestingly, when the environment includes unmanaged exoparasite infestation, dimerization-deficient cooperativity mutant receptors can behave as hypomorphic (loss-of-function) alleles in some contexts (intestinal barrier formation, ventricular septum formation, intestinal stem cell self-renewal, female survival) yet remain indistinguishable from the WT allele in many other tissues or can trigger a similar disease as a gain-of-function allele (SMZL) in a cell type that otherwise appeared unaffected by the mutation. Note that in N2 mice, Notch pathway activity in T cells and skin, where Notch1 is present, are identical to the WT. Thus, the defect is more likely to reside in the B-cell lineage than elsewhere, although this remains to be examined more fully in the future. We propose these behaviors can be explained by assuming that the balance between targets agnostic to dimerization (like Myb) and those dependent on cooperativity on SPSs (like Hes1, Hes5, Nrarp) varies by cell type (Fig 8). Moreover, these differences in dependence upon SPS versus non-SPS target gene regulation between tissues can be further exposed by additional stressors such as environmental insults (i.e., exoparasites) or changes in gene dose. We propose that accessible SPSs can act as a “sink,” holding on to NICDs that otherwise will be available to regulate monomer-dependent enhancers. If true, more N2RAICD may be available to regulate key targets. Importantly, this insight may translate to other transcription factors where variants of uncertain significance are associated with developmental syndromes or neoplastic disease. Such mutations may control molecular behaviors integrating the environment with specific cooperative interactions in affected tissues.

Fig 8

A schematic summary of the findings with a hypothetical mechanism.

Notch integrates environmental cues (mites, cytokines) to drive proliferation in MZB (Notch2) and block differentiation in (ISCs, Notch1 and 2). Activation of SPS-dependent Hes repressors creates a negative feedback tuning of transcription amplitude in MZB and driving the response magnitude in ISCs. In Notch mutants, SPS-dependent Hes gene expression is dampened, and increased availability of NICDRA to monomer-driven target due to reduce trapping on accessible SPS may also contribute. Repeated DSS treatment, or hemizygosity in Notch mutants, exposed insufficient blockade of pro-differentiation signals in ISC, most likely delivered via immune cells or cytokines (IL1ß, 4, or 17A) in DSS-treated mice. Fur mite infestation creates an environment for runaway proliferation in MZB, and enhanced dosage effects in Notch mutants leading to complete loss of ISC postnatally even without DSS challenge. Asterisk marks hypothetical targets selected for their known function in driving B-cell proliferation [67]. DSS, dextran sulfate sodium; ISC, intestinal stem cell; MZB, marginal zone B-cell; NICD, Notch intracellular domain; SMZL, splenic marginal zone B-cell lymphoma; SPS, sequence-paired site.

<span class="Gene">Notch integrates environmental cues (mites, cytokines) to drive proliferation in <span class="Chemical">MZB (Notch2) and block differentiation in (ISCs, Notch1 and 2). Activation of SPS-dependent Hes repressors creates a negative feedback tuning of transcription amplitude in MZB and driving the response magnitude in ISCs. In Notch mutants, SPS-dependent Hes gene expression is dampened, and increased availability of NICDRA to monomer-driven target due to reduce trapping on accessible SPS may also contribute. Repeated DSS treatment, or hemizygosity in Notch mutants, exposed insufficient blockade of pro-differentiation signals in ISC, most likely delivered via immune cells or cytokines (IL1ß, 4, or 17A) in DSS-treated mice. Fur mite infestation creates an environment for runaway proliferation in MZB, and enhanced dosage effects in Notch mutants leading to complete loss of ISC postnatally even without DSS challenge. Asterisk marks hypothetical targets selected for their known function in driving B-cell proliferation [67]. DSS, dextran sulfate sodium; ISC, intestinal stem cell; MZB, marginal zone B-cell; NICD, Notch intracellular domain; SMZL, splenic marginal zone B-cell lymphoma; SPS, sequence-paired site.

The diverse cell types responding to a cutaneous parasite must reflect a systemic change driven by the parasite. Because we could replicate the impact on <span class="Chemical">MZB proliferation in short exposures to dust mite extract, live parasite is not needed, and the response is likely mediated by an immune cell (or cytokine) intermediate. <span class="Disease">Dermatitis is typically associated with both skin-produced cytokines (e.g., IL-33, -17C, and TSLP), and a skewing of CD4+ T cells into T helper 2 (Th2) and their associated cytokines (e.g., IL-4,-5,-13, [78]). Similarly, fur mite infestation has been shown to increase the level of different cytokines (e.g., IL-6 and IL-12; [79] and IL-4 and -5 [80, 81]). Although the exact axis linking anti-parasite immune responses and splenic marginal zone lymphoma, intestinal homeostasis, female/male ratios, and heart development are yet to be identified, this study highlights the role of the environment in chronic disease, including ulcerative colitis and a smoldering malignancy such as SMZL. Combined with the significantly better outcomes in SMZL patients with activated Notch2 alleles [65], one has to wonder about the role of the immune environment in onset and progression of human SMZL patients with Notch2 mutations.

Methods

Ethics statement

<span class="Species">Mice were housed at CCHMC’s animal facility in accordance with IACUC’s animal welfare regulations. The use of animals for the experiments described in this work was approved <span class="Chemical">through protocol number IACUC2018-0105.

Animals

To generate the RA alleles, 3 gRNAs (g25, g26, and g27) that t<span class="Chemical">arget sites surrounding the R1934 codon in N2 were tested for their genome editing activities. Briefly, plasmids carrying the guide sequence under a U6 promoter and Cas9 were transfected into <span class="Gene">MK4 cells. Cells were harvested 2 days after transfection and PCR amplification, with primers flanking the target sites, was performed on genomic DNA isolated from the transfected cells. PCR products were then subjected to T7 endonuclease I (T7E1) assay. Cleavage products generated by T7E1 are indicative of indels present in the PCR products as a result of genomic DNA breakage caused by Cas9-gRNA and the subsequent repair by NHEJ. A gRNA (g3) for Tet2 that was known to have good editing activity was included as positive control. Sixteen mice were obtained from injection of g27 (GGCATCCAGATCGGTTACA), Cas9 mRNA, and a donor oligo (shown in Fig 1, g27 underlined in blue) into 1-cell embryos. Digestion of PCR products with BglII showed that 8 contained products with the BglII site, 4 of which were homozygotes. Sequencing of PCR products confirmed that all had the correct R1934A mutations. Because we mated the homozygote mice to each other, we identified potential second site mutations with the CCTop tool ([82]; https://crispr.cos.uni-heidelberg.de). g27 matches to Notch2 and to a few loci with 4 mismatches (Lemd1, Ccm2, Papolg, Tubb2b and Tubb6) falling within an Exon and next to a PAM sequence (no loci had fewer than 4 mismatches to this gRNA). PCR products from potential off-target sites were sequenced, and no mutations were identified in DNA isolated from any of the founders. For Notch1, a similar process led to the selection of a gRNA (CATTCGGGCATCCAGATCTG), which was injected with Cas9 mRNA and a donor oligo carrying mutations that change R1974 to alanine into 1-cell embryos. PCR products from 24 animals were digested with BglII and XbaI, respectively. Only 1 heterozygote founder carried the R1974A mutation, confirmed by sequencing. This founder was outcrossed into our mixed colony, having a single possible 4-mismatch target in the pseudogene Vmn1r-ps6. In the C57BL6line, the same gRNAs were used. A single heterozygote founder pair was bred within the C57BL6line.

DSS treatment/colitis induction

For colitis induction, <span class="Species">mice were given 1% to 2.5% DSS in autoclaved drinking water for up to 14 days. Weight was measured every day, and stool was checked for changes to monitor disease progression; in case of severe weight loss (>15%) or blood in stool, mice were euthanized. For recovery, mice were given normal drinking water for 14 days before starting the next cycle of DSS treatment, up to 4 cycles of injury and recovery. At the end of treatment, mice were euthanized, and tissue was collected for analysis.

LPS injection/dermatitis induction

To stimulate the immune system with bacterial antigens, we injected adult <span class="Species">mice intraperitoneally twice with <span class="Gene">LPS (0.5 ug/kg bodyweight, once a month, Table 1) over an 8-week period. Blood was collected from the submandibular vein once per week to analyze IgM production by ELISA. The mice were euthanized after the eighth week and their spleens were harvested for histological analyses.

Table 1

Key resources: All used materials including primer and antibodies.

Reagent or Resource	Source	Identifier
Antibodies
Goat Anti-Mouse IgM-UNLB	Southern Biotech	1021–01
Goat Anti-Mouse IgM-HRP	Southern Biotech	1021–05
Lyophilized Rabbit Polyclonal Antibody Ki67 Antigen	Novocastra	NCL-Ki67p
Cleaved Caspase-3 (Asp175) (5A1E) Rabbit mAb	Cell signaling	9664P
Phospho-Histone H3 (Ser10) Antibody	Cell signaling	9701S
Purified anti-Pax-5 Antibody	Biolegend	649702
Cy3-AffiniPure Donkey Anti-Rabbit IgG (H+L)	Jackson ImmunoResearch	711-165-152
Cy3 AffiniPure Donkey Anti-Rat IgG (H+L)	Jackson ImmunoResearch	712-165-150
Alexa Fluor 594 anti-mouse/human CD45R/B220 [RA3-6B2]	Biolegend	103254
Anti-Metallophilic Macrophages antibody [MOMA-1]	Abcam	ab51814
Alexa Fluor 488-AffiniPure F(ab')2 Fragment Donkey Anti-Rabbit IgG (H+L)	Jackson ImmunoResearch	711-546-152
Alexa Fluor 647 anti-mouse IFN-γ [XMG1.2]	Biolegend	505816
Biotin anti-mouse IL-5 [TRFK4]	Biolegend	504401
Alexa Fluor 488 anti-mouse IL-17A [TC11-18H10.1]	Biolegend	506909
Alexa Fluor 647 anti-mouse CD3ε Antibody	Biolegend	152319
Anti-Cytokeratin 8+18 antibody (ab194130)	Abcam	ab194130
Donkey anti-Guinea Pig IgG, Alexa -2788875	Millipore Sigma	AP193SA6
Mouse NKp46/NCR1 Antibody	R&D Systems	AF2225-SP
Alexa Fluor 647 AffiniPure F(ab')2 Fragment Donkey Anti-Goat IgG (H+L)	Jackson ImmunoResearch	705-606-147
anti-mouse/human CD45R/B220 [RA3-6B2]	Biolegend	103206
anti-mouse CD23 [B3B4]	Biolegend	103222
anti-mouse CD21/CD35 (CR2/CR1) [7E9]	Biolegend	123416
anti-mouse CD93 (AA4.1)	Biolegend	136505
anti-mouse IgM [RMM-1] 50 μg	Biolegend	406505
anti-mouse IgD [11-26c.2a]	Biolegend	405723
anti-mouse CD45.1 [A20]	Biolegend	110706
anti-mouse CD45.2 [104]	Biolegend	109814
Anti-Mouse CD3e Clone 145-2C11	BD Biosciences	553063
anti-mouse Ly-6G [1A8]	Biolegend	127615
anti-mouse/human CD11b [M1/70]	Biolegend	101216
anti-mouse/human CD45R/B220	Biolegend	103227
anti-mouse TCR β chain [H57-597]	Biolegend	109208
APC/Cy7 anti-mouse CD45R/B220	Biolegend	103224
anti-mouse CD5 [53–7.3]	Biolegend	100626
Rat Anti-Mouse CD19	Biolegend	bdb563557
CD4 Monoclonal Antibody (RM4-5), PerCP-Cyanine5.5	eBiosciences	45-0042-82
CD8a Monoclonal Antibody (53–6.7), FITC	eBiosciences	11-0081-82
CD8a Monoclonal Antibody (53–6.7), PE-Cyanine7	eBiosciences	25-0081-82
TCR beta Monoclonal Antibody (H57-597), APC-eFluor 780	eBiosciences	47-5961-82
APC anti-mouse CD25 Antibody (clone PC61)	Biolegend	102011
CD4 Monoclonal Antibody (GK1.5), PE	eBiosciences	12-0041-82
PE/Cy7 anti-mouse CD117 (c-Kit) Antibody	Biolegend	105814
CD3e Monoclonal Antibody (145-2C11), FITC	eBiosciences	11-0031-82
CD19 Monoclonal Antibody (eBio1D3 (1D3)), PE	eBiosciences	12-0193-82
Notch2 (D76A6) XP	Cell signaling	5732
monoclonal anti-b-actin (AC-15)	Sigma-Aldrich	A5441
ECL Rabbit IgG, HRP-linked whole AB (from Donkey)	GE Healthcare	NA934
ECL Mouse IgG, HRP-linked whole AB (from Donkey)	GE Healthcare	NA931
Bacterial and Virus Strains
BL21 (DE3) Tuner Competent cells	Novagen	70623
Biological Samples
Chemicals, Peptides, and Recombinant Proteins
XbaI	NEB	R0145
BglII	NEB	R0144
Mouse IgM-UNLB	Southern Biotech	0101–01
DyLight649(Cy5)-conjugated Streptavidin	Jackson Immunoresearch	016-490-084
Dextran sulfate sodium salt (DSS, M.W. approximately 36,000–50,000, colitis grade)	MP Biomedicals	0216011050
Red blood cell lysis buffer (10x)	BioLegend	420301
BSA	Fisher Scientific	Bp1600-100
FBS	HyClone	AE24573269
FBS	Sigma-Aldrich	F2442
Nunc MaxiSorp flat bottom	Thermo Fisher Scientific	44-2404-21
TMB substrate solution	Thermo Fisher	N301
RPMI-1640	Sigma-Aldrich	R0883
Gentamicin	Gibco B.R.L	15750–060
β-mercaptoethanol	Sigma-Aldrich	M7522
U-bottom 96-well	Thermo Scientific	174925
Superfrost Plus microscope slides	Fisher Scientific	12-550-15
Xylene	Fisher Scientific	X3P
Alcian Blue 8GX	Sigma-Aldrich	A3157
Nuclear Fast Red	Vector/Sigma-Aldrich	H-3403/N3020
Trilogy	Cell Marque	920P-10
Normal donkey serum	Jackson ImmunoResearch	017-000-121
Prolong Gold Antifade Reagent	Invitrogen	P36930
Complete Protease Inhibitor Cocktail	Roche	11697498001
Red Blood cell lysis buffer	BioLegend	420301
ACK lysis buffer	Lonza	10-548E
Cell strainer (40 μm)	Falcon	08-771-1
Cell strainer (70 μm)	Falcon	08-771-2
Critical Commercial Assays
Supersignal West Femto Chemiluminescent substrate kit	Thermo Scientific/Fisher Scientific	P134095
PureLink RNA Mini kit	Life Technologies (Invitrogen)	12183025
Superscript II reverse transcriptase	Invitrogen	18064014
iTaq Universal SYBR Green Supermix	Bio-Rad	1725121
Zombie VioletTM Fixable Viability kit	BioLegend	423113
Micro RNAeasy kit	Qiagen	74106
Zymo DNA Clean and Concentrator kit	Zymoresearch	D4029
Deposited Data
SplitDam data	[45]	GEO: GSE70402
ATAC-Seq data	This paper	GEO: GSE149992
Experimental Models: Cell Lines
mK4 cells	[93]	N/A
Experimental Models: Organisms/Strains
N1RA	This paper	N/A
N2RA	This paper	N/A
N1 deletion	[94]	Notch1tm1Con
N2 lacZ	[95]	N/A
C57BL/6	Charles River	027
FVB/N	Harlan	N/A
B6D2F2	Harlan	N/A
Oligonucleotides
N1-deletion fwd: ACGATATCGTGGTGCATACGCTCCTGTGCG	[94]	N/A
N1-deletion rev: GTCAGTTTCATAGCCTGAAGAACG	[94]	N/A
N1RA fwd: GCGGGATTCCTAGCCTGGTTACTC	This paper	N/A
N1RA rev: GTCCTTGTTGGCTCCGTTCTTCAG	This paper	N/A
N2-LacZ fwd: GTTGCAGTGCACGGCAGATACACTTGCTGA	[95]	N/A
N2-lacZ rev: GCCACTGGTGTGGGCCATAATTCAATTCGC	[95]	N/A
N2RA fwd: ACGGCTCATCCCTGACATGAG	This paper	N/A
N2RA rev: TCCTCTCAGAAGGGTAGCAAGTC	This paper	N/A
Actb qPCR fwd: GGCTGTATTCCCCTCCATCG	Harvard PrimerBank	6671509a1
Actb qPCR rev: CCAGTTGGTAACAATGCCATGT	Harvard PrimerBank	6671509a1
Fos qPCR fwd: CGGGTTTCAACGCCGACTA	Harvard PrimerBank	6753894a1
Fos qPCR rev: TTGGCACTAGAGACGGACAGA	Harvard PrimerBank	6753894a1
Gapdh qPCR fwd: AGGTCGGTGTGAACGGATTTG	Harvard PrimerBank	6679937a1
Gapdh qPCR rev: TGTAGACCATGTAGTTGAGGTCA	Harvard PrimerBank	6679937a1
Myb qPCR fwd: AGACCCCGACACAGCATCTA	Harvard PrimerBank	19526459a1
Myb qPCR rev: CAGCAGCCCATCGTAGTCAT	Harvard PrimerBank	19526459a1
Notch1 qPCR fwd: GATGGCCTCAATGGGTACAAG	Harvard PrimerBank	13177625a1
Notch1 qPCR rev: TCGTTGTTGTTGATGTCACAGT	Harvard PrimerBank	13177625a1
Notch2 qPCR fwd: ATGTGGACGAGTGTCTGTTGC	Harvard PrimerBank	33859592a1
Notch2 qPCR rev: GGAAGCATAGGCACAGTCATC	Harvard PrimerBank	33859592a1
Pax5 qPCR fwd: CCATCAGGACAGGACATGGAG	Harvard PrimerBank	6679213a1
Pax5 qPCR rev: GGCAAGTTCCACTATCCTTTG	Harvard PrimerBank	6679213a1
IL1b-qPCR-fwd: CAACCAACAAGTGATATTCTCCATG	[96]	N/A
IL1b-qPCR-rev: GATCCACACTCTCCAGCTGCA	[96]	N/A
IL4-qPCR-fwd: AGATGGATGTGCCAAACGTCCTCA	[97]	N/A
IL4-qPCR-rev: AATATGCGAAGCACCTTGGAAGCC	[97]	N/A
Claudin4-qPCR-fwd: GTCCTGGGAATCTCCTTGGC	Harvard PrimerBank	6753440a1
Claudin4-qPCR-rev: TCTGTGCCGTGACGATGTTG	Harvard PrimerBank	6753440a1
ZO1-qPCR-fwd: GCACCATGCCTAAAGCTGTC	[98]	N/A
ZO1-qPCR-rev: ACTCAACACACCACCATTGC	[98]	N/A
TNFa-qPCR-fwd: CCCTCACACTCAGATCATCTTCT	Harvard PrimerBank	7305585a1
TNFa-qPCR-fwd: GCTACGACGTGGGCTACAG	Harvard PrimerBank	7305585a1
IL17A-qPCR-fwd:GACGCGCAAACATGAGTCC	This paper	N/A
IL17A-qPCR-rev: TTTGAGGGATGATCGCTGCT	This paper	N/A
N1RA sgRNA fwd: caccgCATTCGGGCATCCAGATCTG	This paper	N/A
N1RA sgRNA rev: aaacCAGATCTGGATGCCCGAATGc	This paper	N/A
N2RA sgRNA fwd: caccGGCATCCAGATCGGTTACA	This paper	N/A
N2RA sgRNA rev: aaacTGTAACCGATCTGGATGCC	This paper	N/A
N1RA donor oligo: g*c*t*tgcatttagatcaccctgcctgaacccatccctgccttccagatcctgctccggaacgcagctactgatctagatgcccgaatgcatgatggcacaactccactgatcctggctgcgcgcctggccgtg*g*a*g	This paper	N/A
N2RA donor oligo: a*g*c*caggcgggcagccaggatcaggggggtagtaccatcgttcattctggcatccagatctgttaccgcgttgcggatcagaatctagaagagaagcagagaagtgtcccttagataaggaaaaaga*a*t*g	This paper	N/A
2xCSL(EMSA): cgaaCGTGGGAAacctaggctagaggcacCGTGGGAAactagtgcgggcgtggct	This paper	N/A
1xSPS(EMSA): gctaCGTGGGAAaggagcaaactgcgtTTCCCACGttcgtagtgcgggcgtggct	This paper	N/A
5’IRDye-700_complementary_oligo(EMSA): agccacgcccgcact	This paper	N/A
5’IRDye-800_complementary_oligo(EMSA): agccacgcccgcact	This paper	N/A
Recombinant DNA
Plasmid: N1ΔE	[30]	N/A
Plasmid: N1RAΔE	This paper	N/A
pSpCas9(BB)	[99]	48139
pTXB1-Tn5	[92]	N/A
Software and Algorithms
Image lab	Bio-Rad Laboratories	https://www.bio-rad.com/en-us/product/image-lab-software?ID=KRE6P5E8Z
Prism 8	Graph Pad	www.graphpad.com
CCTop tool	[82]	https://crispr.cos.uni-heidelberg.de
NIS-Elements Advanced Research software	Nikon	N/A
FlowJo software v9.7	Becton Dickinson	https://www.flowjo.com
Other
LPS from Salmonella enterica	Sigma-Aldrich	L6143
HDM extract (Dermatophagoisdes farina)	Greer Laboratories Inc./Fisher Scientific	NC0277827

AB, antibody; ACK, ammonium-chloride-potassium; BSA, bovine serum albumin; CSL, CBF1/Suppressor of Hairless/LAG-1; DSS, decxtran sodium sulfate; EMSA, electrophoretic mobility shift assay; FBS, fetal bovine serum; HDM, house dust mite; HRP, horseradish peroxidase; IgG, immunoglobulin G; IgM, immunoglobulin M; LPS, lipopolysaccharide; mAb, monoclonal antibody; N1, Notch1; N1ΔE, constitutive active Notch1 lacking extracellular domain; N2, Notch2; qPCR, quantitative PCR; RA, Arg-Ala substitution; RPMI, Roswell Park Memorial Institute; sgRNA, short guide RNA; SPS, sequence-paired site; TMB, 3,3′,5,5′-Tetramethylbenzidine; UNLB, unlabeled.

AB, antibody; <span class="Gene">ACK, <span class="Gene">ammonium-chloride-potassium; BSA, bovine serum albumin; CSL, CBF1/Suppressor of Hairless/LAG-1; DSS, decxtran sodium sulfate; EMSA, electrophoretic mobility shift assay; FBS, fetal bovine serum; HDM, house dust mite; HRP, horseradish peroxidase; IgG, immunoglobulin G; IgM, immunoglobulin M; LPS, lipopolysaccharide; mAb, monoclonal antibody; N1, Notch1; N1ΔE, constitutive active Notch1 lacking extracellular domain; N2, Notch2; qPCR, quantitative PCR; RA, Arg-Ala substitution; RPMI, Roswell Park Memorial Institute; sgRNA, short guide RNA; SPS, sequence-paired site; TMB, 3,3′,5,5′-Tetramethylbenzidine; UNLB, unlabeled.

Mild <span class="Disease">dermatitis was induced by application of HDM (<span class="Species">Dermatophagoides farina, Table 1) extract on the ears as described [83]. In brief, the ear lobes of adult mice were gently stripped 5 times with surgical tape and 20 ug of HDM dissolved in autoclaved PBS was administered to each ear twice weekly for 6 weeks. Mice were euthanized, and spleen harvested for histology and MZB numbers determination.

Antibodies

A full list of antibodies is provided in the Key Resource table (Table 1). The following antibodies were used for FACS analysis: Anti-<span class="Species">mouse/<span class="Species">human CD45R/B220, anti-CD23, anti-CD21/CD35 (CR2/CR1), anti-CD93 [AA4.1], anti-mouse IgM, anti-IgD, anti-CD45.1, anti-CD45.2, anti-CD3ε, anti-Ly-6G/Ly-6C(Gr-1), anti-CD11b, anti-TCRb, and anti-CD5 were all purchased from Biolegend. Anti-Mouse CD19 was purchased from BD Biosciences. Rabbit Anti-Ki67 (Novocastra), rabbit anti-cleaved caspase 3 (Cell signaling), rabbit anti-Phospho-Histone H3 (Ser10) (Cell signaling), rat anti-Pax5 (Biolegend), Guinea pig anti-Cytokeratin 8+18 antibody, and FITC rat anti-mouse/human CD45R/B220 (BioLegend) were used for fluorescence immunohistochemistry. Anti-rabbit Alexa Fluor Cy3 (Jackson ImmunoResearch), anti-rabbit Alexa Fluor 647 (Jackson Immunoresearch), anti-rat Cy3 (Jackson Immunoresearch), and Alexa Fluor anti-guinea pig 647 secondary antibodies were used for in fluorescence immunohistochemistry. Notch2 (D76A6) XP (Cell signaling) and HRP-linked rabbit IgG (GE healthcare) secondary antibodies were used for western blot analysis.

Protein purification and EMSA

The <span class="Species">mouse <span class="Gene">RBPj (aa 53–474), mouse N1ICD (aa 1744–2113), mouse N1RAICD (aa 1744–2113), and human SMT3-MAML1 (aa 1–280) proteins were expressed and purified from bacteria using affinity (Ni-NTA or Glutathione), ion exchange, and/or size exclusion chromatography as previously described [84]. The purity of proteins was confirmed by SDS-PAGE with Coomassie blue staining, and concentrations were determined by absorbance measurements at UV280 with calculated extinction coefficients. EMSAs were performed using native polyacrylamide gel electrophoresis as previously described [85, 86]. Fluorescent labeled probes (1.75 nM/each probe) were mixed with increasing concentrations of purified RBPj protein in 4-fold steps (from 2.5 to 640 nM) with or without the indicated purified N1ICD and MAML proteins at 2μM. Acrylamide gels were imaged using the LICOR Odyssey CLx scanner.

EMSA quantitation

To quantitatively analyze the EMSA experiments, we first extracted the grayscale intensity of each band in each lane of the EMSA gels (S1A and S1B Fig). We then fitted the data to a 2-site binding model that takes into account cooperative binding to the second site. The model calculates the binding probability assuming equilibrium binding kinetics (Michaelis-Menten) to 2 sites. Cooperativity is taken into account by assuming that the binding dissociation constant of a complex to the second site is divided by a cooperativity factor C, n<span class="Gene">amely that . The probabilities to find the probe bound by 0, 1, or 2 complexes are given by where is the statistical weight associated with binding of the NTC complex to a <span class="Gene">CSL site, and K is the dissociation constant to a single site. If the cooperativity factor, C, is equal to 1, then the binding to the 2 sites is noncooperative. C>1 corresponds to positive cooperativity (second binding is enhanced). C<1 corresponds to negative cooperativity (second binding is suppressed).

Because we observe that even at high concentrations of <span class="Gene">RBPj, the 1-site state is never depleted (e.g., see RBPj on CSL), we assumed that there is only some fraction of the probes, f<1, that binds 2 complexes and another fraction, (1−f), that can only bind 1 complex. In this case, the probability to find the probe is modified to

We then fit the experimental data (normalized band intensities) to t<span class="Gene">hese expressions. The fitting par<span class="Gene">ameters are K, and f. The parameters are extracted for each experiment separately.

To get an estimation of the confidence interval on the fitting par<span class="Gene">ameters, we use a bootstrap method to randomly generate 5,000 data sets with the s<span class="Gene">ame statistical properties as the experimental data sets (the same mean and standard deviation of band intensities). We then perform the same fitting procedure on all bootstrapped data to obtain the 95% confidence interval on the fitting parameters.

Flow cytometry

For materials used, see Key resource table (Table 1). <span class="Chemical">MZB and FoB cells were sorted by FACS as described in [87]. Single-cell splenocytes were prepared by placing the spleen in a petri dish and mincing it with a razor blade. The disrupted spleen tissue was then transferred into a 50-ml falcon tube and pipetted up and down in 5 ml of ice-cold 1% BSA (Fisher Scientific) in <span class="Chemical">PBS and briefly vortexed to ensure thorough disruption. Single-cell suspensions were obtained by passing the disrupted spleen tissue through a 70-μm strainer (Falcon). The strainer was then rinsed with 5 ml ice-cold 1% BSA/PBS and the single-cell preparation pelleted by centrifuging at 2,000 rpm, for 5 minutes followed by red blood cell lysis (BioLegend), after which the cells were pelleted at 2,000 rpm, for 5 minutes, and resuspended in ice-cold 3% BSA in PBS before cell counting. Single-color antibody stained as well as unstained controls were prepared with 3 million splenocytes each, 1.5 μl (0.75 μg) of each antibody was added into the corresponding single-color control tube. For MZB detection, approximately 10 million cells (in 1 ml 3% BSA) were distributed into Eppendorf tubes, and 7.5 μl of the antibody mix (2.5ul each of FITC anti-B220, PE/Cy7 anti-CD23 and PerCP/Cy5.5 anti-CD21) were added into each tube. They were then incubated at 4°C for 60 minutes before sorting for B220+CD21hiCD23lo MZB cells and B220+CD21intCD23hi FoB cells. To isolate MZB (CD93-B220+CD19+IgM+IgD+CD23lo), FoB (CD93-B220+CD19+IgM+CD21+), MZP (CD93-B220+CD19+CD21hiIgMhiIgDhiCD23hi), and T2 B-cells (CD93+B220+IgM+CD23+), single-cell splenocytes were incubated with the APC/Cy7 anti-B220, PE/Cy7 anti-CD93, Hoechst blue anti-CD19, FITC anti-IgM, AmCyan anti-IgD, Percp/Cy5.5 anti-CD21 and Pacific blue CD23 and FACS sorted. To analyze peritoneal B1 B-cell populations, peritoneal cells were collected as described in [88] and incubated with APC/Cy7 anti-B220, PE anti-TCRb, FITC anti-CD11b, PE/Cy7 anti-CD23, and APC anti-CD5. They were then gated into B2 B-cells (B220+CD23+) and B1 B-cells (B220+CD23-). B1 B-cells were then gated into B1a (CD11b+CD5+) and B1b (CD11b+CD5-) B-cells.

For T-cell analysis, <span class="Disease">thymus and spleen were harvested and disrupted by gentle grinding of tissue with a pestle (CellTreat) on a 40-μm cell strainer (Falcon). Red blood cells in spleen s<span class="Gene">amples were lysed using ACK lysis buffer (Lonza) for 5 minutes at 4°C. Cells were counted and stained at 20×106 cells/ml. Cells were resuspended in PBS with Zombie Violet viability dye (Biolegend) and incubated at 4°C for 20 minutes. Cells were washed and then resuspended in an antibody cocktail in PBS supplemented with 2% FBS (Hyclone) in the presence of 5% 2.4G2 Fc blocking antibody (in house) and incubated for 30 minutes at 4°C. Cells were washed, resuspended in PBS with 2% FBS, and analyzed using an LSRII (BD). Data were analyzed using FlowJo software v9.7, and average population percentages and absolute numbers were graphed using GraphPad Prism (GraphPad Software, Inc.).

MZB and FoB culture and ELISA

For materials used, see Key resource table (Table 1). <span class="Chemical">MZB and FoB cells were cultured in <span class="Chemical">RPMI-1640 (Sigma-Aldrich) containing 10% FBS (Sigma-Aldrich), 10 μg/ml gentamicin (Gibco B.R.L) and 50 μM β-mercaptoethanol (Sigma-Aldrich). A total of 105 MZB and FoB cells were seeded into U-bottom 96-well plates (Thermo Scientific) in 200μL of media. Differentiation was stimulated by adding lipopolysaccharides from Salmonella enterica serotype typhimurium -LPS (Sigma-Aldrich) into each well at a final concentration of 2 μg/ml. The LPS-stimulated cells were cultured at 37°C, 5% CO2, for 5 days. To measure IgM levels by ELISA, MaxiSorp flat-bottom 96-well plates (Nunc) were coated with 200 μL of 5 μg/ml goat anti-mouse IgM (Southern Biotech) in 0.05% PBST (PBS-tween20) at 4°C, overnight. The plates were then washed thrice with 0.05% PBST and blocked with 3% BSA (Fisher Scientific) in PBS for 30 minutes at room temperature. Purified mouse IgM (Southern Biotech) was used to prepare a control standard. A total of 150 μl of supernatant collected from the stimulated B-cells at the end of 5-day incubation was diluted in 0.05% PBST (PBS containing 0.05% Triton-100), and along with the standard, was loaded on to the MaxiSorp flat-bottom (Thermo Fisher Scientific) ELISA plates for 1-hour incubation at room temperature followed by 3 washes with PBST. HRP goat anti-mouse IgM (Southern Biotech), diluted at 1:5,000 in PBST, was added and incubated for 1 hour at room temperature followed by 3 washes with PBST. TMB substrate solution (Thermo Fisher Scientific) was then added and developed for 10 minutes. Development was stopped with 0.16 M sulfuric acid before colorimetric absorption analysis at 450 nm.

Histology

For materials used, see Key resource table (Table 1). <span class="Species">Mouse tissues were fixed overnight in 4% <span class="Chemical">PFA and embedded in paraffin. Adult intestinal tissue was divided into sections corresponding to the jejunum, duodenum, ileum, and colon. Each section was then folded into a swiss-roll [89] and then fixed, mounted and sectioned for histological analysis. For P0 animals, whole intestinal tissue was collected and then fixed and mounted whole before sectioning for histological or immunofluorescence analysis. Sections 5-μm thick were deposited on Superfrost plus microscope slides (Fisher Scientific), deparaffinized with xylene (Fisher Scientific), and rehydrated. Sections were stained with hematoxylin for 2.5 minutes and Eosin for 1 minute before dehydration, clearing, and mounting. For Alcian blue staining, sections were rinsed in 3% acetic acid (Fisher Scientific) for 3 minutes and incubated at room temperature for 30 minutes in 1% Alcian blue 8GX (Sigma-Aldrich) in 3% acetic acid solution. The sections were then rinsed for 3 minutes in 3% acetic acid followed by 10 minutes in running water. After counterstaining with Nuclear Fast Red (Vector) for 5 minutes, slides were rinsed for 10 minutes in running water prior to dehydration, clearing, and mounting. For each sample, images of at least 10 random fields of view were acquired on a Nikon 90i Upright widefield microscope. Where indicated, quantitative analysis of images was done using Nikon’s NIS-Elements Advanced Research software (NIS-AR). In order to automatically identify and quantify Alcian blue positive goblet cells, an inhouse NIS-AR plugin was applied to identify and mask the discrete, large, dark blue Alcian blue spots scattered on the pink-white Nuclear Fast Red counterstain (Fig 3). We then manually traced the villi in the region of interest (ROI) to exclude the Alcian blue stained mucus. The plugin then counted the Alcian blue positive foci within the ROI. Goblet cell numbers were determined for all acquired fields of view for each animal analyzed. The average number of goblet cells per field of view was obtained for each analyzed animal. Where multiple animals of the same genotype were analyzed, the average goblet cell number per field of view was obtained by averaging the goblet cell numbers in all fields of view from all the animals of that genotype.

Fluorescent immunohistochemistry

For materials used, see Key resource table (Table 1). <span class="Chemical">Paraffin embedded sections were de<span class="Chemical">paraffinized with xylene, rehydrated, and subjected to heat-induced epitope retrieval (HIER) by boiling in Trilogy (Cell Marque) for 30 minutes. After cooling, the sections were rinsed with distilled water for 5 minutes followed by PBS with 0.3% Triton-X100 (Fisher Scientific) for 5 minutes. The sections were then incubated at room temperature for 2 hours in blocking solution (10% normal donkey serum [Jackson ImmunoResearch] in PBS-Triton), followed by overnight incubation with respective primary antibodies at 4°C. The sections were washed 3 times for 10 minutes each (3×10 minutes) with PBS-Triton and incubated for 2 hours at room temperature with Fluorophore-labeled secondary antibodies in blocking solution. Unbound secondary antibody was washed 3×10 minutes in PBS-Triton and where indicated, counterstained with DAPI before mounting with Prolong Gold Antifade (Invitrogen). Confocal imaging was performed on a Nikon Ti-E Inverted Microscope.

Cytoplasmic/Nuclear separation and Western Blot

For materials used, see Key resource table (Table 1). <span class="Chemical">N2ICD stability was determined in FACS-isolated <span class="Chemical">MZB and FoB cells. Sorted cells were pelleted for 5 minutes with 2,000 rpm at 4°C and resuspended in 500-μl hypotonic buffer (HB; 20 mM Tris-HCl [pH 7.5], 10 mM NaCl, 3 mM MgCl2) with added protease inhibitor (Roche). After 30 minutes' incubation on ice, 25 μl of 10 NP-40 was added, and samples were vortexed for 10 seconds. Nuclei were pelleted at 3,000 rpm for 10 minutes at 4°C, and the cytoplasmic fraction transferred into a fresh tube. The nuclei pellets were washed twice in 500 μl HB and then lysed in 20 μl 2X Laemmli sample buffer (120 mM Tris-HCl [pH 6.8], 20% glycerol, 4% SDS). The cytoplasmic fractions were concentrated using AmiconUltra– 0.5 mL– 30K centrifugal filters (Merck Millipore) and mixed 1:1 with 2X Laemmli sample buffer. The extracts were separated on 6% polyacrylamide (Bio-Rad) gel and transferred onto nitrocellulose membranes in Tris/glycine transfer buffer. Membranes were blocked with blocking solution (5% milk in 0.1% PBS-Tween20 [Fisher Scientific]) for 1 hour, room temperature, and incubated overnight at 4°C with primary antibody in blocking solution. Membranes were then washed 3 times for 5 minutes with 0.1% PBS-Tween20 and incubated for 1 hour at room temperature with anti-rabbit HRP secondary antibody (GE healthcare) in blocking solution. Membranes were developed with a Supersignal West femto chemiluminescent substrate kit (Fisher scientific) and developed using Chemidoc (Bio-Rad) detection system. Signal intensities were quantified using Image Lab (Bio-Rad) software.

qPCR

For materials used, see Key resource table (Table 1). RNA from tissue and cells was extracted using the PureLink RNA Mini kit (Invitrogen) and cDNA was synt<span class="Gene">hesized with SuperScript II reverse transcriptase (Invitrogen) following the manufacturers instruction. Quantitative PCRs were performed using iTaq Universal SYBR Green Supermix (Bio-<span class="Gene">Rad) on the StepOnePlus RT PCR system. Data were analyzed using the Delta-Delta-CT methods. A full list of oligos is provided in In Key Resources Table.

ATAC-Seq

For materials used, see Key resource table (Table 1). For s<span class="Gene">ample library preparation, we followed the Omni-ATAC method outlined by [90, 91] and purified Tn5 was generated as described [92]. Briefly, 50,000 nuclei from FACS-sorted <span class="Chemical">MZB cells were processed for Tn5 transposase-mediated tagmentation and adaptor incorporation at sites of accessible chromatin. FACS-isolated MZB cells were pelleted and washed with ice-cold PBS. The pellet was resuspended in ATAC-Resuspension Buffer (10 mM Tris-HCl [pH 7.4], 10 mM NaCl, 3 mM MgCl2 0.1% NP40, 0.1% Tween-20, 0.01% Digitonin) and incubated on ice for 3 minutes. The lysed cells were washed in ATAC-Wash Buffer (10 mM Tris-HCl [pH 7.4], 10 mM NaCl, 3 mM MgCl2, 0.1% Tween-20), inverted 3 times, and the nuclei pelleted. The nuclei were resuspended in ATAC transposition mix (10 mM Tris-HCl [pH 7.6], 10 mM MgCl2, 20% Formamide, 100 nM Tn5 transposase) and incubated at 37°C for 30 minutes in a thermomixer at 1,000 RPM. Following tagmentation, the DNA fragments were purified using a Zymo DNA Clean and Concentrator Kit, and library amplification was performed using customized Nextera PCR primer Ad1 in combination with any of Ad2.1 through Ad2.12 barcoded primers as described [91]. The quality of the purified DNA library was performed utilizing an Agilent Bioanalyzer 2100 using High Sensitivity DNA Chips (Agilent Technologies Inc., Santa Clara, CA). The samples were pooled at a concentration of 5 nM and run on an Illumina HI-SEQ 2500 sequencer (Illumina, Inc. San Diego, CA) to obtain paired-end reads of 75 bases (PE75). ATAC sequencing was carried out on 2 conditions MZB WT and RA. For each condition, 4 biological replicates were sequenced, in single-end fashion. Read depth for replicates varied from approximately 50 to 98 million reads thereby giving us average read depth of approximately 67 million reads. Quality check, mapping, and peak calling was performed using CSBB-v3.0 [Process-ChIP-ATAC_SingleEnd]. CSBB uses fastqc, bowtie2 and macs2 [parameters:—nomodel—shift 37—extsize 73], respectively. Duplicate mapped reads were removed before peak calling. Mapped reads in bam format was converted to bigwigs using deeptools (deeptools.ie-freiburg.mpg.de) for visualization purposes. For assessing open nucleosome region differences from MZB WT to RA MZB, we performed differential peak analysis. Within each sample type, only peaks with 75% replication and at least 50% overlap among biological replicates were used for differential peak analysis. Further, peak sets passing above defined criteria were merged (at least 1-bp overlap) using bedtools merge and then number of reads mapping under each peak for each replicate was inferred using FeatureCounts program. Finally, differential peak analysis was performed using EdgeR. No statistically significant changes in peaks (ATAC regions) between WT MZB and RA MZB were identified.

Loss of Notch1 dimerization suppresses target gene expression in MK4 cells (S1 Fig, see S1 Data for raw data).

(A-B) EMSA data for purified proteins binding to probes containing 2 <span class="Gene">CSL (A) or <span class="Chemical">SPS (B) sites. The number of balls marks the occupancy of sites; arrows below indicate orientation of binding sites in probes. (C-D) The average sites filled were plotted against RBPj concentrations to calculate the cooperativity factor “C” on CSL (C) and SPS (D) probes. (E) Relative expression of Notch target genes in mK4 cells overexpressing either N1ΔE or N1RAΔE as determined by RNA Seq (all replicates are shown, values ranked per row. Green arrows indicate targets elevated more in N1RAΔE, red arrows indicate targets repressed in in N1RAΔE relative to control. (F) Luciferase activation assays were used to analyze the homo- and heterodimerization properties of Notch1 and Notch2 on a dimer-dependent reporter gene (Hes5-Luciferase) and a dimer-agnostic reporters (Hey2-Luciferase). As previously shown [38], the dimer interface involves 3 amino acids, the Arg (R) mutated in this study, as well as the positively charged Lys (K1935, Notch1) and a negatively charged Glu (E1939, Notch1, or Asp [D1899] at the equivalent position in Notch2) that form salt bridges between NICD molecules. Dimer formation is critical for Notch-dependent activation of the Hes5 reporter, and mutating any of these amino acids abrogates activation. Notably, by co-expressing 2 Notch protein with complementary mutations, one in which K1935 was changed to E (N1KE), and a second in which D1899 was changed to K (N2DK) leads to strong enhancement in Luciferase expression, explained by achieving a more favorable conformation of the complementing mutant dimer. Note synergistic complementation between N1KE and N2DK but not between N1KE and N2KD, providing strong evidence of a cooperative heterodimer. Significance tested by a Student t-test. CSL, CBF1/Suppressor of Hairless/LAG-1; EMSA, in electrophoretic mobility shift assay; NICD, notch intracellular domain; N1RAΔE, extracellular domain deleted Notch1 Arg1974Ala mutant; RPBj, Recombinant binding protein for immunoglobulin Kappa j region; SPS, sequence-paired site.

(PDF)

Click here for additional data file.

Normal development of T-cell compartments in N1 mice (S1 Fig, see S1 Data for raw data).

Thymi and spleens were isolated from wt, N1, or N1 <span class="Species">mice, and the T-cell compartment was analyzed. (A) The absolute number of thymic single- and double-positive T cells (left) and developing T cells (right) was assessed by flow cytometry. (A’) The average number of cells in the <span class="Disease">thymus (left) and average thymic weight (right) are shown. (B) The percentage (left) and absolute number (right) of T-cell subsets in the spleen were assessed by flow cytometry. (B’) The average number of splenocytes (left) and average spleen weight (right) are shown. (n = 3–6 mice per genotype; error bars = +/- SEM). N1, Notch1 Arg1974Ala heterozygote; N1, Notch1 Arg1974Ala homozygote; wt, wild-type.

(PDF)

Click here for additional data file.

Proliferation potential in wt versus mutant intestines with or without fur mite exposure (S4 Fig).

Sections of P0 and P1 intestines from animals born to <span class="Chemical">fur mite–infested d<span class="Gene">ams (A-H’) and born after fur mite eradication (I-J’) were stained for Ki67 (A-D’, I, and I’) and phospho-H3 (E-H’, J, and J’) to assess for proliferation in the crypts. N1;N2 are indistinguishable from wt (A-B’, E-F’), whereas proliferation is significantly reduced in N1;N2 and N1/-;N2 crypts (C-D’, G-H’). Proliferation in N1;N2 is still decreased compared with heterozygous littermates after fur mite eradication (I-J’). N1;N2, Notch1/Notch2 RA hemizygous; N2, Notch2 RA homozygous; P0-1, postnatal day 0–1; RA, Arg (N1/N2) to Ala substitution; wt, wild-type.

(PDF)

Click here for additional data file.

Like wild type MZB cells, N2 MZB cells have a robust proliferative response upon LPS stimulation and N2RA/RA spleen display germinative centers (S5 Fig).

Isolated <span class="Chemical">MZB from N2 and wt littermates were cultured and stimulated with <span class="Gene">LPS. Both genotypes proliferate after stimulation (A). Sections of N2 and wt spleens were stained with Ki67 and phosphor-H3 to detect proliferation and Caspase3 for apoptosis (B). Proliferation in germinative centers were detected in dimer-deficient mice but not in wt. Apoptosis was not altered. LPS, lipopolysaccharide; MZB, marginal zone B-cell; Notch2 RA homozygous; RA, Arg (N1/N2) to Ala substitution; wt, wild-type.

(PDF)

Click here for additional data file.

Spleen size as a function of age.

In the absence of pathogens; N1;N2 enl<span class="Chemical">arged spleens and lymph nodes of mite-infested <span class="Species">mice have a high proliferative and mitotic index (S6 Fig, see S1 Data for raw data). (A). In the absence of fur mites, an increase in spleen size with aging was observed in N2 mice (RA), but not in mice with other genotypes (+) housed in the same colony (B, D). The enlarged spleens and lymph nodes from aged N1;N2 mice showed increased staining for Ki67 and phosphor-H3 indicating proliferation Apoptosis was slightly increased in enlarged spleens as shown by Caspase3 stain (C). (E) Low magnification of spleens from aged N2 and N1;N2 mice infested with fur mites show expansion of white pulp. N1;N2, Notch1 RA heterozygote, Notch2 RA homozygous; RA, Arg (N1/N2) to Ala substitution.

(PDF)

Click here for additional data file.

Loss of NICD dimerization does not stabilize the protein (S6 Fig; see S1 Data for raw data).

Western blot analysis of nuclear (N) and cytoplasmic (C) preparations of sorted <span class="Chemical">MZB shows no difference in N2 stability between wt and N2 <span class="Species">mice (A); immunoblotting of α-tubulin and histone-h3 confirms separation of cytoplasmic and nuclear fractions, respectively. Quantification of the nuclear N2ICD relative to cytoplasmic total N2 reveals no difference between wt and dimer-deficient N2ICD stability (B). MZB, marginal zone B-cell; NICD, Notch intracellular domain; wt, wild-type.

(PDF)

Click here for additional data file.

Chi-squared analysis of pups (P0 and P1) born in of N1;N2 x N1cross in mite-free housing.

N1, Notch1; N2, <span class="Gene">Notch2; RA, Arg (N1/N2) to Ala substitution; P, postnatal day.

(PDF)

Click here for additional data file.

Chi-squared analysis of male and female pups born in C57BL/6J N1 x N1 cross during fur mite infestation and following generations.

N1, Notch1 <span class="Chemical">Arg1974Ala heterozygote.

(PDF)

Click here for additional data file.

Original images and data used to generate figures and tables presented in the manuscript, organized in tabs corresponding to figure panels.

(XLSX)

Click here for additional data file.

9 Mar 2020

Dear Raphael,

Thank you for submitting your manuscript entitled "Exposure to Mites Sensitizes Intestinal Stem Cell Maintenance, Splenic M<span class="Chemical">arginal Zone B Cell Homeostasis, And Heart Development to <span class="Gene">Notch Dosage and Cooperativity." for consideration as a Research Article by PLOS Biology.

Your manuscript has now been evaluated by the PLOS Biology editorial staff as well as by an academic editor with relevant expertise and I <span class="Gene">am writing to let you know that we would like to send your submission out for external peer review.

However, before we can send your manuscript to reviewers, we need you to complete your submission by providing the metadata that is required for full assessment. To this end, please login to Editorial Manager where you will find the paper in the 'Submissions Needing Revisions' folder on your homepage. Please click 'Revise Submission' from the Action Links and complete all additional questions in the submission questionnaire.

Please re-submit your manuscript within two working days, i.e. by Mar 11 2020 11:59PM.

Login to Editorial Manager here: https://www.editorialmanager.com/pbiology

During resubmission, you will be invited to opt-in to posting your pre-review manuscript as a bioRxiv preprint. Visit http://journals.plos.org/plosbiology/s/preprints for full details. If you consent to posting your current manuscript as a preprint, please upload a single Preprint PDF when you re-submit.

Once your full submission is complete, your paper will undergo a <span class="Chemical">series of checks in preparation for peer review. Once your manuscript has passed all checks it will be sent out for review.

Feel free to email us at plosbiology@plos.org if you have any queries relating to your submission.

Kind regards,

Ines

--

Ines <span class="Disease">Alvarez-Garcia, PhD

Senior Editor

PLOS Biology

Carlyle House, Carlyle Road

C<span class="Gene">ambridge, CB4 3DN

+44 1223–442810

22 Apr 2020

Dear Rafi,

Thank you very much for submitting your manuscript "Exposure to Mites Sensitizes Intestinal Stem Cell Maintenance, Splenic M<span class="Chemical">arginal Zone B Cell Homeostasis, And Heart Development to <span class="Gene">Notch Dosage and Cooperativity." for consideration as a Research Article at PLOS Biology. Thank you also for your patience as we completed our editorial process, and please accept my apologies for the delay in providing you with our decision. Your manuscript has been evaluated by the PLOS Biology editors, an Academic Editor with relevant expertise, and by two independent reviewers.

As you will see, both reviewers are positive and find the conclusions of your manuscript very interesting and significant for the field. Nevertheless, they have also raised a few issues that need to be addressed. After discussing the reviews with the Academic Editor and considering the current circumstances, we will not make essential the experiments suggested, such as the CHIP-seq analysis of <span class="Gene">Notch2+/+ and <span class="Gene">Notch2RA/RA, but we will welcome any data you might have in hand. Please address/discuss all the issues and highlight any unanswered questions in the discussion.

In light of the reviews (attached below), we are pleased to offer you the opportunity to address the remaining points from the reviewers in a revised version that we anticipate should not take you very long. We will then assess your revised manuscript and your response to the reviewers' comments and we may consult the reviewers again.

We expect to receive your revised manuscript within 2 months.

Please email us (plosbiology@plos.org) if you have any questions or concerns, or would like to request an extension. At this stage, your manuscript remains formally under active consideration at our journal; please notify us by email if you do not intend to submit a revision so that we may end consideration of the manuscript at PLOS Biology.

**IMPORTANT - SUBMITTING YOUR REVISION**

Your revisions should address the specific points made by each reviewer. Please submit the following files along with your revised manuscript:

1. A 'Response to Reviewers' file - this should detail your responses to the editorial requests, present a point-by-point response to all of the reviewers' comments, and indicate the changes made to the manuscript.

*NOTE: In your point by point response to the reviewers, please provide the full context of each review. Do not selectively quote paragraphs or sentences to reply to. The entire set of reviewer comments should be present in full and each specific point should be responded to individually.

You should also cite any additional relevant literature that has been published since the original submission and mention any additional citations in your response.

2. In addition to a clean copy of the manuscript, please also upload a 'tr<span class="Gene">ack-changes' version of your manuscript that specifies the edits made. This should be uploaded as a "Related" file type.

*Resubmission Checklist*

When you are ready to resubmit your revised manuscript, please refer to this resubmission checklist: https://plos.io/Biology_Checklist

To submit a revised version of your manuscript, please go to https://www.editorialmanager.com/pbiology/ and log in as an Author. Click the link labelled 'Submissions Needing Revision' where you will find your submission record.

Please make sure to read the following important policies and guidelines while preparing your revision:

*Published Peer Review*

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. Please see here for more details:

https://blogs.plos.org/plos/2019/05/plos-journals-now-open-for-published-peer-review/

*PLOS Data Policy*

Please note that as a condition of publication PLOS' data policy (http://journals.plos.org/plosbiology/s/data-availability) requires that you make available all data used to draw the conclusions arrived at in your manuscript. If you have not already done so, you must include any data used in your manuscript either in appropriate repositories, within the body of the manuscript, or as supporting information (N.B. this includes any numerical values that were used to generate graphs, histogr<span class="Gene">ams etc.). For an ex<span class="Gene">ample see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5

*Blot and Gel Data Policy*

We require the original, uncropped and minimally adjusted images supporting all blot and gel results reported in an article's figures or Supporting Information files. We will require t<span class="Gene">hese files before a manuscript can be accepted so please prepare them now, if you have not already uploaded them. Please carefully read our guidelines for how to prepare and upload this data: https://journals.plos.org/plosbiology/s/figures#loc-blot-and-gel-reporting-requirements

*Protocols deposition*

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosbiology/s/submission-guidelines#loc-materials-and-methods

Thank you again for your submission to our journal. We hope that our editorial process has been constructive thus far, and we welcome your feedb<span class="Gene">ack at any time. Please don't <span class="Gene">hesitate to contact us if you have any questions or comments.

Best wis<span class="Gene">hes,

Ines

--

Ines <span class="Disease">Alvarez-Garcia, PhD

Senior Editor

PLOS Biology

Carlyle House, Carlyle Road

C<span class="Gene">ambridge, CB4 3DN

+44 1223–442810

---------------------------------------------------------------

Reviewers’ comments

<span class="Gene">Rev. 1:

This manuscript is a deep, thorough, and fascinating exploration of the functional consequences of introducing single point substitutions into <span class="Species">murine <span class="Gene">Notch1 and Notch2 that interfere with cooperative dimerization of Notch transcription complexes at head-to-head paired site elements (SPS sites). In isolation, neither dimer-deficient variant results in a developmental phenotype, nor does combining the two alleles in a double homozygote. Under environmental stress, however, N1 RA/RA, N2 RA/RA mice exhibit colonic barrier defects in a DSS colitis model. Analysis of N1 RA/-, N2 +/RA mice shows partial penetrance of a ventricular septal defect that is more pronounced in N1 RA/-, N2 RA/- mice, and fur-mite challenged N2 RA/RA mice show marginal zone B (MZB) cell expansion that can resemble MZB lymphoma in aged mice. Mechanistic studies to elucidate the origin of the paradoxical MZB gain-of-function phenotype in the N2 RA/RA mice suggests that selective loading of this N2 allele on monomer-responsive genes accounts for this effect. This manuscript certainly warrants publication in PLOS Biology after a few minor concerns are addressed.

Comments:

1. The mite infestation appears to have been an unplanned stressor of the genetically engineered <span class="Species">mice. Did the authors evaluate whether the mites preferentially colonized the mutant <span class="Species">mice compared with the wild-type mice?

2. In figure 5E, the authors make the point that HDM-induced <span class="Disease">dermatitis elevated <span class="Chemical">MZB numbers only in the N2 RA/RA mice but not in controls (such as LPS-treated mice). The data do, however, show the same trend in the permethrin and LPS-treated mice - it is just that the data are somewhat noisy and the trends in the other conditions don't reach statistical significance. Could it be that the study was underpowered? The authors might make note of the trend, without undermining the overall message of the figure panel or the study.

3. For those readers who are not <span class="Gene">Notch cognoscenti, the authors should expand the text to clarify for the more general reader the split-d<span class="Gene">am methodology use to compare loading of Notch-RBPJ monomeric complexes and dimeric complexes (that have NICD-D/NICD-AM within the same complex in order to build a functional DAM molecule). They should also improve the quality of the figure legend (D/AM "haves" I think means D/AM "halves" - and the text could also be made clearer for a naïve reader).

Rev. 2:

Kobia et al. described the in vivo roles of cooperative DNA binding of intracellular domains of <span class="Gene">Notch receptors in heart, intestinal epithelium, and spleen. By meticulous phenotypical analysis of sophisticated knock-in <span class="Species">mouse models of Notch1 and Notch2, authors found that dimerization-dependent Notch signaling is essential for heart development, injury response of colonic stem cells, and homeostasis of marginal zone B-cell. The most intriguing finding is Notch cooperativity can be induced at a certain specific context such as mite infestation, which is not preferred in a normal physiological status.

Dimer-deficient <span class="Species">mice generated in this study are wonderful model system to investigate the differential roles between the conventional NTCs and the cooperative NTCs on <span class="Chemical">SPS in vivo. The most of analysis were focused on phenotypical differences in various combination of dimer-compatible and dimer-defective alleles with different Notch dosages. Those are still very invaluable and informative resources to comprehend the fine-tuning mechanisms of diverse outcomes of Notch pathways. However, the underlying molecular mechanisms (provided mostly by Figure 7, only differential gene expression by RNA-seq analysis were examined) are not quite sufficient to explain the complex phenotypes of N1RA and N2RA alleles. Dissection of dimer-dependent and dimer-independent gene regulation using specific cell types affected in animal models (e.g. marginal zone B cells or intestinal stem cells) will greatly improve the manuscript. Detail comments are described below.

Major comments

- Perhaps, one of the most intriguing question would be where dimer-compatible NTC and dimer-defective NTC regulate gene expression. Do they regulate differential enhancer element in normal physiology and infl<span class="Gene">ammatory environment (mite infestation or 1% <span class="Chemical">DDS treated)? ATAC-seq analysis can be one of evidences, but it showed minimal changes in chromatin status between WT and N2RA/RA mice. SplitDAM experiments in Figure 7F is quite interesting but were performed in non-physiological context and only showed Myb locus. CHIP-seq analysis of Notch2+/+ and Notch2RA/RA can be a feasible approach to address this question.

- Where are <span class="Disease">inflammation-sensitive <span class="Chemical">SPS sites contributing altered gene expression in dimer-defective animal models? How can those SPSs upregulate or downregulate Notch target genes? Providing few examples (eg. Myb, FoxM1, E2F1) would be very helpful to understand the potential molecular mechanism of differential Notch pathway outcomes.

Minor comments

- in page 8, "1/8 surviving P0 N1+/-; N2+/- pups" -> "1/8 surviving P0 <span class="Chemical">N1RA/-; <span class="Chemical">N2RA/- pups

- The labels in Figure 5B are improperly presented (overlapped).

7 May 2020

Submitted filen<span class="Gene">ame: Response to Reviewers.docx

Click here for additional data file.

3 Jun 2020

Dear Dr Kopan,

Thank you very much for submitting a revised version of your manuscript "Exposure to Mites Sensitizes Intestinal Stem Cell Maintenance, Splenic M<span class="Chemical">arginal Zone B Cell Homeostasis, And Heart Development to <span class="Gene">Notch Dosage and Cooperativity." for consideration as a Research Article at PLOS Biology. This revised version of your manuscript has been evaluated by the PLOS Biology editors and by the Academic Editor.

We will probably accept the manuscript if you are willing to address the remaining issues highlighted by the academic editor regarding Figures 1 and 7 - please also find attached an annotated word file with suggestions. In addition, we feel the manuscript would benefit from a significant proofreading to fix potential errors.

Please email us (plosbiology@plos.org) if you have any questions or concerns, or would like to request an extension. At this stage, your manuscript remains formally under active consideration at our journal; please notify us by email if you do not intend to submit a revision so that we may end consideration of the manuscript at PLOS Biology.

**IMPORTANT - SUBMITTING YOUR REVISION**

*Resubmission Checklist*

When you are ready to resubmit your revised manuscript, please refer to this resubmission checklist: https://plos.io/Biology_Checklist

To submit a revised version of your manuscript, please go to https://www.editorialmanager.com/pbiology/ and log in as an Author. Click the link labelled 'Submissions Needing Revision' where you will find your submission record.

Please make sure to read the following important policies and guidelines while preparing your revision:

*Published Peer Review*

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. Please see here for more details:

https://blogs.plos.org/plos/2019/05/plos-journals-now-open-for-published-peer-review/

*PLOS Data Policy*

Many thanks for including a data file containing all raw data summarised in the figures. Nevertheless, we are missing data from the following figures:

Fig. 2H; Fig. 4J and Fig. 7D (if you include it)

Please also ensure that both your main and supplementary figure legends in your manuscript include information on WHERE YOUR DATA CAN BE FOUND. Please ensure that your Data Statement in the submission system accurately describes where the underlying data can be found.

*Blot and Gel Data Policy*

We require the original, uncropped and minimally adjusted images supporting all blot and gel results reported in an article's figures or Supporting Information files. We will require t<span class="Gene">hese files before a manuscript can be accepted so please prepare them now, if you have not already uploaded them. Please carefully read our guidelines for how to prepare and upload this data: https://journals.plos.org/plosbiology/s/figures#loc-blot-and-gel-reporting-requirements

*Protocols deposition*

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosbiology/s/submission-guidelines#loc-materials-and-methods

Thank you again for your submission to our journal. We hope that our editorial process has been constructive thus far, and we welcome your feedb<span class="Gene">ack at any time. Please don't <span class="Gene">hesitate to contact us if you have any questions or comments.

Sincerely,

Ines

--

Ines <span class="Disease">Alvarez-Garcia, PhD

Senior Editor

PLOS Biology

Carlyle House, Carlyle Road

C<span class="Gene">ambridge, CB4 3DN

+44 1223–442810

-----------------------------------------------------

Academic Editor's comments

In Figure 1:

The <span class="Chemical">N2RA has not been fully characterized and there is l<span class="Gene">ack of evidence that N2RA would show similar dimerization deficiency like N1RA. It is recommended to point this out either here or in Discussion.

In Figure 7:

The overall analysis of this part is rather poor and may not qualify the level of requirement of our journal. I feel that the rest is already sufficient to confirm that dimerization <span class="Disease">deficiency of mammalian NotchICD can cause pathology in the gut, heart, and B cells. Therefore, I suggest to remove this part from the manuscript unless some of the issues below are addressed:

1. The Fig S6A doesn’t look consistent <span class="Gene">among different replicates. S6B also show high level of variation, so it is extremely difficult to make any conclusion.

2. The RNAseq analysis with N=3 has failed in showing consistency within each group by having an outlier. Unless it has clear correlation to the severity of disease phenotype of the sacrificed <span class="Species">mouse, it seems very difficult to make any conclusion here. Fig7D could be used to show the penetrance of increased expression of the selected genes – number of s<span class="Gene">amples for each genotype is not shown and here many mice would need to be tested to make a firm conclusion.

3. Given the l<span class="Gene">ack of solid evidence that <span class="Gene">Myb and FoxM1 are involved here, further chromosomal analysis with ATAC seq and SplitDAM (although I greatly appreciate the methods) doesn’t seem yield any solid conclusion. This all might need further in-depth study to reveal the true molecular mechanism of the observed phenotypes (for all three main phenotypes).

In conclusion, the suggestion would be to finish the manuscript at Fig 6 and Fig S5. Fig 8 might be included but after revising the contents. Perhaps a different schematic drawing to show dimerization deficiency mechanism and the affected pathological aspects in <span class="Species">mouse would work better.

21 Jun 2020

Submitted filen<span class="Gene">ame: Response to Academic Editor.docx

Click here for additional data file.

15 Jul 2020

Dear Dr Kopan,

Thank you for submitting your revised Research Article entitled "Exposure to Mites Sensitizes Intestinal Stem Cell Maintenance, Splenic M<span class="Chemical">arginal Zone B Cell Homeostasis, And Heart Development to <span class="Gene">Notch Dosage and Cooperativity." for publication in PLOS Biology. I have now discussed the revision with the other editors and obtained advice from the Academic Editor.

We're delighted to let you know that we're now editorially satisfied with your manuscript. The only change we would like you to do in the manuscript is to revise the title to make it more accessible and we have come up with two alternatives. Please choose one of them and change the title whenever you are ready to submit the final version of the manuscript:

1) <span class="Gene">Notch dimerization is important for normal heart development, intestinal stem cell maintenance and splenic m<span class="Chemical">arginal zone B cell homeostasis.

2) <span class="Gene">Notch dimerization and gene dosage are important for normal heart development, intestinal stem cell maintenance and splenic m<span class="Chemical">arginal zone B cell homeostasis during mite infestation

Before we can formally accept your paper and consider it "in press", we also need to ensure that your article conforms to our guidelines. A member of our te<span class="Gene">am will be in touch shortly with a set of requests. As we can't proceed until t<span class="Gene">hese requirements are met, your swift response will help prevent delays to publication. Please also make sure to address the data and other policy-related requests noted at the end of this email.

*Copyediting*

Upon acceptance of your article, your final files will be copyedited and typeset into the final PDF. While you will have an opportunity to review t<span class="Gene">hese files as proofs, PLOS will only permit corrections to spelling or significant scientific errors. Therefore, please take this final revision time to assess and make any remaining major changes to your manuscript.

NOTE: If Supporting Information files are included with your article, note that t<span class="Gene">hese are not copyedited and will be published as they are submitted. Please ensure that t<span class="Gene">hese files are legible and of high quality (at least 300 dpi) in an easily accessible file format. For this reason, please be aware that any references listed in an SI file will not be indexed. For more information, see our Supporting Information guidelines:

https://journals.plos.org/plosbiology/s/supporting-information

*Published Peer Review History*

Please note that you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. Please see here for more details:

https://blogs.plos.org/plos/2019/05/plos-journals-now-open-for-published-peer-review/

*Early Version*

Please note that an uncorrected proof of your manuscript will be published online ahead of the final version, unless you opted out when submitting your manuscript. If, for any reason, you do not want an earlier version of your manuscript published online, uncheck the box. Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us as soon as possible if you or your institution is planning to press release the article.

*Protocols deposition*

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosbiology/s/submission-guidelines#loc-materials-and-methods

*Submitting Your Revision*

To submit your revision, please go to https://www.editorialmanager.com/pbiology/ and log in as an Author. Click the link labelled 'Submissions Needing Revision' to find your submission record. Your revised submission must include a cover letter, a Response to Reviewers file that provides a detailed response to the reviewers' comments (if applicable), and a tr<span class="Gene">ack-changes file indicating any changes that you have made to the manuscript.

Please do not <span class="Gene">hesitate to contact me should you have any questions.

Best wis<span class="Gene">hes,

Ines

--

Ines <span class="Disease">Alvarez-Garcia, PhD

Senior Editor

PLOS Biology

i<span class="Disease">alvarez-garcia@plos.org

Carlyle House, Carlyle Road

C<span class="Gene">ambridge, CB4 3DN

+44 1223–442810

------------------------------------------------------------------------

DATA POLICY:

Many thanks for adding the data file containing the raw data underlying all the graphs shown in the main and supplementary figures. Please <span class="Gene">amend the following:

- Ren<span class="Gene">ame the file 'S1_Data'

- In the data from Fig. 2, relabel data shown in Fig. 2J for 2H (there is no J in the figure).

- As you have to relabel the file, please <span class="Gene">amend in each of the corresponding figure legends the sentence indicating where the data can be found and add this also to each of the corresponding legends of the supplementary files.

- You have indicated that you will submit to GEO all the molecular data. Please do so before acceptance to production and indicate the GEO number in the Data Availability section.

- There is an instance of 'data not shown' in page 10. Please either provide the data in the supplementary figures or remove the statement. All data must be shown.

-------------------------------------------------------------------------

BLOT AND GEL REPORTING REQUIREMENTS:

For manuscripts submitted on or after 1st July 2019, we require the original, uncropped and minimally adjusted images supporting all blot and gel results reported in an article's figures or Supporting Information files. We will require t<span class="Gene">hese files before a manuscript can be accepted so please prepare and upload them now. Please carefully read our guidelines for how to prepare and upload this data: https://journals.plos.org/plosbiology/s/figures#loc-blot-and-gel-reporting-requirements

While you have added some of them to the data file, others seem to be missing. Please provide them all in the s<span class="Gene">ame file.

21 Aug 2020

Submitted filen<span class="Gene">ame: Response to Reviewers.docx

Click here for additional data file.

2 Sep 2020

Dear Dr Kopan,

On behalf of my colleagues and the Academic Editor, Bon-Kyoung Koo, I <span class="Gene">am pleased to inform you that we will be delighted to publish your Research Article in PLOS Biology.

The files will now enter our production system. You will receive a copyedited version of the manuscript, along with your figures for a final review. You will be given two business days to review and approve the copyedit. Then, within a week, you will receive a PDF proof of your typeset article. You will have two days to review the PDF and make any final corrections. If there is a chance that you'll be unavailable during the copy editing/proof review period, please provide us with contact details of one of the other authors whom you nominate to handle t<span class="Gene">hese stages on your behalf. This will ensure that any requested corrections reach the production department in time for publication.

Early Version

The version of your manuscript submitted at the copyedit stage will be posted online ahead of the final proof version, unless you have already opted out of the process. The date of the early version will be your article's publication date. The final article will be published to the s<span class="Gene">ame URL, and all versions of the paper will be accessible to readers.

PRESS

We frequently collaborate with press offices. If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximise its impact. If the press office is planning to promote your findings, we would be grateful if they could coordinate with biologypress@plos.org. If you have not yet opted out of the early version process, we ask that you notify us immediately of any press plans so that we may do so on your behalf.

We also ask that you take this opportunity to read our Embargo Policy regarding the discussion, promotion and media coverage of work that is yet to be published by PLOS. As your manuscript is not yet published, it is bound by the conditions of our Emb<span class="Chemical">argo Policy. Please be aware that this policy is in place both to ensure that any press coverage of your article is fully substantiated and to provide a direct link between such coverage and the published work. For full details of our Embargo Policy, please visit http://www.plos.org/about/media-inquiries/embargo-policy/.

Thank you again for submitting your manuscript to PLOS Biology and for your support of Open Access publishing. Please do not <span class="Gene">hesitate to contact me if I can provide any assistance during the production process.

Kind regards,

Alice Musson

Publishing Editor,

PLOS Biology

on behalf of

Ines <span class="Disease">Alvarez-Garcia,

Senior Editor

PLOS Biology