Diagnosis, genetic variations, virulence, and toxicity of AHPND-positive Vibrio parahaemolyticus in Penaeus monodon.

Acute hepatopancreatic necrosis disease (AHPND) is an emerging shrimp (Penaeus monodon) disease caused by Vibrio parahaemolyticus (VP) since 2013 in Bangladesh. The aim of this work was to evaluate a PCR and RT-PCR techniques as rapid methods for detecting V. parahaemolyticus AHPND-positive P. monodon using genetic markers. Healthy and diseased shrimp (P. monodon) samples were collected from three monitoring stations. The samples were enriched in TCBS plates and DNA extraction from the cultured bacteria. DNA quantifications, PCR amplification, RT-PCR, and gene sequencing were done for the detection of V. parahaemolyticus AHPND-positive P. monodon. The sequence of PCR amplicons showed 100% identity and significant alignment with V. parahaemolyticus. The primers used provided high specificity for V. parahaemolyticus in PCR detection compared with another Vibrio species. In the PCR, amplification resulted positive amplicons, whereas, non-AHPND isolates showed no amplicons. Neighbor-joining methods indicated that all genes evolved from a common ancestor and clades have different traits with very low genetic distance and low variability. The pairwise alignment scores of atpA, tox, blaCARB, 16S rRNA, and pirA genes were 100.0, 98.90, 98.89, 95.53, and 41.42, respectively. The RT-qPCR exposed variable expression levels for all genes in the AHPND-positive strain. Homology analysis and distance matrix exhibited all genes to have the lowest similarity and most divergence, offering the highest specificity. In this study, the expression and variability of target genes confirmed the presence of V. parahaemolyticus in all sampling sites. The results suggested that PCR amplification, RT-qPCR, and gene sequencing can be used for the rapid detection of V. parahaemolyticus in AHPND-positive P. monodon that may lead to subsequent prevention and treatment research in the future for managing this disease. © Springer Nature Switzerland AG 2020.

Introduction

Vibriosis is one of the major disease problems in shellfish and finfish aquaculture responsible for the mortality of cultured shrimp worldwide (Mohney et al. 1994). Opportunistic pathogens with highly virulent strains (Ishimaru et al. 2009) include Vibrio alginolyticus, Vibrio anguillarum, Vibrio harveyi and Vibrio parahaemolyticus (Kannapiran et al. 2009). In an initial outbreak in the southwest of China in 2009, acute hepatopancreatic necrosis disease (AHPND) had its rapid, lethal effect in early stages of shrimp and had spread all over the world. Over the past 40 years, Asia’s farmed shrimp aquaculture industry is impacted by episodes of disease, notably AHPND, resulting in substantial national income losses (Shinn et al. 2018a). V. parahaemolyticus is widely distributed in marine environments and frequently isolated from a variety of raw seafood, particularly shellfish. The V. parahaemolyticus harboring virulence genes such as tdh and trh (Zhang and Orth 2013) have toxic effect on human health.

AHPND is characterized by high mortality generally when shrimp is 1 month old or post larvae is around 20–30 days old (De Schryver et al. 2014); it is responsible for a significant proportion of economic losses recorded from at least eight Asian territories. An empty gut and an atrophied, pale hepatopancreas (Lai et al. 2015), massive sloughing off of the epithelial cells of the hepatopancreas (Sirikharin et al. 2015), and hemocyte infiltration are caused by a specific set of V. parahaemolyticus (De Schryver et al. 2014).

AHPND was first detected in shrimp farms in southwestern Bangladesh in 2013 and consequently spread to other cultural areas of Bangladesh. The pathogen is transferred orally and then localizes at the shrimp gastrointestinal tract and creates a poison that causes tissue devastation and invalidism of the shrimp digestive system known as the hepatopancreas (Zorriehzahra and Banaederakhshan 2013). To control AHPND, farmers implemented prevention through pond eradication and renovation, but it could not stop outbreaks of the pathogen once the disease appeared repeatedly in shrimp farms. To prevent AHPND, its causative agent (Praveena et al. 2014) namely V. parahaemolyticus must be characterized thoroughly. Although plasmid-encoded binary toxins pirA and pirB (Kim et al. 2015) are found to be the primary causes of AHPND, whether other virulent factors are toxR and toxA genes (Kim et al. 1999; Sirikharin et al. 2015) commonly present in V. parahaemolyticus and may play essential roles in genetic diversity analyzed by 16S rRNA gene (Feng et al. 2017) during shrimp infection remains unknown (Li et al. 2017).

The PCR primers target specific DNA sequences using PCR present in samples in several locations, this tool identified pathogenic V. parahaemolyticus causing AHPND (Han et al. 2015a). The primer set AP1 and AP2 which target the DNA sequences of AHPND was the first PCR diagnostic tool used in 2013 (Flegel and Lo 2014a). Three sets of AHPND primers (AP1, AP2, and AP3), AP2 showed a false positive result due to the plasmid mutation lacking the toxin gene (Flegel and Lo 2014b). Among (AP1, AP2, and AP3) the primer sets, AP3 demonstrated the highest sensitivity and best specificity (Flegel 2014). The TUMSAT-Vp3 primer used targeting the AHPND DNA sequences (Tinwongger et al. 2014). The AP4 nested PCR method showed higher sensitivity and amplified pirA and pirB genes in V. parahaemolyticus and detected AHPND isolates containing these two genes (Dangtip et al. 2015). Among the recent PCR methods, AP3 method is considered the most promising tool for detecting AHPND which targets the pirA as it exhibited high sensitivity and specificity (Soto-Rodriguez et al. 2015). Thus, the use of AP3 primers which can detect pirA gene and duplex PCR method to detect pirA and pirB genes is the most recommended confirmatory tests for AHPND detection (Han et al. 2015b). The current disease problems in Asia, notably AHPND caused by pathogenic isolates of Vibrio parahaemolyticus (Shinn et al. 2018b). In 2020, Santos et al. (2020) reported the different strategies in diagnosing and potential treatments for AHPND and the discovery of pathogenic mechanisms involved in AHPND. This study aimed to analyze the specific detection, genetic variability, and expression of virulence and toxic genes using rapid detection method in V. parahaemolyticus isolated from Penaeus monodon in affected areas in Bangladesh remain unclear, which may include the essential groundwork for advance research of AHPND.

Materials and methods

Isolation and storage of Vibrio parahaemolyticus isolates

AHPND-causative Vibrio parahaemolyticus was isolated from shrimp culture ponds or ghers in PCF Feed Industries Ltd. in Bagherhat, C.P. Bangladesh Co., Ltd. in Khulna, and Radiant Shrimp Farms Ltd. in Sathkhira respectively. Dead and moribund juvenile (~ 2 g) shrimps (Penaeus monodon) were collected from 30 AHPND outbreaks ponds or ghers. About 25 g of each type of sample (gills, guts, and hepatopancreas) was thoroughly triturated in a sterile mortar and pestle with use of 225 ml of alkaline saline peptone water (ISO) (Thermo Scientific™) and homogenized for 2 min in a stomacher (Life Technologies, CA, USA) (Chonsin et al. 2015). Tenfold serial dilution of 1 ml of homogenates was established in alkaline saline peptone water (ASPW+) with three replicates which were generated and shaken at 170 rpm at 37 °C for 18 h. A total of 100 μl volumes of the extract was plated onto thiosulfate-citrate-bile salts-sucrose (TCBS) plates (Remel Inc., Santa Fe Drive, Lenexa, USA) for 24 h. The Vibrio parahaemolyticus sucrose agar (VPSA) incubated at 37 °C for 24 h. The characteristic large colonies (3–4 mm) with light blue or green centers on TCBS and VPSA were regarded as presumptive V. parahaemolyticus and further subjected to morphological, cultural, and biochemical characterization. A series of biochemical tests as per BAM, USFDA method (Kaysner and DePaola 2004) was used for the identification of Vibrio isolates.

All colonies were picked and streaked on tryptone soya agar (TSA) (Sigma-Aldrich, Germany) supplemented with 3% (w/v) NaCl (Sigma-Aldrich, Germany). After 24 h incubation, one colony from each plate was inoculated into tryptone soya broth (TSB) (Sigma-Aldrich, Germany) enriched with 3% (w/v) NaCl grown by shaking at 170 rpm at 37 °C for 12 h. The bacterial suspension was incubated at 37 °C for 12 h with continuous shaking. The total 12 h culture volume (50 ml) was used as inoculum for 500 ml fresh medium (500 ml) followed by continued cultivation with shaking until the OD600 reached 0.6 (approximately 6–8 h) and was equivalent to approximately 2 × 108 cells per ml. The bacterial cells were removed by centrifugation at 8500 rpm for 10 min at 4 °C; the supernatant was used to prepare crude protein fractions. Subsequently, 1 ml of medium was mixed with 1 ml of 50% (v/v) ultrapure glycerol (Invitrogen™) and stored at − 80 °C. A total of 1 ml bacterial cells of overnight culture was centrifuged, and the pellet was suspended in 400 μl of ddH2O. The bacterial suspension was centrifuged at 11,000 rpm for 6 min. The supernatant was used as DNA template for PCR assay.

Bacterial genomic and plasmid DNA extraction

A general DNA extraction technique was applied to obtain the DNA of 30 isolates from healthy/suspected/infected shrimp stomach or hepatopancreatic tissue. Bacterial genomic DNA and plasmid DNA were applied with DNAzol™ reagent to isolate genomic DNA (a vast spectrum, fast isolation, and large recovery of genomic DNA kits, Invitrogen™, and PureLinkR Pro Quick96 Plasmid Kit, Invitrogen™), following the manufacturer’s instruction. In this study, 0.01–1 ng of DNA extracted from bacterial isolate or 10–100 ng from shrimp tissue produces the volume of template DNA in the 25 μl PCR reaction.

Primers used for PCR amplification

The well-conserved regulatory genes toxR and toxA (Sirikharin et al. 2015), a highly conserved 16S rRNA gene (Tarr et al. 2007), a novel species-specific genetic marker blaCARB-17 (Li et al. 2016), AP1 and AP2 (Feng et al. 2017) and pirA gene (AP3) (Sirikharin et al. 2014), was analyzed and examined for PCR amplification to produce the expression of virulence and toxic genes tlh, tdh, and trh of AHPND V. parahaemolyticus isolates (Gutierrez West et al. 2013). The sequence of primers applied for the amplification of target genes is listed in Table 1.

Table 1

The sequence of primer pairs (forward and reverse) for PCR amplification of trh, tdh, 16S rRNA, toxR, atpA, tlh, pirA, toxA, pirB, and blaCARB−17 targeting genes

Primer pair	Oligonucleotide sequence (5′-3′)	Product length	Target gene	Reference
Trh-F Trh-R	CTCTACTTTGCTTTCAGT AATATTCTGGAGTTTCAT	460 bp	trh	(Suthienkul et al. 1995)
Tdh-F Tdh-R	CGTTGATTATTCTTTTACGA TTTGTTGGATATACACAT	623 bp	tdh	(Karunasagar et al. 1996)
V.16S-700F V.16S-1325R	CGGTGAAATGCGTAGAGA T TTACTAGCGATTCCGAGTTC	663 bp	16S rRNA	(Tarr et al. 2007)
ToxB-F ToxB-R	TGTACTGTTGAACGCCTA CACGTTCTCATACGAGTG	503 bp	toxR	(Neogi et al. 2010)
atpA-VP-F atpA-VP-R	TACTAGGCCGCGTAGTA CGCTGGACGTACACCT	794 bp	atpA	(Izumiya et al. 2011)
AP1-F AP1-R	CCTTGGGTGTGCTTAGAGGATG GCAAACTATCGCGCAGAACACC	700 bp		(Flegel and Lo 2013)
AP2-F AP2-R	TCACCCGAATGCTCGCTTGTGG CGTCGCTACTGTCTAGCTGAAG	700 bp		(Flegel and Lo 2013)
TLH-F TLH-R	AAAGCGGATTATGCAGAAGCACTG GCTACTTTCTAGCATTTTCTCTGC	450 bp	tlh	(Dickinson et al. 2013)
AP3-F AP3-R	ATGAGTAACAATATAAAACATGAAAC GTGGTAATAGATTGTACAGAA	333 bp	pirA	(Sirikharin et al. 2014)
Tt16AP4-F1* AP4-R1	ATGAGTAACAATATAAAACATGAAAC ACGATTTCGACGTTCCCCAA	1269 bp	toxA	(Dangtip et al. 2015)
AP4-F2 AP4-R2	TTGAGAATACGGGACGTGGG GTTAGTCATGTGAGCACCTTC	230 bp	toxA	(Dangtip et al. 2015)
PIR-F1 AP4-R1	TGACTATTCACGATTGGACTG CACGACTAGCCATTGTTA	284 bp	pirA	(Han et al. 2015b)
PIR-F2 PIR-R2	TGATGAAGTGATGGGTGCTC TGTAAGCGCCGTTTAACTCA	392 bp	pirB	(Han et al. 2015b)
qPCR-F qPCR-R	TTGGACTGTCGAACCAAACG GCACCCCATTGGTATTGAATG Probe: AGACAGCAAACATACACCTATCATCCCGCA	135 bp	pirA	(Han et al. 2015b)
CARB-F CARB-R	ACC(T)TTGATGGAAGATA T(C)TAACTTTCTTTGTAGTGC(A)	303 bp	blaCARB − 17	(Li et al. 2016)

*Note that primer AP4-F1 is identical to primer AP3-F from the AP3 method

.16S-700F

.16S-1325R

PCR amplification of target genes

The template DNA derived from AHPND-suspected or positive 30 isolates was used for PCR amplification (Sirikharin et al. 2014) with specific primer set for particular target genes in Table 1. The final reaction volume was 10 μl, containing 5 μl of Green Master Mix (Go-TagG2), 1 μl of 10 μM primers, 1 μl of template DNA, and 3 μl nuclease-free water. The thermal profile for DNA amplification in a thermal cycler (Professional standard gradient, Biometra, Germany) was as follows: preheating at 95 °C for 2 min and 1 min denaturation at 94 °C for 35 cycles. The annealing temperature was 58 °C (primer-specific) for 1 min and then was elongated or extended to 72 °C for 1 min to a final extension of 72 °C for 5 min. Moreover, 1% agarose gel was used to separate the amplified PCR product from each sample electrophoretically (Nacalai Tesque, Inc., Kyoto, Japan) at a constant voltage of 120 for 30 min in the 1 × TAE buffer. The gel was stained with 10 μl ethidium bromide (10 mg/mL in 100 mL of DW) for 10 min and visualized under ultraviolet (UV) light, and molecular weight marker was 1 Kb plus DNA ladder (Invitrogen™, Thermo Fisher Scientific). The DNA bands were observed on high-performance UV transilluminator and photographed with a gel documentation system (BioDoc-It™ Imaging system, Cambridge, UK). The sequences (next-generation sequencing platform, 1st Base Laboratories, Malaysia) of the PCR amplicons were analyzed by MEGA X (version 10.0.5) (Kumar et al. 2018), DNAMAN (Lynnon Biosoft Corporation, USA, version 10.0.2.100) (Austin 2010) and Geneious prime software (Biomatters Limited, New Zealand, version 2020.0.2). The NCBI-BLAST (GeneBank) and SMART BLAST were used for sequence analysis (Table 2) and the specificity is shown in Table 3. The multiple sequence alignments were monitored using Geneious prime, ClustalW, and DNAMAN software. The neighbor-joining method (Saitou and Nei 1987) and the maximum composite likelihood method (Tamura et al. 2004) were used to determine the evolutionary history and distance analyzed by MEGA X.

Table 2

The amplification of PCR result of AP1, AP2, toxR, 16S rRNA, pirA (AP3), toxA, blaCARB−17, tlh, atpA, tdh, and trh in AHPND-positive isolates

Bacterial isolates	Primer pair/target gene											Identity* (%)
	toxR	16S rRNA	AP1	AP2	AP3	toxA	blaCARB−17	tlh	atpA	tdh	trh
ahpn-1	+	+	–	+	+	–	+	+	+	–	–	100
ahpn-3	+	+	+	+	+	+	+	+	+	+	+	100
ahpn-8	+	+	+	+	+	+	+	+	+	+	+	100
ahpn-11	+	+	+	+	+	+	+	+	+	–	–	100
ahpn-12	+	+	+	–	+	+	+	+	+	–	–	100
ahpn-13	+	+	+	+	+	+	+	+	–	+	+	99
ahpn-14	+	+	+	+	+	+	+	+	+	+	–	99
ahpn-15	+	+	+	+	+	+	+	+	+	+	+	100
ahpn-16	+	+	+	+	+	–	+	+	+	+	+	99
ahpn-17	+	+	+	+	+	+	+	+	+	+	+	99
ahpn-18	+	+	–	+	+	+	+	+	+	+	–	99
ahpn-19	+	+	+	+	+	–	+	+	+	–	–	99
ahpn-20	+	+	+	+	+	+	+	+	+	+	+	100
ahpn-21	+	+	+	+	+	–	+	+	+	–	–	99
ahpn-22	+	+	+	+	+	+	+	+	+	–	–	99
ahpn-23	+	+	+	+	+	+	+	+	–	+	+	99
ahpn-24	+	+	–	+	+	+	+	+	+	+	+	99
ahpn-25	+	+	+	+	+	+	+	+	+	+	+	100
ahpn-26	+	+	+	+	+	+	+	+	+	–	+	100
ahpn-27	+	+	+	–	+	–	+	+	–	–	–	99
ahpn-28	+	+	+	–	+	–	+	+	–	–	–	99
ahpn-29	+	+	+	+	+	+	+	+	–	+	+	100
ahpn-30	+	+	+	+	+	+	+	+	+	+	+	100

*Summary of metadata for genome sequence using BLAST (nr) in NCBI producing species identity of 30 isolates collected from major shrimp farming regions of Bangladesh

Table 3

The PCR methods were resulting in the specificity targeting different genes in AHPND-positive and AHPND-negative isolates

Species	Source	No. of isolates	Positive rate (%)
			toxR	toxA	16S rRNA	pirA	blaCARB−17	tlh	atpA	tdh	trh
Vibrio parahaemolyticus	Shrimp	30	100	100	100	100	100	100	83	77	85
V. harveyi	Shrimp	1	0	0	0	0	0	0	0	0	0
V. campbellii	Shrimp	1	0	0	0	0	0	0	0	0	0
V. anguillarum	Shrimp	3	0	0	66	33	0	0	0	0	0
V. vunificus	Food	1	0	0	0	0	0	0	0	0	0
V. cholerae	Food	5	0	0	0	80	0	0	0	0	0
V. metschnikovii	Food	1	0	0	0	0	0	0	0	0	0
V. fluvialis	ATCC*	1	0	0	0	0	0	0	0	0	0
V. mimicus	ATCC	1	0	0	0	0	0	0	0	0	0
V. natriegens	Food	1	0	0	0	0	0	0	0	0	0
Pseudomonas sp.	Clinical	1	0	0	0	0	0	0	0	0	0
Aeromonas sp.	Food	1	0	0	0	0	0	0	0	0	0
Escherichia coli	Food	2	0	0	0	0	0	0	0	0	0
Salmonella sp.	Food	2	0	0	0	0	0	0	0	0	0
Staphylococcus sp.	Food	2	0	0	0	0	0	0	0	0	0
Enterobacter sp.	Clinical	1	0	0	0	0	0	0	0	0	0

*The American Type Culture Collection

Quantitative PCR for cDNA synthesis

The RNA was extracted using the Ambion RNAqueous Midi Kit (InvitrogenTM) from TSB+ (Sigma-Aldrich, Germany) culture medium via centrifugation at 8000g for 10 min in accordance with the instruction. Thermo Scientific™ Culti-Loops™ V. parahaemolyticus ATCC™ 17802™ was used as a negative control. Thermo Scientific Maxima H Minus cDNA Synthesis Master Mix with dsDNase provides a simple workflow that combines genomic DNA elimination and cDNA synthesis in a one-tube procedure. The cDNA reaction components are pre-mixed into a complete master mix that is convenient to use, reduces pipeting steps, and is optimized for cDNA synthesis in two-step quantitative RT-PCR (RT-qPCR) applications.

Homology tree of target genes within AHPND-positive isolates

The DNAMAN software (Lynnon Biosoft Corporation, USA, version 10.0.2.100) was used to analyze the homology of target genes within AHPND-positive isolates by applying an effective alignment method. The NCBI nucleotide collection (nr) and whole-genome shotgun (wgs) database (accession nos.: AP014860.1, LK021128.1, CP021148.1, and CP033146.1) were used to retrieve target genes toxR, 16S rRNA, AP1, AP2, pirA (AP3), toxA, blaCARB-17, tlh, atpA, tdh, and trh-like sequences. The sequence of the target genes was used to construct the homology trees.

Expression analysis of target genes by qPCR

The primer pair (qPCR-forward and qPCR-reverse, and probe) in Table 1 was chosen to quantify pirA gene expression. ATCC17802 was used as the negative control and 16S rRNA gene were selected for the normalization of gene expression in RT-qPCR. Every 1 μl of cDNA was used as template. The final reaction volume of 20 μl consisted of 10 μl of Syber Green Master Mix (Thermo Fisher Scientific), 1.6 μl of 10 mM forward and reverse primer, 0.4 μl of ROX Reference Dye (Invitrogen™), 2 μl of cDNA template, and 6 μl of ddH2O for RT-qPCR (7500 Fast Real-time PCR system, Applied Biosystems). The thermal profile was as follows: 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 15 s. Each reaction was carried out in triplicate and analyzed by ABI 7500 v2.0.6. software.

Results

Among the 30 AHPND outbreak shrimp ponds or ghers yielded a total of 30 isolates that were stored at − 80 °C. The sequence of PCR amplicon analysis of the 30 isolates yielded 23 V. parahaemolyticus positive samples that produced 100% identity and significant alignment with V. parahaemolyticus. The other 7 isolates corresponded to common marine microorganisms that produced 99% significant alignment with Photobacterium and V. harveyi (Table 2). In the initial screening, 23 isolates provided a positive signal with toxR, 16S rRNA, pirA, blaCARB-17, and tlh. The primers confirmed that six isolates isolated from shrimp in growing ponds (ahpn-3, ahpn-8, ahpn-15, ahpn-20, ahpn-25, and ahpn-30) contained toxR, 16S rRNA, AP1, AP2, pirA (AP3), toxA, blaCARB-17, tlh, atpA, tlh, and trh genes, but not in the other 17 isolates (Table 2). The PCR technique determined the specificity of target genes compared with separate bacterial isolates in Table 3; 100% specificity was provided in V. parahaemolyticus with toxR, toxA, 16S rRNA, pirA, blaCARB-17, and tlh. The atpA, tdh, and trh genes yielded 83%, 77%, and 85% specificities in V. parahaemolyticus, respectively, whereas the 30 strains were isolated from shrimp in growing ponds. V. alginolyticus isolated from shrimp yielded 66% and 33% specificities with 16S rRNA and pirA genes, respectively. The other Vibrio spp. isolated from food and ATCC sources, Pseudomonas and Enterobacter isolated from clinical sources and Aeromonas, Escherichia coli, Salmonella, and Staphylococcus isolated from food sources showed 0% specificity with toxR, toxA, 16S rRNA, pirA (AP3), blaCARB-17, tlh, atpA, tdh, and trh (Table 3).

Agarose gel (1%) was used to reveal the PCR amplification of target genes toxR, 16S rRNA, AP1, AP2, pirA (AP3), toxA, blaCARB-17, tlh, atpA, tdh, and trh by using AHPND-positive representative strain ahpn-25 (the samples of ahpn-3, ahpn-8, ahpn-15, ahpn-20, ahpn-25, and ahpn-30 showed 100% identity in Table 2 and revealed all target genes by PCR in Table 2; among them, ahpn-25 was used as a representative strain) to identify V. parahaemolyticus in Fig. 1. Lanes 3–13 show the bands of positive amplicons at 350, 663, 700, 700, 336, 333, 303, 450, 794, 623, and 460 bp, whereas non-AHPND (ahpn-2) exhibited no amplicons in lane 2.

Fig. 1

The results of the PCR fingerprints trh, tdh, 16S rRNA, toxR, atpA, AP1, AP2, tlh, pirA (AP3), toxA, pirA, pirB, qPCR products, and blaCARB−17 amplification in AHPND-positive isolates. 1% agarose gel shows the amplicons of target genes in this strain. Lane M: DNA marker; lane 2–16: positive amplicons of representative strain of Vibrio parahaemolyticus (ahpn-25) respectively. Molecular weight, in the first and last lane, corresponds to ladder 100 bp

The amplified PCR products of the target genes with six AHPND-positive representative isolates (ahpn-3, 8, 15, 20, 25, and 30) received 99% identity (NCBI, BLAST) with their closed sequence in Table 2 and Fig. 2a and exhibited high homology. To construct the phylogenetic relationship (Li et al. 2016), 8 Vibrio spp. were selected from GeneBank to compare with target gene sequences; all genes were derived from a common ancestor (Fig. 2a). All genes showed a common ancestor (accession no. CP022245.1), whereas all clades were derived with different traits with very low genetic distance (Fig. 2b). The sequences of the PCR amplification of target genes (toxR, 16S rRNA, pirA (AP3), toxA, blaCARB-17, tlh, atpA, tdh, and trh) from an AHPND-positive representative strain (ahpn-25) were aligned with the reference strain of V. parahaemolyticus (accession no. CP034571.1) with low variability (Fig. 3).

Fig. 2

a Phylogenetic tree of AHPND-positive isolates and the reference strains. AHPND-positive isolates used in this study are named in ahpn-25 as a representative strain. The neighbor-joining tree shows the phylogenetic relationships of partial sequences of toxR, 16S rRNA, pirA (AP3), toxA, blaCARB−17, tlh, atpA, tdh, and trh genes using forward (F) and reverse (R) primers compared with closely related sequences were selected from GenBank. GenBank accession numbers are AP014859.1, CP033140.1, CP022102.1, CP028145.1, CP020078.1, Ap014860.1, KM067908.1, and CP009266.2. b The toxR, 16S rRNA, pirA (AP3), toxA, blaCARB−17, tlh, atpA, tdh, and trh has a common ancestor accession no. CP022245.1, all clades are derived with different traits with low genetic distance

Fig. 3

Multiple sequence alignment and pairwise alignment score (right) of 16S rRNA, atpA, blaCARB−17, pirA (AP3), tdh, tlh, tox, and trh partial gene sequences with the reference strain of Vibrio parahaemolyticus accession no. CP034571.1 using ClustalW and DNAMAN

The PCR amplification, agarose gel electrophoresis, and RT-qPCR assay of target genes 16S rRNA, blaCARB−17 and atpA revealed accurate amplified fragment in Fig. 1 and comparatively high expression and constantly maintained 100% specificity in Table 2 for V. parahaemolyticus (Izumiya et al. 2011; Dickinson et al. 2013) in parallel with different isolates in Table 3. The unique homology was found for target genes (16S rRNA, tox, blaCARB-17, pirA, atpA, tlh, tdh, and trh) compared with another Vibrio spp. The degrees of similarity ranges were (23–58%) for pirA, trh, blaCARB-17, tlh, 16sRNA, tlh, tdh, and tox genes in V. parahaemolyticus, respectively, compared with the atpA gene (Fig. 4). The trh revealed the highest distance of 0.736 and the lowest distance involved with the tdh gene was 0.000, showing the low divergence and lowest specificity for detection of tdh (Fig. 5).

Fig. 4

Comparison of sequence homology; the sequence of AHPND-positive strain (ahpn-25) for eight genes used as Vibrio parahaemolyticus detection targets. The 16S rRNA, pirA (AP3), tox, blaCARB−17, tlh, atpA, tdh, and trh gene homology compared with Vibrio sp. (NCBI accession no. LK021128.1, AP014860.1, CP021148.1, and CP033146.1)

Fig. 5

Distance and homology matrix of AHPND-positive strain (ahpn-25) for eight genes used as Vibrio parahaemolyticus detection targets compared with V. parahaemolyticus (NCBI accession no. AP014860.1)

The expression levels of the pirA gene, the virulence gene of AHPND-positive isolates, after incubation for 4 h at 37 °C was determined. This result showed that the pirA gene was expressed in all AHPND-positive isolates, but that levels of expression were variable (Fig. 6).

Fig. 6

Relative gene expression levels determined by RT-qPCR of pirA in AHPND-positive isolates incubated for 4 h at 37 °C in tryptone soya broth (TSB) culture medium. A non-AHPND strain ATCC17802 was used as the negative control. Error bars indicate standard error

Discussion

In this study, highly conserved detection gene 16S rRNA (Tarr et al. 2007), atpA (Izumiya et al. 2011), blaCARB-17 (Li et al. 2016), virulence gene pirA (Sirikharin et al. 2014; Han et al. 2015b), trh (Suthienkul et al. 1995), tdh (Karunasagar et al. 1996), trh (Dickinson et al. 2013) and toxic genes toxR (Neogi et al. 2010) toxA (Dangtip et al. 2015), and pirB (Han et al. 2015b) were isolated from 23 AHPND-positive isolates. AHPND causes early mortality syndrome (De Schryver et al. 2014) and outbreaks (Chonsin et al. 2015) in the shrimp aquaculture industry of Bangladesh. As previously reported, AHPND is characterized by two pir genes (Lai et al. 2015) which are deadly (Lee et al. 2015), binary toxins pirA and pirB (Kondo et al. 2014; Han et al. 2015b) genes found in isolates of V. parahaemolyticus of P. monodon.

To construct the phylogenetic relationship (Li et al. 2016), 8 Vibrio spp. were selected from GeneBank to compare with target gene sequences; all genes were derived from a common ancestor. The derived traits of pirA, atpA, 16S rRNA, tox, and tdh genes had a common ancestor sharing 100% identity with the reference strain of V. parahaemolyticus (accession nos. CP028145.1, AP014860.1, and KM067908.1); trh, blaCARB-17, and tlh genes had a common ancestor sharing 100% identity with the reference strain of V. parahaemolyticus (accession no. AP014859.1) (Fig. 2a). All genes showed a common ancestor (accession no. CP022245.1), wherein all clades were derived with different traits with very low genetic distance (Fig. 2b). The phylogenetic relationship in the sequence of target genes showed that AHPND-positive isolates belonged to Vibrio spp. and all of which were close to V. parahaemolyticus. The variability (Liu et al. 2015) of the target genes (toxR, 16S rRNA, pirA (AP3), toxA, blaCARB-17, tlh, atpA, tdh, and trh) sequence was analyzed. The few mutations and sequence inaccuracy were identified in the starting and middle regions of the genes. The genetic variations (Chonsin et al. 2015) including missing nucleotide through gene sequencing were examined.

The sequences of the PCR amplification (Kondo et al. 2014; Restrepo et al. 2016) of target genes (toxR, 16S rRNA, pirA (AP3), toxA, blaCARB-17, tlh, atpA, tdh, and trh) from an AHPND-positive representative strain (ahpn-25) were aligned with the reference strain of V. parahaemolyticus (accession no. CP034571.1) with low variability (Fig. 3). The atpA gene in AHPND-positive isolates produced high homology and 100% pairwise alignment with the reference strain in this research. The eight different target genes were aligned and obtained a consensus sequence. The pairwise alignment scores for atpA, tox, blaCARB-17, 16S rRNA, and pirA gene were 100.0, 98.90, 98.89, 95.53, and 41.42, respectively, in the AHPND-positive strain ahpn-25. Variations included a missing nucleotide position in the sequence of all target genes in this study analyzed by ORFfinder and RCSB PDB, by using Smart BLAST (CDD) and NCB (Marchler-Bauer et al. 2017; Marchler-Bauer et al. 2015; Marchler-Bauer et al. 2013). This result revealed some bacterial virulence proteins such as VirB8 and VirB10 (accession no: cl01500), TrbE (accession no: cl36305), sopB_N and ParB (accession nos: cd16394 and cl38291), TraF (accession no: cl31246), Tra8 (accession no: COG2826), PRK00409 (accession no: cl29770), and SR_Res par (accession no: cd03767), which may conserved the protein domain family in the sequences of 16S rRNA, blaCARB-17, pirA, tdh, tlh, tox, and trh gene.

The PCR amplification, agarose gel electrophoresis, and RT-qPCR assay of target genes 16S rRNA, blaCARB−17 and atpA revealed accurate amplified fragment in Fig. 1 and comparatively high expression and constantly maintained 100% specificity in Table 2 for V. parahaemolyticus (Izumiya et al. 2011; Dickinson et al. 2013) in parallel with different isolates in Table 3. Accordingly, the PCR, electrophoresis, and RT-qPCR assay of target genes toxR, pirA (AP3), toxA, tlh, tdh, and trh yielded less specificity and low expression. The level of specificity is unsatisfactory in rapid molecular methods for identifying V. parahaemolyticus, thereby hindering its comprehensive application in routine laboratory tests (Klein et al. 2014). This result assured that the isolates isolated from shrimp farms were all toxic to shrimp, but their virulence was different, and the relative expression level was variable between isolates. In this study, the relative expression levels determined by RT-qPCR (Karunasagar et al. 1996; Gutierrez West et al. 2013) of target genes showed that nine target genes were expressed in AHPND-positive representative strain, but that levels of expression were variable. The atpA-like gene exhibited the lowest degrees of similarity in V. parahaemolyticus and highest in V. anguillarum via homology analysis, indicating the most divergence in AHPND-positive isolates (Restrepo et al. 2016). The homology distance matrix for target genes of AHPND-positive strain (ahpn-25) was compared with that of reference strain (accession no: AP014860.1).

The sensitivity and specificity of RT-qPCR applied in this work can be useful to detect V. parahaemolyticus in shrimp (Penaeus monodon) in epidemiological research. All target genes in V. parahaemolyticus that may be causal agents of AHPND in shrimp may require a suitable vaccine development to prevent AHPND in Bangladesh.