Literature DB >> 33007045

Generation of a conditional mutant knock-in under the control of the natural promoter using CRISPR-Cas9 and Cre-Lox systems.

Vijay S Thakur1, Scott M Welford1,2.   

Abstract

Modulation of gene activity by creating mutations has contributed significantly to the understanding of protein functions. Oftentimes, however, mutational analyses use overexpression studies, in which proteins are taken out of their normal contexts and stoichiometries. In the present work, we sought to develop an approach to simultaneously use the CRISPR/Cas9 and Cre-Lox techniques to modify the endogenous SAT1 gene to introduce mutant forms of the protein while still under the control of its natural gene promoter. We cloned the C-terminal portion of wild type (WT) SAT1, through the transcriptional stop elements, and flanked by LoxP sites in front of an identical version of SAT1 containing point mutations in critical binding sites. The construct was inserted into the endogenous SAT1 locus by Non-Homologous End Joining (NHEJ) after a CRISPR/Cas9 induced DNA double strand break. After validating that normal function of SAT1 was not altered by the insertional event, we were then able to assess the impact of point mutations by introduction of Cre recombinase. The system thus enables generation of cells in which endogenous WT SAT1 can be conditionally modified, and allow investigation of the functional consequences of site specific mutations in the context of the normal promoter and chromatin regulation.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 33007045      PMCID: PMC7531807          DOI: 10.1371/journal.pone.0240256

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Genetic manipulation techniques, such as Cre-LoxP, flp-FRT, and CRISPR/Cas9, are extremely powerful tools to modify the genome as desired to decipher the functions of genes or genetic elements. Cre-LoxP technology has been successfully used for site and time specific gene manipulations in various species including mouse and mammalian cell cultures. The technique was developed in 1980s and is based on the ability of cyclization recombinase gene (cre) obtained from P1 bacteriophage to effect recombination between pairs of loxP (ATAACTTCGTATAatgtatgcTATACGAAGTTAT) sites [1,2]. Such recombination can lead to the deletion of DNA present between two loxP sites if they are orientated in same direction, or flip the orientation of a DNA segment between two loxP sites if oriented in opposite directions. The technique can therefore be used to alter the genome as temporally desired by recombining segments of DNA. CRISPR/Cas9 is a more recent genome editing technology that was discovered from a bacterial self-defense system against viruses or plasmids. When viruses infect bacteria, the bacteria can capture a small piece of viral DNA and store them interspaced by short palindromic repeats in the form of an array known as Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR). The array serves as memory for bacteria for future attacks by similar viruses. When exposed to the virus or DNA again, the bacteria use the information to synthesize non-coding crRNA, which bind to the foreign DNA with similar sequence and cause double strand breaks (DSBs) using CRISPR-associated protein 9 (Cas9) to inactivate them. As Cas9 requires a specific element named the Protospacer-associated motif (PAM) on the 3’ end of the DNA sequence in order to bind to DNA and cut, the viral DNA pieces are evidently not randomly selected by the bacterial defense mechanism. This uniqueness of the CRISPR bacterial defense system has been exploited in CRISPR/Cas9 technology to induce DSBs at specific sites in the genomes of higher organisms to allow genome manipulation [3-5]. DSBs in eukaryotic organisms, for example, normally initiate DNA repair via non-homologous end joining (NHEJ) or Homology Directed Repair (HDR). NHEJ typically leads to short insertion/deletion (indels) near the cutting site, which if in a coding region of a gene or a critical genomic element, can disrupt function. On the other hand, introduction of DNA with homologous sequences near the cut site can allow insertion of a DNA segment of interest. Being so simple, versatile and precise, CRISPR/Cas9 has been quickly adopted as a preferred molecular tool in elucidating gene functions. The technique is already revolutionizing the field of biomedical research and gene therapy. It has been reported that traditional site-specific genetic manipulation tools, like Cre/LoxP, and CRISPR/Cas9 technology can be combined to modify genes to accelerate conditional gene targeting [6,7]. In the present work, we have combined CRISPR/Cas9 and Cre/LoxP, and successfully created a CRISPR-Cas9-LoxP system to replace a part of the endogenous SAT1 gene with an in vitro reconstructed wild type/mutant cassette that can be switched upon Cre expression. SAT1 (Spermidine/spermine N1-acetyltransferase 1) is the rate limiting enzyme in polyamine catabolism. We recently identified a novel role for SAT1 in gene regulation [8], which raised questions about the known, existing functions of SAT1 in its new role in transcription. Using the dual CRISPR-Cas9-LoxP system, we successful created a knock-in cassette to manipulate SAT1 between wild type or mutant, enabling study of the importance of specific binding pockets and gain molecular insights into the normal biology of SAT1.

Methods

Construction of insert

SAT1 is a 6 exon gene spanning 3,400 nucleotides on the X chromosome (Fig 1A and S1 Fig). To construct a DNA insert to be incorporated into the SAT1 gene to make a conditional knock-in allele, 4 different pieces of the SAT1 gene were cloned: Part 1: approximately 2400 bp of SAT1 starting upstream of the transcriptional start site through intron 3, with a KpnI restriction site on the 5’ and an XhoI restriction site on the 3’; Part 2A: exons 4–6 with a LoxP sequence following the XhoI restriction site on the 5’ end, and a ClaI restriction site on the 3’ end; Part 2B: exons 4–6 including point mutations and a LoxP site following a ClaI restriction site on the 5’ end, and an EcoRI restriction site on the 3’ end; Part 3: from exon 6 to approximately 1000 bp downstream with EcoR1 and NotI sites on the 5’ and 3’ ends, respectively (S2 Fig). The parts were amplified with PCR using primers containing the desired restriction enzyme sites and LoxP sites (see Table 1 for primer sequences). The sequences of all of the amplified fragments of the gene were verified by Sanger sequencing. Each amplified piece was cloned into pBSKSII+. Two sites corresponding to amino acids 101 and 152 were mutated in Part 2B in pBSKSII+ using site directed mutagenesis to obtain a plasmid containing E152K and R101A point mutations (Part 2-DM), or only the E152K single mutation (Part 2-SM). The different parts were then combined to obtain the final construct. In order to make the vector blasticidin selectable, the blasticidin gene under the PGK promoter was amplified from pLX304 and inserted on the 3’ side of the constructed insert enclosed within NotI restriction sites (Fig 1). Finally, the plasmid was linearized by cutting with NaeI and purified before transfection.
Fig 1

Construction of insert.

A. Schematic of the SAT1 locus, indicating exons and introns, the gRNA site location, the mutation sites, the START and STOP codons, and the transcriptional stop AATAAA sequence. Below are the four PCR ‘parts’ and the location of the loxP sites and the primers used for sequence validation. B. The engineered SAT1 insert in pBSSKII+ plasmid with features indicated. C. Schematic of the SAT1 locus after CRISPR/Cas9 mediated incorporation of the target construct. D. Schematic of the SAT1 locus after Cre recombination. BSD = Blasticidin S deaminase; hPGK = human 3-phosphoglycerate kinase promoter.

Table 1

Primers used in the study.

PurposeSequenceRestriction site
Amplify Part 1F: 5’-GCAGGTACCCCCGGATCACACTTTGAGAA-3’KpnI
Amplify Part 1R: 5’-CAGCTCGAGGACTGGCCACTCTGCAGTCT-3’XhoI
Amplify Part 2AF: 5’-GCACTCGAGATAACTTCGTATAGCATACATTATACGAAGTTATCACAGTTGTAGCCTGACTTCAGTG-3’XhoI
Amplify Part 2AR: 5’-CAGATCGATAAAGAACTAGTAAAAATGCTTACACCAAAC-3’ClaI
Amplify Part 2BF: 5’-GCAATCGATATAACTTCGTATAGCATACATTATACGAAGTTATCACAGTTGTAGCCTGACTTCAGTG-3’ClaI
Amplify Part 2BR: 5’-CAGGAATTCAAAGAACTAGTAAAAATGCTTACACCAAAC -3’EcoRI
Amplify Part 3F: 5’-GCAGAATTCATTTCTTACACATCTTTCTTGCTGTT-3’EcoRI
Amplify Part 3R: 5’-CAGGCGGCCGCTCTTGATTTTCAATGTTTCATAATCC-3’NotI
Amplify BSDF: 5’-GCAGCGGCCGCTTCAGACCCACCTCCCAAC-3’NotI
Amplify BSDR: 5’-CAGGCGGCCGCTGGATCTCTGCTGTCCCTGT-3’NotI
Site specific mutation R101AF: 5’-CTTCGTGATGAGTGATTATGCAGGTACGATTGAGTTCGG-3’
Site specific mutation R101AR: 5’-CCGAACTCAATCGTACCTGCATAATCACTCATCACGAAG-3’
Site specific mutation E152KF: 5’-GATCTGTCCAGTGAAAAGGGTTGGAGACTG-3’
Site specific mutation E152KR: 5’-CAGTCTCCAACCCTTTTCACTGGACAGATC-3’
Amplify SAT1 sgRNA siteF: 5’-GGCGGGGAGGTAACTAAAAG-3’
Amplify SAT1 sgRNA siteR: 5’-CCACTGCTGGATGATCTCAC-3’
Clone test: R45’-GCCATGGCTGTCTCATGATT-3’
Clone test: R115’-GTTGTCTGGGTGGTTGCTTT-3’
Clone test: R125’-CTGGCGTAATAGCGAAGAGG-3’
Clone test: R135’-CCTCTGCTCCGAACTCAATC-3’
Clone test: R155’-CAGAGTGGCCAGTCCTCGAG-3’
Clone test: R185’-AGCAGCACTCCTCACTCCTC-3’
Clone test: R195’-CCGAACTCAATCGTACCTCT-3’
Clone test: R205’-CCGAACTCAATCGTACCTGC-3’

Construction of insert.

A. Schematic of the SAT1 locus, indicating exons and introns, the gRNA site location, the mutation sites, the START and STOP codons, and the transcriptional stop AATAAA sequence. Below are the four PCR ‘parts’ and the location of the loxP sites and the primers used for sequence validation. B. The engineered SAT1 insert in pBSSKII+ plasmid with features indicated. C. Schematic of the SAT1 locus after CRISPR/Cas9 mediated incorporation of the target construct. D. Schematic of the SAT1 locus after Cre recombination. BSD = Blasticidin S deaminase; hPGK = human 3-phosphoglycerate kinase promoter.

Design and synthesis of sgRNA

An sgRNA was designed using the Optimized CRISPR design-site (https://chopchop.cbu.uib.no). The criteria for gRNA selection were high cutting efficiency, low off site targets, and cutting of DNA at least 150 bases upstream of exon 4. We used the Guide-it sgRNA In Vitro Transcription Kit (Takara Bio USA, Inc.) to produce the sgRNA. Briefly, first a forward PCR primer was designed as a DNA template for sgRNA containing our target sequence as per manufacturer’s protocol. By performing a PCR reaction with the included Guide-it Scaffold Template and a primer we designed, the DNA template that contains the sgRNA-encoding sequence under the control of a T7 promoter was generated. This DNA template was in vitro transcribed to sgRNA and purified. The transcribed sgRNA was analyzed for its cleavage efficiency of an SAT1 DNA segment which contains the sgRNA next to a PAM sequence on its 3’ end.

Transfection

U87MG cells were plated in 6 well plates at a density of 2.5x105 per well. 720 ng of insert linearized by cutting with the NaeI restriction enzyme and purified using a gel extraction kit, 1.5μg of Cas9, and 360ng of sgRNA and 9uL lipofectamine RNAiMax (Thermo Fisher) reagent were used to transfect the cells.

Clonal selection and characterization of clones

One day after transfection, cells were put under blasticidin selection. Individual clones were picked and expanded when sufficiently large. Genomic DNA from the clones was isolated. PCR was performed using primer pair F-R11 and R-4 to verify if the 5’ end of the insert was next to the selected gRNA cut site; and primer pair F-R12 and R-R13 to verify if insert was at the correct place in the SAT1 gene and in the correct orientation (see Table 1 for primer sequences). The amplified PCR products were gel purified and sequenced.

Western blots

Westerns were performed using standard procedures by running RIPA cell lysates on denaturing polyacrylamide gels, transferring to PVDF membranes, and staining with the following antibodies: SAT1: ab105220 (Abcam); MELK: HPA017214 (Sigma); FOXM1: PA5-27144 (Thermo Fisher); β-actin: A1978 (Sigma). Quantification of the blots was performed with ImageJ, and statistical calculations by student’s t tests were performed with GraphPad Prism 7.05.

DNA gels electrophoresis

Post PCR samples were separated on 1.2% agarose gels and stained with ethidium bromide, and then visualized with a UV illuminator according to standard methods. A 1 kilobase DNA ladder was used as a size standard.

Results

In order to test the effect of specific SAT1 mutants in the biology of polyamine metabolism, common approaches of shRNA or even CRISPR/Cas9 knockout followed by re-expression of mutant constructs are inadequate due to the challenge of replicating endogenous levels of expression. We therefore attempted to develop a CRISPR/Cas9-based knockin approach to insert appropriate mutants into the normal SAT1 locus. The U87MG glioblastoma cell line was chosen as the target cell line because it is easy to culture and is amenable to viral infections. Therefore, the SAT1 locus, as indicated in Fig 1A was used to design a knock-in scheme whereby exons 4–6 would be duplicated with the wild type exons flanked by loxP sites, and immediately followed by mutant exons 4–6. The concept is to maintain all of the regulatory elements of the endogenous locus, including the intron/exon boundaries, the transcriptional termination sequence, and any potential transcriptional regulatory elements within or down-stream of the gene by extending the construct well beyond the normal end of transcription before introducing a selectable antibiotic resistance marker (blasticidin s deaminiase) (Fig 1B).

Cutting efficiency of the sgRNA

The sequence of intron 3 of SAT1 (tatttactattctgaactgccgtgtaaacctgacgtattcccaagtcaacataccagtataccaataggatgtgaataatgtgtgtgttgagtttaaaaccatagcagttttgctctggcaagtaatgaaagcgttctcgcttcctgagtgtgagctccagcagactgcagagtggccagtc) was analyzed by the CHOPCHOP gRNA design tool (https://chopchop.cbu.uib.no), and the high scoring gRNA sequence GGGAATACGTCAGGTTTACA was selected. A 56 nucleotide forward primer CCTCTAATACGACTCACTATAGGGAATACGTCAGGTTTACAGTTTAAGAGCTATGC was designed to create the DNA template for the sgRNA. After gel electrophoresis, the sgRNA had a band that appeared the proper size of 150bp (Fig 2A). The sgRNA was tested for its cleavage efficiency at the selected sequence on inton 3 of the SAT1 gene. The sgRNA was incubated with a fragment amplified from genomic DNA obtained from U87MG cells containing the gRNA sequence (Fig 2B) and Cas9 endonuclease in vitro. The DNA fragment was cleaved into two pieces with near 100% efficiency (Fig 2C, lane 2).
Fig 2

In vitro transcription and screening of sgRNA.

A. Gel electrophoresis of the PCR product of In Vitro Transcription of sgRNA B. PCR product of 819-bp target fragment amplified from the SAT1 gene containing gRNA sequence. C. The PCR amplified SAT1 fragment, the sgRNA, and recombinant Cas9 enzyme were combined in an in vitro cleavage reaction according to the protocol. The reaction mixture was run on 2% Agarose gel. Lane. 1 shows the untreated target SAT1 fragment, and Lane 2 shows the Cas9 treated, cleaved target fragments.

In vitro transcription and screening of sgRNA.

A. Gel electrophoresis of the PCR product of In Vitro Transcription of sgRNA B. PCR product of 819-bp target fragment amplified from the SAT1 gene containing gRNA sequence. C. The PCR amplified SAT1 fragment, the sgRNA, and recombinant Cas9 enzyme were combined in an in vitro cleavage reaction according to the protocol. The reaction mixture was run on 2% Agarose gel. Lane. 1 shows the untreated target SAT1 fragment, and Lane 2 shows the Cas9 treated, cleaved target fragments.

Verification of incorporation of the insert in the correct place and orientation in the SAT1 gene

According to the design, after transfection, Cas9 will cleave endogenous SAT1 as well as the linearized insert at the sgRNA site. Notably, U87MG cells have only one X chromosome, facilitating the approach. The insert may be randomly or specifically inserted during NHEJ DNA repair. Insertion of DNA fragments as big as 48 kilobases using NHEJ repair has been successfully used in the past and has shown that the percentage of cells which incorporated large fragments into the genome was higher than using an HDR mechanism [9], particularly as a significantly lower number of cells are in S/G2 phase of the cycle at any given time compared to the entire population. In order to confirm that the insert was placed into the SAT1 gene at the right place and orientation, and a functional wild type SAT1 gene remained intact, the cells were selected using blasticidin and genomic DNA was PCR amplified. Primer R11, which binds the SAT1 gene upstream of the gRNA cut site, and R4, which binds to downstream of the gRNA cut site after the LoxP sequence on the wild type exon 4-exon6 part, were used. We also performed PCR on genomic DNA from the clones to further confirm that the insert has incorporated at the correct place using the R12 forward primer which binds to pBSKSII+ plasmid sequences remaining on the insert after linearization, and the R13 reverse primer that binds to intron 4 of SAT1 (Fig 3). After PCR, gel purified PCR products were subjected to DNA sequencing for confirmation of amplification of the proper fragments (S3 Fig). In order to identify the successful clones, we screened a total of 84 clones (27 for the double mutant, and 57 for the single mutant. PCR success rate was 32% (27/84), but upon further analyses to ensure all parts of the vector were incorporated, 3 of the 27 clones were deemed correct. Thus the overall success rate was 3.6%.
Fig 3

Genomic PCR analysis of positive clones for verification of incorporation of the insert in the right place and orientation in the SAT1 gene.

Primer pair R4/R11 and R12/R13 amplify the 5’-junction (608bp) and the 3’-junction (709bp) of the engineered insert integration, respectively. All amplified DNA fragments exhibited expected sizes (including some additions and deletion between the sequences of primers), indicating correct integration of the insert into endogenous SAT1 gene via NHEJ.

Genomic PCR analysis of positive clones for verification of incorporation of the insert in the right place and orientation in the SAT1 gene.

Primer pair R4/R11 and R12/R13 amplify the 5’-junction (608bp) and the 3’-junction (709bp) of the engineered insert integration, respectively. All amplified DNA fragments exhibited expected sizes (including some additions and deletion between the sequences of primers), indicating correct integration of the insert into endogenous SAT1 gene via NHEJ.

Confirmation of conversion of wild type SAT1 to mutant SAT1 after Cre expression

In order to verify conditional conversion of wild type SAT1 to mutant SAT1, cells of clones DM#2 and SM#36 were infected with either 200 multiplicity of infection (MOI) or 800 MOI control adenovirus or Cre recombinase expressing viruses for 3 days. Genomic DNA was isolated from the cells and amplified using forward primer R15 which binds to both wild type as well as mutated SAT1 (R101A). The reverse primers used were R19 which amplify only wild type SAT1 and not mutated SAT1 (R101A), and R20 which will amplify mutated SAT1 (R101A) but not wild type SAT1. The primers R19 and R20 have two unique nucleotides on the 3’ end. Results showed that the wild type gene amplified using primer set R15/R19 in control Adeno virus treated clones but not when treated with Adeno-Cre viruses; whereas with primer set R15/R20, the wild type gene was not amplified in control adenovirus treated cells but was amplified in Adeno-Cre treated clonal cells (Fig 4A). The amplified DNA was gel extracted and sequenced to confirm the conditional conversion of wild type SAT1 to the mutant forms. As the primers have >90% similar sequence, some amplification with R15/R19 primers in Adeno-Cre virus treated samples and with R15/R20 primers in Adeno-control samples occurred. DNA sequencing of these bands however still confirmed wild type or mutant SAT1 in adeno-control or adeno-Cre treated samples, respectively (Fig 4B).
Fig 4

Validation of clone DM#2.

A. Primer pair R15/R19 and R15/R20 amplify the WT or mutant SAT1, respectively. B. Sequence results of the PCR products confirm the conversion of WT codon (AGA) to mutant codon (GCA) of amino acid 101 of SAT1 protein. C. Primer pairs R15/R18 and R17/R18 amplify the WT and mutant SAT1 at nucleotides corresponding to amino acids 101 and 152 of SAT1 protein. D. Sequence results of the PCR products confirm the conversion of WT to mutant SAT1 gene.

Validation of clone DM#2.

A. Primer pair R15/R19 and R15/R20 amplify the WT or mutant SAT1, respectively. B. Sequence results of the PCR products confirm the conversion of WT codon (AGA) to mutant codon (GCA) of amino acid 101 of SAT1 protein. C. Primer pairs R15/R18 and R17/R18 amplify the WT and mutant SAT1 at nucleotides corresponding to amino acids 101 and 152 of SAT1 protein. D. Sequence results of the PCR products confirm the conversion of WT to mutant SAT1 gene. As mutation E152K is caused by to only one nucleotide change, unlike R101A where two nucleotides change, we were not able to design a primer which can cause differential amplification of wild type vs. the E152K mutant. Therefore, after PCR amplification using primer sets R15/R18 to amplify the region of the second mutation, DNA sequencing was performed to confirm the conversion of wild type to mutant SAT1 (Figs 4C, 4D, 5A and 5B). DNA sequencing confirmed that expression of Cre using adenovirus was able to delete the wild type part of SAT1 between exons 4–6, and allow replacement with mutant exons 4–6. In SM#36, Cre was also expressed from Lentivirus to achieve the same result. DNA sequencing of the DNA fragments obtained using R15/R18 primers again confirmed the conversion of wild type SAT1 gene to the mutant form (Fig 5C and 5D).
Fig 5

Validation of clone SM#36.

A. DNA gel showing DNA amplification of WT or mutant SAT1 using R15/R18 and R17/R18 primers. B. Sequence results of the PCR products confirm the conversion of WT codon (AAG) to mutant codon (AAA) of amino acid 152 of SAT1 protein after Cre recombination. C. DNA gel showing DNA amplification of WT or mutant SAT1 using R15/R18 and R17/R18 primers after Cre recombination. D. Sequence results of the PCR products confirm the conversion of the WT codon (AGA) to the mutant codon (GCA) for amino acid 101; and the WT codon (AAG) to the mutant codon (AAA) for amino acid 152 of SAT1.

Validation of clone SM#36.

A. DNA gel showing DNA amplification of WT or mutant SAT1 using R15/R18 and R17/R18 primers. B. Sequence results of the PCR products confirm the conversion of WT codon (AAG) to mutant codon (AAA) of amino acid 152 of SAT1 protein after Cre recombination. C. DNA gel showing DNA amplification of WT or mutant SAT1 using R15/R18 and R17/R18 primers after Cre recombination. D. Sequence results of the PCR products confirm the conversion of the WT codon (AGA) to the mutant codon (GCA) for amino acid 101; and the WT codon (AAG) to the mutant codon (AAA) for amino acid 152 of SAT1.

Effect of SAT1 mutation on its downstream targets genes

We have previously reported that MELK and FOXM1 are downstream targets of SAT1 transcriptional activity, and SAT1 enzymatic activity is required for this role [8]. We wanted to examine the effect of conversion of wild type SAT1 to mutant SAT1, which causes loss of its polyamine acetylation enzymatic activity, on transcriptional activity. As an essential control experiment, we first measured the levels of each of SAT1, FOXM1, and MELK in the mutant clones compared to the parental U87MG cell line from which they were derived. In the absence of Cre recombination, we found that the levels of each of the three proteins were not significantly different (Fig 6A and 6B), suggesting we had not inadvertently disrupted the basal function of SAT1, and that targeting was sufficiently specific. We then proceeded to assess the effect of Cre recombination on FOXM1 and MELK. As see in Fig 6C and 6D, the conversion of wild type SAT1 to mutant SAT1 did not significantly alter SAT1 protein levels, but the levels of MELK and FOXM1 decreased significantly. The results confirm that the CRISPR/Cas9-LoxP approach for generation of conditional mutant gene under the control of its own promoter is attainable and useful for studying in vivo gene functions.
Fig 6

Effect of SAT1 mutation on its downstream targets genes.

A. Western blot of parental U87MG and knockin clones DM#2 and SM#36 demonstrating insignificant changes to basal levels of FOXM1, MELK, and SAT1. B. Quantification of three replicate experiments. C. Western blot of Cre infected DM#2 and SM#36 showing changes in FOXM1 and MELK. D. Quantification of three replicate experiments. Uncropped and replicate westerns are shown in supplementary data.

Effect of SAT1 mutation on its downstream targets genes.

A. Western blot of parental U87MG and knockin clones DM#2 and SM#36 demonstrating insignificant changes to basal levels of FOXM1, MELK, and SAT1. B. Quantification of three replicate experiments. C. Western blot of Cre infected DM#2 and SM#36 showing changes in FOXM1 and MELK. D. Quantification of three replicate experiments. Uncropped and replicate westerns are shown in supplementary data.

Discussion

In this study, by combining CRISPR-Cas9 and Cre/LoxP technologies, we successfully generated cell lines in which wild type SAT1 can be conditionally modified to a mutant form under the control of its natural promoter. We exploited NHEJ repair to introduce an engineered DNA fragment into the SAT1 gene after induction of a CRISPR-Cas9-induced DNA double stranded break at a specific site on the SAT1 gene. The design presented here provides a framework that could be exploited for any other gene in the genome, depending on the complexity of a given locus. For SAT1, the tools allow the dissection of function between what is known in the literature from a variety of studies and a novel function that we recently uncovered, namely as a transcriptional regulator. Given that exogenous expression of SAT1 causes general failure of protein translation and subsequent cell death [10], a knock-in strategy to avoid toxicity of overexpression was essential. Likewise, overexpression of many genes leads to artificial phenotypes. Thus, using the CRISPR-Cas9-LoxP approach allows relevant observation of endogenous biological functions. Knocking in exogenous DNA into a specific site in the genome to maintain genomic integrity has significant experimental advantages. In the past, an HDR approach has been successfully applied to introduce a fragment of DNA into a gene by exogenously providing a complimentary sequence. Homologous recombination for precise DNA insertion or replacement at a selected genomic locus has been widely used with great success in generating genetically modified cells in culture and in experimental animals [11-15]. As HDR occurs only during S/G2 phase, however, the process can result in a low efficiency. Therefore, a modified approach would be advantageous to increase the practicality of knock-in experiments. DNA repair using NHEJ takes place throughout the cell cycle and is a dominant DNA repair mechanism in mammalian cells [9]. Even in HDR based gene targeting studies, the frequency of NHEJ indels is higher than HDR mediated DNA insertion even when single strand oligonucleotides were provided for HDR-mediated gene correction [16,17]. Lin, et al. reported the capture of DNA sequences at double-strand breaks in mammalian chromosomes [18]. Orlando et al. reported successful insertion of small oligonucleotides efficiently can be inserted via NHEJ at the DSB caused by Zinc finger nucleases on genomic DNA [19]. Three years later, two studies showed that successful integration of large plasmid DNAs can be successfully integrated in the genome by NHEJ repair mechanism after simultaneous cleavage of both plasmid and genome DNAs by ZFN/TALEN nucleases [20,21]. In the genome of zebrafish and Xenopus, where HDR-mediated gene insertion is extremely inefficient, an NHEJ repair mechanism was successfully and efficiently used to insert DNAs at CRISPR/Cas9 generated DSBs [22-24]. A recent study showed that homology independent high knock-in events mediated by NHEJ, were able to knock-in DNA as big as 34 kilobases with much higher efficiency than using HDR [9]. In the present study we used an NHEJ approach, because the insert had no region of homology, to knock-in our DNA insert into SAT1 gene. No gene editing technology (to date) is perfect, and some limitation must be considered. In the present study, we took advantage of the fact that SAT1 is localized to the X chromosome, and using cells derived from a male glioblastoma patient meant that only a single locus needed to be edited. We cannot at present assume that the success rate would have been the same if two loci were targeted for an autosomal gene. That said, CRISPR/Cas9 approaches frequently knockout two loci without tremendous reductions in efficiency [6], and it is likely that a similar strategy would work for genes not on the X chromosome in a male cell line. An additional limitation, which is common for all template based knock-in approaches, could be the length of insert. We were fortunate in the case of SAT1 to be targeting to amino acids relatively close to each other. Should one desire to alter residues at greater distances, there is no reason to think a second round of CRISPR/Cas9 would be any more challenging than the first, and one could imagine significantly more complicated schemes that would still be controlled by Cre in the end. Results of this study confirm that CRISPR/Cas9-coupled NHEJ repair can provide a valuable path for efficient knock-in of large DNA segments in human cells. Wild type SAT1 can be conditionally converted to a mutant version while still under the control of its natural promoter by supplying Cre recombinase at the desired time. The system can thus be used to study and identify the function of enzymatic activity of SAT1 gene in regulating its downstream pathways and providing better understanding of its mechanism in genomic function. The approach can also be expanded to study other genes in cells.

Sequence of SAT1 gene.

Introns are depicted small letters and exons in capital letters. (PPTX) Click here for additional data file.

Parts of the SAT1 CRISPR/Cas9 gene editing construct.

(PPTX) Click here for additional data file.

Sequences of ligation sites in clones.

Addition or deletion on 5’ and 3’ end of the insert on DNA sequence. (PPTX) Click here for additional data file.

Raw gel images.

(PPTX) Click here for additional data file.

Raw and triplicate western images in different exposures.

(PPTX) Click here for additional data file. 17 Jun 2020 PONE-D-20-13689 Generation of a conditional mutant knock-in under the control of the natural promoter using CRISPR-Cas9 and Cre-Lox systems. PLOS ONE Dear Dr. Welford, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. There are both experimental, statistical and textual issues that must be completed. Experimental and Statistical. Present the raw data for Western blots in supplementary experiments. Provide a link to all of the sequencing data. Provide the raw data for Western blots and all other electrophoretic experiments. As noted by Reviewer 2, the Western blots of Sat1 and its targets must be compared with the original cell line. Please indicate the number of times the Western analysis was performed, quantify the data, and determine statistical significance. If the experimental has not been repeated, please conduct at least three times (including the above controls). Textual In the Results section, 1 st paragraph what is the meaning of "score" The Results section should open with a brief overview of the method that should be shown diagrammatically in a new Figure 1. The Materials and Methods are incomplete and lack methods including electrophoretic and blotting techniques such as Western analysis as sequencing and statistical analysis (for Westerns). The text contains multiple grammatical errors throughout.  Please correct these errors. (Examples: Abstract:"an identical region SAT1 containing";  "CRISPR/Cas9 induced DNA double break".) Please provide more detail in the current Figure 1 as suggested by Reviewer 3. Address all other issues not mentioned above from the Reviewers. There are no conflicts among the Reviewers. They present different valuable insights. The AE evaluation focused on structural aspects of the manuscript and experimental issues (as noted above). Please submit your revised manuscript by Aug 01 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols We look forward to receiving your revised manuscript. Kind regards, Arthur J. Lustig, PhD Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2.  PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions. 3. Please include your tables as part of your main manuscript and remove the individual files. Please note that supplementary tables (should remain/ be uploaded) as separate "supporting information" files [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: No Reviewer #3: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: N/A Reviewer #2: No Reviewer #3: N/A ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Comments: Authors describe an approach to introduce mutant forms of the endogenous SAT1 gene in mammalian cells by simultaneously using the CRISPR/Cas9 and Cre-Lox techniques. This approach could also be expanded to dissect functions of other genes that are important for cell growth and therefore cannot be simply deleted. Minor issues to be addressed: 1. Are there any published approaches that combining CRISPR/Cas9 and Cre-Lox systems, either using in mammalian or in other eukaryotic cells? It would be valuable for the readers to know the differences between the existing methods and the one established in this study. 2. Please give the detail data about the efficiency and the positive rate of this method in the text. 3. Please give a clear information of “U87MG cells” in the text. 4. In figure 1, please explain “BSD” and “hPGK” in the figure legend. Reviewer #2: The manuscript by Thakur and Welford describe a smart system to create inducible mutant alleles combining CRISPR/Cas9 and Cre/lox in one transgenesis cassette integrated in the locus of choice via NHEJ. Several aspects of the manuscript remain a bit obscure and needs to be clarified for the efficiency of the method to be evaluated by potential other users. 1)How many clones where tested to find the two ones that have the correct integrations and are further characterized? 2)it would be much easier to evaluate the PCR results if the primer position would be indicated in a schematic like the one in fig 1B-C. 3)The western blot analysis of Sat1 and its targets should be integrated with a comparison of the same levels in the cell lines from which the transgenic ones were derived (U87MG) to show that the cassette integration doesn't affect the expression and is regulated at endogenous levels. 4)The western blots should be performed in triplicates at least and the results quantified as it's common standard nowadays. Also Uncropped blots should be made available. Minor point The file "paper tables" contains also the supplementary figures that are therefore duplicated. Reviewer #3: In the current manuscript, Thakur VS et al. developed an interesting approach to simultaneously use the CRISPR/Cas9 and Cre-Lox techniques to modify the endogenous SAT1 gene to introduce mutant forms of the protein while still under the control of its natural gene promoter. The authors first inserted a construct containing both wild type and mutant Exon4-Exon6 fragments into intron 3 of the endogenous SAT1 locus by NHEJ after a CRISPR/Cas9-induced DSB. The wild-type Exon4-6 fragment was then deleted by Cre recombinase. The authors show that the SAT1 mutant cell lines had reduced FoxM1 and MELK expression. Although the manuscript is well written, several points require further clarification. 1. Supplementary Figure 1 and 2 should be summarized as a figure and put in Figure 1. The scheme should include start codon, stop codon, mutation sites etc. 2. Stop codon should be marked in both WT and mutant SAT1 in Figure 1. 3. Figure 4 and 5, the location of primers should be labeled in a scheme of the transgene. 4. Figure 4C and D are not described in the text. 5. Figure 6, additional SAT1 activity assays would strengthen the conclusion. 6. Off-target integrations occurred during the NHEJ-mediated knock-in were discussed, but not studied. 7. Limitations of this new approach should be discussed. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No Reviewer #3: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 21 Aug 2020 AE: o Experimental and Statistical. � Present the raw data for Western blots in supplementary experiments. Raw data now presented in supplementary figure 4 and 5. � Provide a link to all of the sequencing data. All sequencing data are presented in supplementary figure 3. � Provide the raw data for Western blots and all other electrophoretic experiments. Raw data now presented in supplementary figure 4 and 5. � As noted by Reviewer 2, the Western blots of Sat1 and its targets must be compared with the original cell line. New data has been added to figure 6 to address this. � Please indicate the number of times the Western analysis was performed, quantify the data, and determine statistical significance. If the experimental has not been repeated, please conduct at least three times (including the above controls). All westerns were performed three times, quantified, and presented now in figure 6 and supplementary 5. o Textual � In the Results section, 1 st paragraph what is the meaning of "score" The gRNA design tool CHOPCHOP was used, and a high scoring gRNA with minimal predicted off target sites was chosen. We have clarified this in the text. � The Results section should open with a brief overview of the method that should be shown diagrammatically in a new Figure 1. A new Figure 1A has been made, and appropriately introduced. � The Materials and Methods are incomplete and lack methods including electrophoretic and blotting techniques such as Western analysis as sequencing and statistical analysis (for Westerns). More details were added. � The text contains multiple grammatical errors throughout. Please correct these errors. (Examples: Abstract:"an identical region SAT1 containing"; "CRISPR/Cas9 induced DNA double break".) Completed. � Please provide more detail in the current Figure 1 as suggested by Reviewer 3. Completed. Reviewer #1: Minor issues to be addressed: 1. Are there any published approaches that combining CRISPR/Cas9 and Cre-Lox systems, either using in mammalian or in other eukaryotic cells? It would be valuable for the readers to know the differences between the existing methods and the one established in this study. Indeed, there is a published approach that combined CRISPR/Cas9 and Cre-Lox systems and has been cited in the paper (reference 7). However, in that study, WT gene was not modified, but an exogenous gene under an artificial promoter was introduced which can then be manipulated using Cre-Lox system. In our paper, we modified the WT SAT1 gene such that it can be converted to its mutated version by cre activation while still under its natural promoter. 2. Please give the detail data about the efficiency and the positive rate of this method in the text. This data has been added to the results. 3. Please give a clear information of “U87MG cells” in the text. U87MG has been properly introduced. 4. In figure 1, please explain “BSD” and “hPGK” in the figure legend. The abbreviations have been added to the legend. Reviewer #2: 1)How many clones where tested to find the two ones that have the correct integrations and are further characterized? This data is added to the results. 2)it would be much easier to evaluate the PCR results if the primer position would be indicated in a schematic like the one in fig 1B-C. Primer locations were added to Figure 1A 3)The western blot analysis of Sat1 and its targets should be integrated with a comparison of the same levels in the cell lines from which the transgenic ones were derived (U87MG) to show that the cassette integration doesn't affect the expression and is regulated at endogenous levels. This data was now added to figure 6. 4)The western blots should be performed in triplicates at least and the results quantified as it's common standard nowadays. Also Uncropped blots should be made available. All westerns were performed three times, quantified and the data are presented in figure 6 and in supplementary figure 5 Minor point The file "paper tables" contains also the supplementary figures that are therefore duplicated. The duplication was removed. Reviewer #3: 1. Supplementary Figure 1 and 2 should be summarized as a figure and put in Figure 1. The scheme should include start codon, stop codon, mutation sites etc. A new panel was added to figure 1. 2. Stop codon should be marked in both WT and mutant SAT1 in Figure 1. Stop codons are identified. 3. Figure 4 and 5, the location of primers should be labeled in a scheme of the transgene. Primer locations were added to Figure 1A 4. Figure 4C and D are not described in the text. The text was amended to include the references to Figure 4C and D 5. Figure 6, additional SAT1 activity assays would strengthen the conclusion. We agree that activity assays would strengthen the biology behind the story here, but felt this was a bit beyond the scope of the study. As we are not claiming a biological advance in this work, the sequencing confirms the presence of the alteration. We do appreciate the comment and are applying this to future studies currently. 6. Off-target integrations occurred during the NHEJ-mediated knock-in were discussed, but not studied. There is of course always a chance that off target editing will occur. Because we saw no changes to the endogenous levels of SAT1 before Cre recombinase activity excised the loxP cassette, we are confident that off target effects are likely minimal in our case. A comment was added to the results to address this point. 7. Limitations of this new approach should be discussed. The discussion was amended to address limitations. Submitted filename: responses to reviewers.docx Click here for additional data file. 23 Sep 2020 Generation of a conditional mutant knock-in under the control of the natural promoter using CRISPR-Cas9 and Cre-Lox systems. PONE-D-20-13689R1 Dear Dr. Welford, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Arthur J. Lustig, PhD Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #2: All comments have been addressed Reviewer #3: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #2: Yes Reviewer #3: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #2: Yes Reviewer #3: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #2: Yes Reviewer #3: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #2: Yes Reviewer #3: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #2: The authors have addressed all my major concerns. I believe now the manuscript is sound and ready for publication. I specifically acknowledge the effort made by the authors to address some of the points raised with new experiments under the current difficult circumstances. Reviewer #3: (No Response) ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #2: No Reviewer #3: No 24 Sep 2020 PONE-D-20-13689R1 Generation of a conditional mutant knock-in under the control of the natural promoter using CRISPR-Cas9 and Cre-Lox systems. Dear Dr. Welford: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Arthur J. Lustig Academic Editor PLOS ONE
  24 in total

Review 1.  Manipulating the mammalian genome by homologous recombination.

Authors:  K M Vasquez; K Marburger; Z Intody; J H Wilson
Journal:  Proc Natl Acad Sci U S A       Date:  2001-07-17       Impact factor: 11.205

2.  Capture of DNA sequences at double-strand breaks in mammalian chromosomes.

Authors:  Y Lin; A S Waldman
Journal:  Genetics       Date:  2001-08       Impact factor: 4.562

3.  Site-specific DNA recombination in mammalian cells by the Cre recombinase of bacteriophage P1.

Authors:  B Sauer; N Henderson
Journal:  Proc Natl Acad Sci U S A       Date:  1988-07       Impact factor: 11.205

4.  A Simple Combined Use of CRISPR-Cas9 and Cre-LoxP Technologies for Generating Conditional Gene Knockouts in Mammalian Cells.

Authors:  Tzahi Noiman; Chaim Kahana
Journal:  CRISPR J       Date:  2018-08

Review 5.  Gene targeting in mice: functional analysis of the mammalian genome for the twenty-first century.

Authors:  Mario R Capecchi
Journal:  Nat Rev Genet       Date:  2005-06       Impact factor: 53.242

6.  Zinc-finger nuclease-driven targeted integration into mammalian genomes using donors with limited chromosomal homology.

Authors:  Salvatore J Orlando; Yolanda Santiago; Russell C DeKelver; Yevgeniy Freyvert; Elizabeth A Boydston; Erica A Moehle; Vivian M Choi; Sunita M Gopalan; Jacqueline F Lou; James Li; Jeffrey C Miller; Michael C Holmes; Philip D Gregory; Fyodor D Urnov; Gregory J Cost
Journal:  Nucleic Acids Res       Date:  2010-06-08       Impact factor: 16.971

7.  In vivo cleavage of transgene donors promotes nuclease-mediated targeted integration.

Authors:  Sandra Cristea; Yevgeniy Freyvert; Yolanda Santiago; Michael C Holmes; Fyodor D Urnov; Philip D Gregory; Gregory J Cost
Journal:  Biotechnol Bioeng       Date:  2012-10-23       Impact factor: 4.530

8.  Highly efficient CRISPR/Cas9-mediated knock-in in zebrafish by homology-independent DNA repair.

Authors:  Thomas O Auer; Karine Duroure; Anne De Cian; Jean-Paul Concordet; Filippo Del Bene
Journal:  Genome Res       Date:  2013-10-31       Impact factor: 9.043

9.  Knock-in of large reporter genes in human cells via CRISPR/Cas9-induced homology-dependent and independent DNA repair.

Authors:  Xiangjun He; Chunlai Tan; Feng Wang; Yaofeng Wang; Rui Zhou; Dexuan Cui; Wenxing You; Hui Zhao; Jianwei Ren; Bo Feng
Journal:  Nucleic Acids Res       Date:  2016-02-04       Impact factor: 16.971

10.  Spermidine/spermine N1-acetyltransferase 1 is a gene-specific transcriptional regulator that drives brain tumor aggressiveness.

Authors:  Vijay S Thakur; Brittany Aguila; Adina Brett-Morris; Chad J Creighton; Scott M Welford
Journal:  Oncogene       Date:  2019-08-09       Impact factor: 9.867

View more
  1 in total

Review 1.  Strategies for site-specific recombination with high efficiency and precise spatiotemporal resolution.

Authors:  Xueying Tian; Bin Zhou
Journal:  J Biol Chem       Date:  2021-03-04       Impact factor: 5.157

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.