Literature DB >> 33000233

Caveolin‑1 modulates hypertensive vascular remodeling via regulation of the Notch pathway.

Qian Wang1, Minxi Lao1, Zhen Xu2, Meilin Ding1, Shaolei Guo3, Ling Li4.   

Abstract

Hypertension is one of the critical risk factors of cerebrovascular disease. Caveolin‑1 (Cav‑1) has been suggested to be involved in the development of hypertension; however, the underlying mechanism remains largely unknown. Therefore, the present study aimed to investigate the mechanism underlying Cav‑1 in hypertension. In the present study, the hypertension model was induced by infusion of angiotensin II (Ang‑II) in rats. Cell Counting Kit‑8 assay was used to detect the viability of human umbilical vein endothelial cells (HUVECs). Flow cytometry was used to determine the apoptosis of HUVECs. Transmission electron microscopy was utilized to address the thickness of the vessel walls. Reverse transcription‑quantitative PCR, western blotting and immunofluorescence staining were used to assess the mechanism of cav‑1/Notch1 involved in hypertensive vascular remodeling. In the present study, an Ang‑II‑induced hypertension model was successfully established in rats. With this model, it was found that the expression levels of cav‑1 and Notch1 were significantly increased in brain tissues in the hypertension group compared with the sham‑operated group. In cultured HUVECs, knockdown of cav‑1 regulated Ang‑II‑induced HUVEC viability and apoptosis, and modulated hypertensive vascular remodeling, which was mediated by the Notch pathway. The data of the present study demonstrated that the cav‑1/Notch signaling plays an important role in the regulation of Ang‑II‑induced hypertension and vascular remodeling.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 33000233      PMCID: PMC7533525          DOI: 10.3892/mmr.2020.11508

Source DB:  PubMed          Journal:  Mol Med Rep        ISSN: 1791-2997            Impact factor:   2.952


Introduction

Hypertension, which promotes the occurrence of cerebral venous dysfunction-mediated brain tissue damage, such as venous sinus thrombosis, venous cerebral infarction, venous cerebral hemorrhage, periventricular venous disease, venous neurocytotoxicity, neurodegeneration and demyelination, is one of the primary risk factors of cerebrovascular disease (1–4). Vascular remodeling has been shown to be important for the progression of hypertension-mediated cerebrovascular disease (5). Under hypertensive conditions, blood vessels undergo a series of structural and functional changes to develop and maintain high blood pressure, which leads to hemiplegia, epilepsy and dementia, thus seriously affecting the health of the patient (6). Therefore, understanding the underlying mechanism of vascular remodeling will aid in the prevention of hypertension-mediated cerebral venous disease. Caveolin-1 (cav-1) is a primary structural protein and a regulatory component of caveolae. It participates in various physiological processes, such as vesicle transport, membrane phospholipid metabolism, cholesterol transport and cell signaling (7). Aberrant expression of cav-1 is closely associated with the occurrence of various diseases, including cardiovascular diseases, lung injury, tumorigenesis and infectious diseases (8–11). Cav-1 regulates its activity through complementary binding with other signal molecules and thus, modulates physiological processes, such as cell proliferation and differentiation, via different signaling pathways. Increasing evidence has indicated that cav-1 may be implicated in the development of hypertension. It has been reported that, in mice, cav-1 acted on inflammation and vascular remodeling, independent of the regulation of blood pressure or cardiac hypertrophy (12). Another study demonstrated that the upregulation of cav-1 and caveolae increased agonist-induced production of pulmonary arteries via the modulation of store-operated Ca(2+) entry and receptor-operated calcium entry, contributing to the progression of pulmonary hypertension in rats (13). However, the detailed mechanism of cav-1 in Ang-II-induced hypertension remains largely unknown. The Notch pathway has been shown to play a crucial role in vascular development (14). The activation of the Notch signaling pathway is mediated by the binding of cellular surface receptors (Notch1-4) to their ligands, which results in the cleavage of the intracellular domain of the receptors. Subsequently, the intracellular domain enters the nucleus where it promotes the transcription of downstream effectors (15). Previous studies reported that Notch1 signaling is implicated in the progression of pulmonary hypertension, but the function and mechanism of Notch1 in Angiotensin II (Ang-II)-induced hypertension remains unclear (16–18). The Ang-II-induced hypertension model is commonly used in studies on hypertension (12,19). In the present study, the Ang-II-induced hypertension model was successfully established in rats and it was found that the expression of cav-1 and Notch1 were significantly upregulated in the brain tissues of hypertensive rats. Moreover, the present data demonstrated that cav-1 modulated hypertensive vascular remodeling by regulating the Notch signaling pathway. These findings may provide novel therapeutic candidate targets for the treatment of hypertension.

Materials and methods

Cell culture

Human umbilical vein endothelial cells (HUVECs) were purchased from the American Type Culture Collection and were cultured in endothelial cell medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin (Gibco; Thermo Fisher Scientific, Inc.) at 37°C with 5% CO2. HUVECs were treated with 5 ng/ml Ang-II (Sigma-Aldrich; Merck KGaA). A total of 24 h later, cells were harvested and used for further experiments.

Cell treatment

Cells were treated with 20 µM DAPT (N-[N-(3,5-difluorophenacetyl)-1-alanyl]- S-phenylglycine t-butyl ester) (Sigma-Aldrich; Merck KGaA), a Notch pathway inhibitor, for 24 h at 37°C.

Cell Counting Kit-8 (CCK-8) assay

Cells (5×103) were seeded in 96-well plates. After treatment with Ang-II (5 ng/ml) for 24 h, cell viability was determined with a CCK-8 assay (Beyotime Institute of Biotechnology), according to the manufacturer's instructions.

Apoptosis detection

Apoptosis analysis was performed using a FITC-Annexin V apoptosis detection kit (BD Biosciences). Cells (1×106) were harvested and washed once with PBS. Then, cells were incubated with propidium iodide and FITC-Annexin V for 15 min at 4°C. After washing with PBS three times, cells were suspended in binding buffer and analyzed using a CytoFLEX flow cytometer (Beckman Coulter, Inc.) and FlowJo software (version 10; FlowJo LLC). Early + late apoptosis was assessed.

Establishment of hypertension model

A total of 12 female Sprague-Dawley (SD) rats (age, 6 weeks; weight, 153±12.4 g) were randomly divided into two groups: Hypertension model group (n=6) and sham operation group (sham group, n=6). One rat in the hypertension model group died, the cause of death was cerebral infarction, it was found with symptoms of hemiparalysis and the dissection was performed after death. The duration of the animal experiment was 1 month. Animal health and behavior were monitored once a day post-surgery. All the animals were kept in the specific-pathogen-free animal laboratory at 24±1°C with 50±10% humidity, 12-h light/dark cycles, and free access to food and water. The weight of the SD rats was measured before surgery. Rats were anesthetized with pentobarbital sodium (30 mg/kg). Under sterile conditions, an incision was made in the mid scapular region and an osmotic pump containing angiotensin II (infusion rate, 0.7 mg/kg per day) was implanted. Blood pressure was measured once before surgery, and 1 week and 3 weeks after surgery. Sham-operated rats underwent the same surgical procedure after anesthesia, except that no osmotic pump was implanted. Rats were euthanized by pentobarbital sodium (150 mg/kg), and the heart rates were detected to verify death. All experimental protocols were approved by the Committee of Animal Care and Use at Sun Yat-sen University (approval no. SYSU-IACUC-2019PGY260K; Guangdong, China).

Western blotting

Protein from cells or tissues were isolated and lysed in RIPA lysis buffer (Sigma-Aldrich; Merck KGaA), containing protease inhibitors (Sigma-Aldrich; Merck KGaA). Protein concentration was determined by the Braford method (BioRad Laboratories, Inc.). Proteins (50 µg) were separated via SDS-PAGE on a 10% gel, and subsequently transferred onto PVDF membranes. The membrane was blocked with 5% non-fat milk for 1 h at room temperature, and then incubated overnight at 4°C with anti-collagen (COL)-I (cat. no. ab260043), anti-matrix metalloprotease (MMP)2 (cat. no. ab92536), anti-MMP9 (cat. no. ab38898), anti-cav-1 (cat. no. ab18199), anti-Notch1 (cat. no. ab167441) and GAPDH (cat. no. ab9485) antibodies (all 1:1,000; all purchased from Abcam). Subsequently, the membrane was incubated with a HRP-conjugated goat anti-rabbit IgG H&L secondary antibody (1:5,000; cat. no. ab6721; Abcam) for 2 h at room temperature. The proteins were detected by ECL chemiluminescence (EMD Millipore) and analyzed using ImagePro Plus software (version 6.0; Media Cybernetics, Inc.).

Small interfering (si)RNA transfection

siRNAs (si-1, si-2, and si-3) targeting cav-1 and control siRNA were synthesized by Shanghai GenePharma Co., Ltd. siRNA transfection (50 nmol) was performed using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). Then, 48 h post-transfection, cells were collected and used for further experiments.

Reverse transcription-quantitative (RT-q)PCR

Total RNA from cells and tissues was isolated using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). RNA was reverse-transcribed into cDNA using a RevertAid First Strand cDNA Synthesis kit (Thermo Fisher Scientific, Inc.). The following temperature protocol was used for reverse transcription: 37°C for 2 min, 23°C for 10 min, 55°C for 10 min and 85°C for 10 min. RT-qPCR was conducted on a PRISM 7500 System (Applied Biosystems; Thermo Fisher Scientific, Inc.) with SYBR-Green (Tiangen Biotech Co., Ltd.). The following thermocycling conditions were used for qPCR: 95°C for 5 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min. The expression was calculated using the 2−ΔΔCq method (20). GAPDH was used as a control. Primers used are shown in Table I.
Table I.

Primer sequences used for reverse transcription- quantitative PCR.

GenesPrimer sequences (5′→3′)
Caveolin-1F: GCTGAGCGAGAAGCAAGTGT
R: GGTGAAGCTGGCCTTCCAAA
Notch1F: AATGTGGATGCCGCAGTTGT
R: TGATGTCCCGGTTGGCAAAG
MMP2F: CCCATGAAGCCCTGTTCACC
R: CGGTCGTAGTCCTCAGTGGT
MMP9F: GACGGCAATGCTGATGGGAA
R:GCAGAAGCCGAAGAGCTTGT
COL-1F: CCAGTGTGGCCCAGAAGAAC
R: GCAGGAAGGTCAGCTGGATG
β-actinF: CGTAAAGACCTCTATGCCAACA
R: CGGACTCATCGTACTCCTGCT

F, forward; R, reverse; COL, collagen; MMP, matrix metalloprotease.

Immunofluorescence staining

Tissues were fixed with 4% paraformaldehyde overnight at room temperature. Paraffin-embedded tissue slices (thickness, 4 µm) were dewaxed and rehydrated. Slices were blocked with 10% goat serum (Thermo Fisher Scientific, Inc.) for 30 min at room temperature, and then incubated with anti-cav-1 (1:1,000; cat. no. ab17052; Abcam) at 4°C overnight. After washing with PBS, slices were incubated with Alexa 555-conjugated secondary antibody (1:5,000, cat. no. A28180; Thermo Fisher Scientific, Inc.) for 2 h at room temperature. Diamidino-phenyl-indole (DAPI) was utilized to stain the nuclei. Images were obtained using a fluorescence microscope (Nikon Corporation) and analysed using ImagePro Plus software (version 6; Media Cybernetics, Inc.).

Transmission electron microscopy

To observe the alteration of the cerebral vein following the induction of hypertension, rat brain tissues were sliced into ~1 mm3 and the white-matter region with small veins were incubated in 2.5% glutaraldehyde for 12 h at 4°C. After washing with PBS, tissues were fixed with 1% osmic acid for 3 h at 4°C. Tissues were dehydrated and embedded in epoxy resin for 4 h at room temperature. Then, the tissue was cut into 70-nm sections. After staining with uranyl acetate at room temperature for 2 h and lead citrate at room temperature for 15 min, tissues were observed using a transmission electron microscope (Leica Microsystems, Inc.).

Statistical analysis

Statistical analysis was carried out using SPSS 19.0 software (IBM Corp.). Comparisons were analyzed by one-way ANOVA and followed by Tukey's post hoc test. P<0.05 was considered to indicate a statistically significant difference.

Results

Ang-II infusion induces hypertension in rats

In order to understand the molecular mechanism of cav-1 in the pathogenesis of hypertension, an Ang-II-induced hypertension model was established in rats. As shown in Fig. 1A, rats infused with Ang-II (the hypertension group) showed a significantly lower venous flow velocity compared with the sham-operated rats. In contrast, the blood pressure in the hypertension group was significantly higher compared with the sham-operated group (Fig. 1B). Moreover, the thickness of the vessel walls was significantly higher compared with the sham-operated animals (Fig. 1C). Together, these results suggested that the rat hypertension model induced by Ang-II was successfully established.
Figure 1.

Establishment of Ang-II-induced hypertension model in rats. (A) Determination of venous flow velocity. (B) Blood pressure. (C) Determination of vessel wall thickness by transmission electron microscopy in hypertensive rats (hypertension) and sham-operated rats (sham). Scale bar, 2 µm. Arrows indicate the vessel. **P<0.01, ***P<0.001. Ang, angiotensin.

Cav-1 and Notch1 are upregulated after Ang-II infusion

The expression levels of cav-1 and Notch1 were examined in rat brain tissues. The protein levels of cav-1 and Notch1 were significantly increased in the brain tissue of the hypertension group compared with the sham-operated group, as characterized by immunofluorescence staining and western blotting, respectively (Fig. 2A and B). Consistent with these results, RT-qPCR analysis showed that the mRNA levels of cav-1 and Notch1 in the brain tissues of hypertensive rats were significantly higher compared with the sham-operated animals (Fig. 2C). Also, the mRNA expression of Notch3 was examined in the two groups, but there was no significant difference between them (Fig. S1).
Figure 2.

Expression of cav-1 and Notch1 in the brain tissues of hypertensive rats. (A) Immunofluorescence staining of cav-1 in brain tissues of hypertensive rats (hypertension) and control rats (sham). Scale bar, 100 µm. Arrows indicate the expression of cav-1. (B) Western blotting analysis of Notch1 expression in brain tissues of hypertensive rats (hypertension) and sham-operated rats (sham). (C) Reverse transcription-quantitative PCR analysis of cav-1 and Notch1 mRNA expression in the brain tissues of hypertensive rats (hypertension) and sham-operated rats (sham). **P<0.01. Cav-1, caveolin-1.

Ang-II regulates HUVEC viability and extracellular matrix-related genes

To provide further support for the in vivo results, cultured HUVECs were utilized. A CCK-8 assay was carried out to determine the effect of Ang-II on HUVEC viability. The results showed that the viability of Ang-II-treated HUVECs was significantly decreased compared with the control cells (Fig. 3A). A flow cytometry assay revealed that Ang-II exposure significantly increased the apoptotic rate of HUVECs (Fig. 3B). In addition, RT-qPCR and western blotting demonstrated that Ang-II treatment significantly increased the mRNA and protein levels of collagen-1, MMP2 and MMP9, which are important regulators of the extracellular matrix (Fig. 3C and D). Therefore, these results indicated that Ang-II regulated HUVEC viability and altered extracellular matrix-associated protein expression.
Figure 3.

Ang-II induces hypertension model in HUVECs. (A) Cell Cycle Kit-8 assay was used to assess the viability of HUVECs after Ang-II treatment. (B) Flow cytometry was used to assess apoptosis of HUVECs after Ang-II exposure. (C) Reverse transcription-quantitative PCR was used to measure mRNA expression and (D) western blotting was used to determine protein expression levels of vascular remodeling-associated genes, COL-1, MMP2 and MMP9. *P<0.05, **P<0.01. HUVECs, human umbilical vein endothelial cells; Ang, angiotensin; COL, collagen; MMP, matrix metalloprotease.

Cav-1 modulates HUVEC viability and the extracellular matrix

Increased expression of cav-1 was also observed in HUVECs, following the administration of Ang-II (Fig. 4A). Thus, it was investigated whether cav-1 might contribute to Ang-II-mediated HUVEC cell viability and extracellular matrix alteration. To assess this, cav-1 expression was knocked down by siRNAs. As shown in Fig. 4B, the expression levels of cav-1 were significantly downregulated after transfection with cav-1 siRNAs (si-1, si-2, and si-3), as si-2 was shown to be the most effective it was selected for further experiments. It was found that the silencing of cav-1 restored the Ang-II-inhibited viability of HUVECs (Fig. 4C) Additionally, the enhancement of apoptosis in HUVECs induced by Ang-II was also reversed by cav-1 knockdown (Fig. 4D). Moreover, the depletion of cav-1 downregulated the mRNA and protein levels of collagen-1, MMP2 and MMP9, which were increased by Ang-II (Fig. 4E and F). Together, these results suggested that cav-1 reversed Ang-II-induced viability and extracellular matrix alteration in HUVECs.
Figure 4.

Effect of cav-1 knockdown on vascular remodeling. (A) Western blotting was used to determine expression of cav-1 in Ang-II-treated HUVECs. (B) Verification of the knockdown efficiency of cav-1 siRNAs via western blotting. (C) Depletion of cav-1 restored Ang-II-induced inhibition of HUVEC viability. (D) Depletion of cav-1 reversed the Ang-II-induced increase of HUVEC apoptosis. (E) Reverse transcription-quantitative PCR was performed to measure mRNA expression of vascular remodeling-associated genes in HUVECs treated with Ang-II alone or together with si-cav-1. (F) Western blotting was used to determine the expression of vascular remodeling-associated proteins in HUVECs treated with Ang-II alone or together with si-cav-1. *P<0.05, **P<0.01. HUVECs, human umbilical vein endothelial cells; Ang, angiotensin; siRNA, small interfering RNA; cav-1, caveolin-1; COL, collagen; MMP, matrix metalloprotease.

Cav-1 modulates HUVEC viability and the extracellular matrix via Notch signaling

The upregulation of Notch1 in Ang-II-infused mice allowed for the investigation of whether cav-1 may regulate vascular remodeling via Notch signaling. Indeed, consistent with the in vivo results, treatment with Ang-II increased the expression of Notch1, whereas knockdown of cav-1 decreased the protein expression of Notch1 (Fig. 5A). To confirm the involvement of Notch signaling activation in vascular remodeling, the Notch pathway inhibitor, DAPT (N-[N-(3,5-difluorophenacetyl)-1-alanyl]-S-phenylglycine t-butyl ester), was applied, which was demonstrated to decrease the expression of Notch1 (Fig. 5B). It was observed that while Ang-II treatment decreased the viability of HUVECs, DAPT treatment reversed this effect (Fig. 5C). Consistently, the increased apoptosis observed in Ang-II-treated HUVECs was decreased following DAPT administration (Fig. 5D). Moreover, treatment with DAPT reversed the Ang-II-mediated upregulation of Notch1, collagen-1, MMP2 and MMP9 (Fig. 5E and F). Overall, these results implied that cav-1/Notch functions in vascular remodeling.
Figure 5.

Cav-1 regulates vascular remodeling via Notch. (A) Western blotting was used to measure Notch1 expression in HUVECs treated with Ang-II alone or together with si-cav-1. (B) Western blotting was used to determine Notch1 expression in HUVECs treated with Ang-II alone or together with DAPT. (C) Cell Counting Kit-8 assay was used to measure viability of HUVECs treated with Ang-II alone or together with DAPT. (D) Apoptosis analysis of HUVECs treated with Ang-II alone or together with DAPT. (E) Reverse transcription-quantitative PCR was used to measure mRNA expression of vascular remodeling-associated genes in HUVECs treated with Ang-II or together with DAPT. (F) Western blotting was used to determine expression of vascular remodeling-associated proteins in HUVECs treated with Ang-II or together with DAPT. *P<0.05, **P<0.01. HUVECs, human umbilical vein endothelial cells; Ang, angiotensin; siRNA, small interfering RNA; DAPT, N-[N-(3,5-difluorophenacetyl)-1-alanyl]-S-phenylglycine t-butyl ester; cav-1, caveolin-1; COL, collagen; MMP, matrix metalloprotease.

Discussion

In the present study, a hypertension model induced by infusion of Ang-II was constructed. Using this model, it was found that cav-1 and Notch1 expression levels were significantly increased in the brain tissues of hypertensive rats compared with control animals. In cultured HUVECs, it was found that knockdown of cav-1 promoted Ang-II-induced HUVEC viability and altered hypertensive vascular remodeling. Furthermore, the data demonstrated that cav-1 exerted its function via regulation of the Notch pathway. Therefore, the present findings revealed a novel mechanism of cav-1/Notch in hypertension. Multiple studies have suggested that cav-1 is implicated in different models of hypertension. For example, it has been reported that the depletion of C-C motif chemokine 5 rescued pulmonary vascular dysfunction and reversed pulmonary hypertension via activation of bone morphogenetic protein receptor type 2 by cav-1 (21). Fluvastatin protected against monocrotaline-induced pulmonary arterial hypertension via the downregulation of cav-1 in rats (22). In addition, cav-1 participated in the regulation of vascular remodeling. The upregulation of cav-1 decreased cavin-1 expression and promoted the viability and migration of vascular smooth muscle cells (VSMCs) in balloon injury-induced neointimal hyperplasia (23). It was also found that cav-1 deficiency prevented Ang II-mediated hypertrophy and inward remodeling of pial arterioles, which indicated that cav-1 promoted Ang-II-mediated hypertrophy and vascular remodeling (24). Furthermore, another study reported that the overexpression of cav-1 in mice enhanced medial hypertrophy and perivascular fibrosis of the aorta, and its coronary and renal arteries, and that cav-1 promoted hypertensive vascular remodeling (12). The results of the present study were consistent with previous studies. It was observed that cav-1 was increased in the brain tissue of Ang-II-infused hypertensive rats. Moreover, cav-1 depletion reversed the effects of Ang-II on HUVEC viability and apoptosis. Additionally, the knockdown of cav-1 decreased the expression levels of collagen-1, MMP2 and MMP9, which are critical factors involved in promoting vascular remodeling. Therefore, the present data indicated a crucial role for cav-1 in vascular remodeling, which may further contribute to hypertension. Previous studies have reported that, in coronary microvascular remodeling, the administration of Ang-II antagonists in rats increased caveolin-1 protein expression, and nitric oxide synthase (NOS) 3 gene and protein expression, as well as NOS activity, thereby reducing collagen expression in the vessel walls and suppressing vascular remodeling (25). The difference in the results of Ang-II-mediated cav-1 protein expression and the effects on vascular remodeling among different studies may be the result of studying different tissues, and the involvement of additional signaling modules. Thus, further research is required. The Notch signaling pathway is a critical regulator in the occurrence and development of the vascular system (26). Notch belongs to the membrane protein receptor family. Notch1 and Notch4 are expressed in endothelial cells, whereas Notch1 and Notch3 are expressed in VSMCs (27,28). Notch activation regulates angiogenesis by inhibiting vascular endothelial growth factor receptors (VEGFR) and limiting the amount of vascular sprouting (28). It has been reported that treatment with DAPT attenuated intimal hyperplasia by inhibiting Notch1 signaling (29). Notch receptors 1 and 3 have been demonstrated to play important roles in the proliferation and migration of VSMCs, and the secretion of MMP2 and MMP9 (30,31), which have roles in the modulation of the degradation of the extracellular matrix and the destruction of vascular wall matrix. Previous studies also suggested that the Notch pathway is involved in the development of hypertension. It has been reported that TNF-α triggered pulmonary arterial hypertension by repressing the bone morphogenetic type-II receptor and modulating the Notch pathway (32). Notch was revealed to regulate the Ca2+-sensing receptor, and thus promoted hypoxia-induced pulmonary hypertension (33). In the present study, it was found that Notch1 expression was elevated in the brain tissues of Ang-II-induced hypertensive rats compared with sham-operated rats. The silencing of cav-1 decreased the expression of Notch1 induced by Ang-II. Moreover, treatment with DAPT reversed the effects of Ang-II on cell viability and apoptosis. Furthermore, DAPT decreased the Ang-II-induced upregulation of collagen-1, MMP2 and MMP9 expression. These results indicated that cav-1/Notch signaling contributed to Ang-II-induced vascular remodeling. Of note, a limitation of the present study was that the alteration of cav-1 in hypertensive rats was determined using brain tissue instead of cerebrovascular tissue. This was because after the rats were sacrificed, the cerebral veins started shrinking and thus it was difficult to separate them from the brain tissue. In summary, the present data demonstrated an important role for cav-1/Notch1 signaling in the regulation of Ang-II-induced hypertension and vascular remodeling. Targeting the cav-1 or Notch signaling pathways may present promising strategies for the treatment of hypertension. The process of vascular remodeling includes degradation of the extracellular matrix, cell proliferation, apoptosis, vascular inflammation and fibrosis. Whether additional signaling molecules, such as EPH receptor 4, VEGF and epidermal growth factor receptors, are involved in the process, and how important the signaling pathway is in vivo in animals, will be investigated further in future research.
  33 in total

1.  Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.

Authors:  K J Livak; T D Schmittgen
Journal:  Methods       Date:  2001-12       Impact factor: 3.608

2.  Notch activation of Ca2+-sensing receptor mediates hypoxia-induced pulmonary hypertension.

Authors:  Qiang Guo; Hua Xu; Xinjing Yang; Daguo Zhao; Shenlang Liu; Xue Sun; Jian-An Huang
Journal:  Hypertens Res       Date:  2016-09-01       Impact factor: 3.872

3.  Caveolin-1 Deletion Prevents Hypertensive Vascular Remodeling Induced by Angiotensin II.

Authors:  Steven J Forrester; Katherine J Elliott; Tatsuo Kawai; Takashi Obama; Michael J Boyer; Kyle J Preston; Zhen Yan; Satoru Eguchi; Victor Rizzo
Journal:  Hypertension       Date:  2016-11-28       Impact factor: 10.190

4.  Notch1 signalling regulates endothelial proliferation and apoptosis in pulmonary arterial hypertension.

Authors:  Swati Dabral; Xia Tian; Baktybek Kojonazarov; Rajkumar Savai; Hossein Ardeschir Ghofrani; Norbert Weissmann; Monica Florio; Jan Sun; Danny Jonigk; Lavinia Maegel; Friedrich Grimminger; Werner Seeger; Soni Savai Pullamsetti; Ralph Theo Schermuly
Journal:  Eur Respir J       Date:  2016-07-28       Impact factor: 16.671

5.  Identification of the HIV-1 gp41 core-binding motif in the scaffolding domain of caveolin-1.

Authors:  Jing-He Huang; Lu Lu; Hong Lu; Xi Chen; Shibo Jiang; Ying-Hua Chen
Journal:  J Biol Chem       Date:  2006-12-31       Impact factor: 5.157

6.  Protection against monocrotaline-induced pulmonary arterial hypertension and caveolin-1 downregulation by fluvastatin in rats.

Authors:  Shaoping Zhu; Junyu Wang; Xianguo Wang; Jinping Zhao
Journal:  Mol Med Rep       Date:  2017-12-22       Impact factor: 2.952

7.  TCV-116 stimulates eNOS and caveolin-1 expression and improves coronary microvascular remodeling in normotensive and angiotensin II-induced hypertensive rats.

Authors:  N Kobayashi; Y Mori; S Nakano; Y Tsubokou; T Kobayashi; H Shirataki; H Matsuoka
Journal:  Atherosclerosis       Date:  2001-10       Impact factor: 5.162

8.  Effects of methyl-beta-cyclodextrin on blood-brain barrier permeability in angiotensin II-induced hypertensive rats.

Authors:  Müge Atış; Uğur Akcan; Canan Uğur Yılmaz; Nurcan Orhan; Poyraz Düzgün; Umut Deniz Ceylan; Nadir Arıcan; Serçin Karahüseyinoğlu; Gizem Nur Şahin; Bülent Ahıshalı; Mehmet Kaya
Journal:  Brain Res       Date:  2019-03-23       Impact factor: 3.252

Review 9.  Notch signaling in blood vessels: who is talking to whom about what?

Authors:  Jennifer J Hofmann; M Luisa Iruela-Arispe
Journal:  Circ Res       Date:  2007-06-08       Impact factor: 17.367

Review 10.  The global epidemiology of hypertension.

Authors:  Katherine T Mills; Andrei Stefanescu; Jiang He
Journal:  Nat Rev Nephrol       Date:  2020-02-05       Impact factor: 28.314

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.