| Literature DB >> 32992674 |
Wei-Shan Chang1, Ci-Xiu Li1, Jane Hall2, John-Sebastian Eden1,3, Timothy H Hyndman4, Edward C Holmes1, Karrie Rose2.
Abstract
Viral pathogens are being increasingly described in association with mass morbidity and mortality events in reptiles. However, our knowledge of reptile viruses remains limited. Herein, we describe the meta-transcriptomic investigation of a mass morbidity and mortality event in a colony of central bearded dragons (Pogona vitticeps) in 2014. Severe, extensive proliferation of the respiratory epithelium was consistently found in affected dragons. Similar proliferative lung lesions were identified in bearded dragons from the same colony in 2020 in association with increased intermittent mortality. Total RNA sequencing identified two divergent DNA viruses: a reptile-infecting circovirus, denoted bearded dragon circovirus (BDCV), and the first exogeneous reptilian chaphamaparvovirus-bearded dragon chaphamaparvovirus (BDchPV). Phylogenetic analysis revealed that BDCV was most closely related to bat-associated circoviruses, exhibiting 70% amino acid sequence identity in the Replicase (Rep) protein. In contrast, in the nonstructural (NS) protein, the newly discovered BDchPV showed approximately 31%-35% identity to parvoviruses obtained from tilapia fish and crocodiles in China. Subsequent specific PCR assays revealed BDCV and BDchPV in both diseased and apparently normal captive reptiles, although only BDCV was found in those animals with proliferative pulmonary lesions and respiratory disease. This study expands our understanding of viral diversity in captive reptiles.Entities:
Keywords: PCR assays; RNA-sequencing; chapparvovirus; circovirus; respiratory disease
Mesh:
Substances:
Year: 2020 PMID: 32992674 PMCID: PMC7600432 DOI: 10.3390/v12101073
Source DB: PubMed Journal: Viruses ISSN: 1999-4915 Impact factor: 5.048
PCR primers used in this study.
| Primer Name | Target | Sequence 5′-3′ | Site Start | Site End | Tm (°C) | GC |
|---|---|---|---|---|---|---|
| BDCV_F1 | BDCV_cap | GTATTGTTTCAGAGATTCGCCG | 65 | 86 | 57.8 | 45.5 |
| BDCV_R1 | ATTGTAATGAAGGCGTTGTTCC | 1144 | 1165 | 57.6 | 40.9 | |
| BDCV_F2 | BDCV_cap | GCCGAAGTGTCTGGTAATACTA | 974 | 995 | 57.3 | 43.5 |
| BDCV_R2 | GATTGGTTAAGAGTCGGGATTTC | 440 | 462 | 57.6 | 40.9 | |
| BDCV_F3 | BDCV_rep | AATACCTGACCAGTCTGCCA | 1551 | 1570 | 57.3 | 50.0 |
| BDCV_R3 | CGATGGCGTAGGAACAGATG | 659 | 640 | 59.3 | 55.0 | |
| BDCV_F4 | BDCV_rep | GGTGAAGTCGATTGTTCCTTTG | 312 | 333 | 58.4 | 45.5 |
| BDCV_R4 | GTGGGTATTGTTTCAGAGATTCG | 1633 | 1611 | 58.9 | 43.5 | |
| BDchPV_F1 | BDchPV_NS | CTGAACAATATCTCTTCGTTGGAG | 217 | 240 | 57.4 | 41.7 |
| BDchPV_R1 | TCCCAGACACCCATATAACAATC | 1490 | 1512 | 57.7 | 43.5 | |
| BDchPV_F2 | BDchPV_NS | GCTCTCCTGAATATTGTGATATGTC | 954 | 978 | 57.4 | 40.0 |
| BDchPV_R2 | TTCCCTACCCACTTCTTTCTG | 2255 | 2275 | 56.9 | 47.6 | |
| BDchPV_F3 | BDchPV_VP | CTAGCTCAGACATCAGATCCAG | 2004 | 2025 | 57.5 | 50.0 |
| BDchPV_R3 | GTCGGTGGAGGATTGTCTATAG | 3346 | 3367 | 57.5 | 50.0 | |
| BDchPV_F4 | BDchPV_VP | AGCTTTTCCCAAATGACACTG | 2848 | 2868 | 57.0 | 42.9 |
| BDchPV_R4 | CAGAAGACACAACAGTAGGTAAAG | 4087 | 4110 | 57.2 | 41.7 |
BDCV: Bearded Dragon CircoVirus, BDchPV: Bearded Dragon ChaphamaParvoVirus, rep: replicase, cap: capsid, NS: Non-Structural protein, VP: Viral capsid Protein.
Figure 1Photomicrographs of pulmonary lesions in central bearded dragons from the 2014 and 2020 outbreak. Thickening of the normally squamous infundibular epithelium. (Haematoxylin and eosin (HE) stain 40×) (A) and the segmental nature of this change observed in an affected animal from the 2020 outbreak (HE 20×) (B) Metaplasia of the normally squamous infundibular epithelium to pseudostratified columnar and multifocally ciliate. Normal lung appears on the right and infundibular epithelium becomes proliferative on the left (HE 1000×) (C) and multifocal epithelial cells with large, irregularly shaped, basophilic nuclei (arrowheads, HE 1000×) (D) Bizarre atrial epithelial cells containing eosinophilic cytoplasmic inclusions (arrowheads, (HE 1000×) (E).
Rep protein (amino acid) motifs detected in the bearded dragon circovirus.
| Name of Region | Sequence in the | Sequence in Bearded Dragon Circovirus | |
|---|---|---|---|
| RCR motif | RCR motif I | FT(L/I)NN | FTINN |
| RCR motif II | PHLQG | PHIQG | |
| RCR motif III | YC(S/x)K | YCSK | |
| SF3 helicase motif | Walker A | G(P/x)(P/x) GxGK(S/t) | GEPGSGKS |
| Walker B | uuDDF | ILDDF | |
| Walker C | uTSN | ITSN |
Figure 2Genome characterization and phylogeny of bearded dragon circovirus. (A) Genome organization of bearded dragon circovirus. The outermost circles of the metadata ring represent the GC content (%, green), nucleotide polymorphism (%, orange), and read mapping coverage (yellow) of the genome. In the innermost circles, the proteins encoded by the replicase (Rep) and capsid protein (Cap) are labelled in pink and cyan, respectively. (B) Phylogenetic analysis of the Rep gene (nonstructural replicase protein) of circoviruses, including members of the Cyclovirus and Circovirus genera. Bootstrap values > 70% are presented for key nodes (1000 replicates). The tree was midpoint rooted for clarity only. Scale bar shows the number of substitutions per site. (C) Comparison of nonamer sequences with closely related viruses in the Circoviridae.
Figure 3Genome of bearded dragon chaphamaparvovirus in comparison to related viruses. The amino acid sequence size of the ORFs of each virus is shown. Yellow and orange boxes refer to the NS and VP genes, respectively. The classic motif features HXH (blue asterisk) and GPXNTGKX (green asterisk) on NS genes are labelled.
Figure 4Genome characterization and phylogenetic relationships of bearded dragon chaphamaparvovirus. (A) Genome depiction and reads mapping coverage of bearded dragon chaphamaparvovirus. (B) Phylogenetic analysis of the nonstructural protein gene (NS gene) of parvoviruses, including other chaphamaparvoviruses and members of the Parvovirinae, Densovirinae, and Hamaparvovirine. Bootstrap values >70% were presented for key nodes (1000 replicates). The tree was midpoint rooted for clarity only. Scale bar shows the number of substitutions per site.
PCR testing of captive reptiles from the 2014 and 2020 outbreaks.
| Year | Case no. | Species | Clinical Sign | Organ | PCR Results | |
|---|---|---|---|---|---|---|
| BDCV | BDchPV | |||||
| 2014 | 10043.1 | CBD | Respiratory | Kidney | - | - |
| Lung | - | - | ||||
| 10043.2 | CBD | Respiratory | Liver | - | - | |
| 10043.3 | CBD | Respiratory | Kidney | + | - | |
| Lung | + | + | ||||
| 10043.4 | CBD | Respiratory | Liver | - | + | |
| 10043.5 | CBD | Respiratory | Liver | + | - | |
| 2020 | 13270.1 | CBD | Mild neurological | Brain | - | - |
| Liver | - | + | ||||
| 13270.2 | CBD | Normal | Brain | - | - | |
| Liver | - | - | ||||
| 13270.3 | CBD | Mild nonspecific illness | Brain | - | - | |
| Liver | + | + | ||||
| 13270.4 | CBD | Neurological | Brain | - | + | |
| Liver | + | + | ||||
| 13270.5 | CBD | Normal | Brain | - | - | |
| Liver | - | - | ||||
| 13270.6 | CBD | Neurological | Brain | n.a. | n.a. | |
| Liver | - | - | ||||
| 13270.7 | CBD | Neurological | Brain | n.a. | n.a. | |
| Liver | - | - | ||||
| 13270.8 | CBD | Neurological | Brain | n.a. | n.a. | |
| Liver | - | - | ||||
| 13270.9 | JL | Normal | Brain | - | - | |
| Liver | + | - | ||||
| 13270.10 | JL | Neurological | Brain | - | - | |
| Liver | - | - | ||||
| 13270.11 | JL | Neurological | Brain | - | - | |
| Liver | - | - | ||||
| 13270.12 | GED | Moribund | Brain | - | - | |
| Liver | - | - | ||||
| Total: BDCV positive cases: 5/17; BDchPV positive cases: 5/17 | ||||||
CBD: central bearded dragon (Pogona vitticeps); JL: jacky lizard (Amphibolurus muricatus); GED: grassland earless dragon (Tympanocryptis pinguicolla); n.a.: nonapplicable; green: negative; red: positive.