| Literature DB >> 32988528 |
H K Zanu1, S K Kheravii1, N K Morgan1, M R Bedford2, R A Swick3.
Abstract
Calcium has the caical">pacity to interact with phytate-P to form Ca-phytate complexes and decrease the ability of exogenous phytase to degrade phytic acid. This study investigated the hypothesis that high dietary Ca would impair gut permeability, phytate esters (inositol x-phosphate, IPx: IP3, IP4, IP5, and IP6) degradation, jejunal gene expression, and intestinal morphology. Ross 308 day-old male broilers (n = 768) were distributed into 48-floor pens each housing 16 birds in a factorial arrangement. Factors were NE challenge-no or yes; phytase level of 500 or 1,500 FTU/kg, and Ca level 0.6 or 1.0% starter, 0.5 or 0.9% grower, 0.4 or 0.8% finisher with available P in each phase. Challenged birds were gavaged with 3 field strains of Eimeria on day 9 and 108 CFU per mL of Clostridium perfringens Strain EHE-NE18 on day 14 and day 15. A phytase × Ca interaction was observed in the ileum for IP3 (P < 0.01), IP4 (P < 0.05), and IP6 (P < 0.01). The IP3 and IP4 concentrations were similar for both doses of phytase in the presence of low Ca, but with high Ca, both increased significantly but to a greater extent when the high dose of phytase was used. While IP6 concentrations were low and similar between both doses of phytase at low Ca levels, increasing dietary Ca levels increased IP6 concentrations regardless of phytase dose, but the effect was greater in the low phytase diet. A phytase × Ca interaction was detected for vitamin D receptor (VDR) (P < 0.05) expression where bird fed low phytase and low Ca recorded the highest expression of VDR, all other treatments being equivalent. The challenge decreased crypt depth to villus height ratio (P < 0.001). Challenge birds had higher fluorescein isothiocyanate dextran (P < 0.05) in blood compared with unchallenged birds. Thus, high Ca and high phytase, while not the best for IP6 destruction, did not lead to huge reductions in indicators of gut health.Entities:
Keywords: dietary calcium; gut health; necrotic enteritis; phytate esters and phytase
Mesh:
Substances:
Year: 2020 PMID: 32988528 PMCID: PMC7598120 DOI: 10.1016/j.psj.2020.06.030
Source DB: PubMed Journal: Poult Sci ISSN: 0032-5791 Impact factor: 3.352
Ingredient and nutrient composition of basal diets (g/kg), as-fed.
| Ingredients | Starter (0-14 D) | Grower (14-28 D) | Finisher (28-42 D) | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 0.6% Ca + low phytase | 0.6% Ca + high phytase | 1.0% Ca + low phytase | 1.0% Ca + high phytase | 0.6% Ca + low phytase | 0.6% Ca + high phytase | 1.0% Ca + low phytase | 1.0% Ca + high phytase | 0.6% Ca + low phytase | 0.6% Ca + high phytase | 1.0% Ca + low phytase | 1.0% Ca + high phytase | |
| Wheat | 620 | 620 | 597 | 597 | 708 | 708 | 687 | 687 | 723 | 723 | 702 | 702 |
| SBM | 296 | 296 | 302 | 302 | 185 | 185 | 189 | 189 | 166 | 166 | 170 | 170 |
| Canola expeller cold press | 50 | 50 | 50 | 50 | 70 | 70 | 70 | 70 | 70 | 70 | 70 | 70 |
| Canola oil | 12 | 12 | 18 | 18 | 14 | 14 | 21 | 21 | 23 | 23 | 30 | 30 |
| Limestone | 6 | 6 | 16 | 16 | 5 | 5 | 15 | 15 | 3 | 3 | 14 | 14 |
| MDC phosphate | 4.19 | 4.19 | 4.26 | 4.26 | 2.42 | 2.42 | 2.5 | 2.5 | 0.64 | 0.64 | 0.71 | 0.71 |
| Xylanase | 0.1 | 0.1 | 0.1 | 0.1 | 0.1 | 0.1 | 0.1 | 0.1 | 0.1 | 0.1 | 0.1 | 0.1 |
| Phytase | 0.1 | 0.3 | 0.1 | 0.3 | 0.1 | 0.3 | 0.1 | 0.3 | 0.1 | 0.3 | 0.1 | 0.3 |
| Salt | 1.41 | 1.41 | 1.43 | 1.43 | 0.83 | 0.83 | 0.85 | 0.85 | 0.82 | 0.82 | 0.84 | 0.84 |
| Na bicarbonate | 2 | 2 | 2 | 2 | 2 | 2 | 2 | 2 | 2 | 2 | 2 | 2 |
| TiO2 | - | - | - | - | 5 | 5 | 5 | 5 | 5 | 5 | 5 | 5 |
| Vitamins | 1 | 11 | 1 | 1 | 0.7 | 0.7 | 0.7 | 0.7 | 0.5 | 0.5 | 0.5 | 0.5 |
| Trace minerals | 1.2 | 1.2 | 1.2 | 1.2 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 |
| Choline Cl 60 | 0.64 | 0.64 | 0.67 | 0.67 | 0.74 | 0.74 | 0.77 | 0.77 | 0.58 | 0.58 | 0.6 | 0.6 |
| L-lysine HCl | 2.34 | 2.34 | 2.24 | 2.24 | 2.81 | 2.81 | 2.75 | 2.75 | 2.61 | 2.61 | 2.55 | 2.55 |
| DL-methionine | 1.99 | 1.99 | 2 | 2 | 1.58 | 1.58 | 1.6 | 1.6 | 4.89 | 4.89 | 4.9 | 4.9 |
| L-threonine | 0.54 | 0.54 | 0.53 | 0.53 | 0.57 | 0.57 | 0.58 | 0.58 | 0.51 | 0.51 | 0.51 | 0.51 |
| Nutrients | ||||||||||||
| MEn, kcal/kg | 3,000 | 3,000 | 3,000 | 3,000 | 3,100 | 3,100 | 3,100 | 3,100 | 3,100 | 3,100 | 3,100 | 3,100 |
| Crude protein, % | 24.4 | 24.4 | 24.3 | 24.3 | 20.9 | 20.9 | 20.8 | 20.8 | 20.3 | 20.3 | 20.3 | 20.3 |
| SID, % | ||||||||||||
| Arginine | 1.40 | 1.40 | 1.41 | 1.41 | 1.14 | 1.14 | 1.14 | 1.14 | 1.09 | 1.09 | 1.09 | 1.09 |
| Lysine | 1.24 | 1.24 | 1.24 | 1.24 | 1.05 | 1.05 | 1.05 | 1.05 | 0.99 | 0.99 | 0.99 | 0.99 |
| Methionine | 0.5 | 0.5 | 0.5 | 0.5 | 0.43 | 0.43 | 0.43 | 0.43 | 0.75 | 0.75 | 0.75 | 0.75 |
| d M + C | 0.89 | 0.89 | 0.88 | 0.88 | 0.80 | 0.80 | 0.80 | 0.80 | 1.11 | 1.11 | 1.11 | 1.11 |
| Tryptophan | 0.27 | 0.27 | 0.27 | 0.27 | 0.23 | 0.23 | 0.23 | 0.23 | 0.22 | 0.22 | 0.22 | 0.22 |
| Isoleucine | 0.88 | 0.88 | 0.88 | 0.88 | 0.73 | 0.73 | 0.73 | 0.73 | 0.70 | 0.70 | 0.70 | 0.70 |
| Threonine | 0.79 | 0.79 | 0.79 | 0.79 | 0.68 | 0.68 | 0.68 | 0.68 | 0.65 | 0.65 | 0.65 | 0.65 |
| Valine | 0.98 | 0.98 | 0.98 | 0.98 | 0.84 | 0.84 | 0.84 | 0.84 | 0.81 | 0.81 | 0.81 | 0.81 |
| Calcium, % | 0.60 | 0.60 | 1.00 | 1.00 | 0.51 | 0.51 | 0.91 | 0.91 | 0.43 | 0.43 | 0.83 | 0.83 |
| Available P, % | 0.40 | 0.40 | 0.40 | 0.40 | 0.36 | 0.36 | 0.36 | 0.36 | 0.32 | 0.32 | 0.32 | 0.32 |
| Sodium, % | 0.18 | 0.18 | 0.18 | 0.18 | 0.16 | 0.16 | 0.16 | 0.16 | 0.16 | 0.16 | 0.16 | 0.16 |
| Choline, pmm | 1,700 | 1,700 | 1,700 | 1,700 | 859 | 859 | 885 | 885 | 731 | 731 | 757 | 757 |
| Analyzed, DM basis | ||||||||||||
| Calcium, % | 0.51 | 0.52 | 0.77 | 0.84 | 0.40 | 0.40 | 0.82 | 0.92 | 0.38 | 0.33 | 0.76 | 0.79 |
| Total P, % | 0.59 | 0.60 | 0.59 | 0.61 | 0.54 | 0.54 | 0.58 | 0.59 | 0.51 | 0.52 | 0.52 | 0.51 |
Abbreviation: SBM, soybean meal; SID, standardised ileal digestibility.
MDC phosphate or monodicalcium phosphate contains 21% P and 16% Ca, Kynophos 21, sourced from BEC, Brisbane, QLD.
Xylanse was Econase XP 25, providing 160,000 birch xylanase units per gram inclusion, AB Vista Feed Ingredients, UK, no matrix values applied.
Phytase was Quantum Blue 5G, AB Vista Feed Ingredients, UK to provide 500 FTU/kg (0.1% phytase) or 1,500 FTU/kg (0.3% phytase). Matrix values used Ca, P, Na, ME, CP, arginine, lysine, methionine, methionine + cystine, tryptophan, isoleucine, threonine, and valine of 1,650, 1,500, 350%, 520,000 kcal/kg, 4,210, 130, 170, 39, 390, 190, 255, 330, and 230%, respectively (amino acids expressed as SID).
Vitamin premix per kg diet: vitamin A, 12 MIU; vitamin D, 5 MIU; vitamin E, 75 mg; vitamin K, 3 mg; nicotinic acid, 55 mg; pantothenic acid, 13 mg; folic acid, 2 mg; riboflavin, 8 mg; cyanocobalamin, 0.016 mg; biotin, 0.25 mg; pyridoxine, 5 mg; thiamine, 3 mg; antioxidant, 50 mg.
Trace mineral concentrate supplied per kilogram of diet: Cu (sulfate), 16 mg; Fe (sulfate), 40 mg; I (iodide), 1.25 mg; Se (selenate), 0.3 mg; Mn (sulfate and oxide), 120 mg; Zn (sulfate and oxide), 100 mg; cereal-based carrier, 128 mg; mineral oil, 3.75 mg.
Recovered phytate esters and inositol concentration (μmol/g DM) in the in experimental diets.
| Treatment | Starter | Grower | Finisher | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| IP3 | IP4 | IP5 | IP6 | Inositol | IP3 | IP4 | IP5 | IP6 | Inositol | IP3 | IP4 | IP5 | IP6 | Inositol | ||||
| NE | Phy | Ca | ||||||||||||||||
| 1. | - | 500 | Low | 0.154 | 0.588 | 2.466 | 16.757 | 0.572 | 0.104 | 0.714 | 3.610 | 14.857 | 0.092 | 0.252 | 1.343 | 6.582 | 12.044 | 0.052 |
| 2. | - | 1,500 | Low | 0.064 | 0.597 | 2.743 | 17.181 | 0.000 | 0.181 | 0.672 | 3.873 | 15.030 | 0.009 | 0.280 | 1.461 | 6.690 | 11.591 | 0.051 |
| 3. | - | 500 | High | 0.133 | 0.651 | 2.801 | 17.032 | 0.341 | 0.132 | 0.845 | 4.209 | 16.516 | 0.245 | 0.170 | 1.417 | 7.018 | 11.576 | 0.094 |
| 4. | - | 1,500 | High | 0.131 | 0.762 | 2.984 | 16.500 | 0.299 | 0.147 | 0.805 | 4.078 | 14.654 | 0.195 | 0.244 | 1.532 | 6.977 | 11.612 | 0.049 |
| 5. | + | 500 | Low | 0.156 | 0.770 | 3.138 | 16.685 | 0.350 | 0.143 | 0.794 | 4.274 | 15.163 | 0.070 | 0.192 | 1.671 | 7.578 | 11.309 | 0.052 |
| 6. | + | 1,500 | Low | 0.281 | 0.736 | 3.033 | 15.455 | 0.283 | 0.060 | 1.026 | 5.543 | 13.607 | 0.196 | 0.196 | 1.630 | 7.249 | 10.922 | 0.051 |
| 7. | + | 500 | High | 0.205 | 0.846 | 3.319 | 15.460 | 0.333 | 0.104 | 1.148 | 5.540 | 12.907 | 0.112 | 0.176 | 1.737 | 7.585 | 11.141 | 0.094 |
| 8. | + | 1,500 | High | 0.155 | 0.832 | 3.356 | 15.884 | 0.106 | 0.116 | 1.173 | 5.829 | 12.612 | 0.222 | 0.167 | 1.855 | 7.874 | 10.495 | 0.049 |
Phytase (Quantum Blue 5G).
Abbreviations: Ca, calcium; IP3, inositol triphosphate; IP4, inositol tetraphosphate; IP5, inositol pentaphosphate; IP6, inositol hexaphosphate; NE, necrotic enteritis; phy, phytase.
Sequences of primers used for quantitative real-time PCR.
| Gene symbol | Group | Gene name | Primer sequence (5ʹ-3ʹ) | Ta°C | Amplicon size (bp) | Reference | Function |
|---|---|---|---|---|---|---|---|
| CLDN1 | Tight junction protein | Claudin 1 | F-CTTCATCATTGCAGGTCTGTCAG | 60 | 103 | This study | Maintenance of intestinal barrier function |
| CLDN5 | Tight junction protein | Claudin 5 | F-GCAGGTCGCCAGAGATACAG | 61 | 162 | This study | Maintenance of intestinal barrier function |
| JAM2 | Tight junction protein | Junctional adhesion molecule 2 | F-AGACAGGAACAGGCAGTGCTAG | 60 | 135 | This study | Maintenance of intestinal barrier function |
| OCLD | Tight junction protein | Occludin | F- ACGGCAGCACCTACCTCAA | 60 | 123 | ( | Maintenance of intestinal barrier function |
| NaPi-IIb | Phosphorus transporter | Na-dependent Pi cotransporters, type IIb | F- CGGTCCGTTCACTCTGTTGC | 60 | 165 | This study | Mediation of intestinal phosphate uptake |
| VDR | Vitamin D transporter | Vitamin D receptor | F- ACGCAGACATGGACACCGT | 60 | 193 | This study | Provides instructions for making vitamin D receptor |
| CALB1 | Calcium transporter | Calbindin 1 | F- GGCAGGCTTGGACTTAACACC | 60 | 105 | This study | Transport protein of calcium |
| ATP1A1 | Calcium transporter | ATPase Na+/K+ transporting subunit alpha 1 | F- GTCAACCCGAGGGATGCTAA | 60 | 179 | ( | Provides instructions for making Na+/K+ ATPase |
| ATP5A1W | Calcium transporter | ATP synthase subunit alpha | F- GGCAATGAAACAGGTGGCAG | 60 | 232 | This study | Synthesis of ATP |
| ATP13A4 | Calcium transporter | ATPase type 13A4 | F-CCAAAGCTCCTGCTAAATGC | 61 | 178 | ( | |
| ATP2A1 | Calcium transporter | ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 | F-CGCTGTCAATCAGGACAAGA | 61 | 250 | ( | Catalyzes the hydrolysis of ATP and translocation of calcium from the cytosol to the sarcoplasmic reticulum lumen. |
| ATP2B1 | Calcium transporter | ATPase, Ca++ transporting, plasma membrane 1 | F-CTGGGCATGGGAACACTACT | 60 | 169 | ( | Catalyzes the hydrolysis of ATP and maintenance of intracellular calcium homeostasis |
| CASR | Calcium transporter | Calcium sensing receptor | F-CTGCGTGATTTGGCTCTACA | 60 | 160 | ( | Regulator of parathyroid hormone synthesis and secretion and systemic calcium homeostasis. |
| SLC8B1 | Calcium transporter | (Sodium/lithium/calcium exchanger), member B1 | F-CTTCGAGCTGAGCAACACTG | 60 | 169 | ( | Mediates mitochondrial calcium extrusion and mitochondrial calcium homeostasis |
| CACNA1A | Calcium channel | Calcium channel, voltage-dependent, P/Q type alpha 1A subunit | F-GCAGCGGGTCTATAAGCAGT | 60 | 198 | ( | Provides instructions for making calcium channels |
| TPCN2 | Calcium channel | Two pore segment channel 2 | F-AGGTGCTGTGGTTCCTATGG | 60 | 210 | ( | Very little is known about the physiological functions but believe to form functional Ca2+-permeable channel |
| TPCN3 | Calcium channel | Two-pore calcium channel 3 | F-TGGGAATGGGAGTTCAAGAG | 60 | 183 | ( | Very little is known about the physiological functions but believe to form functional Ca2+-permeable channel |
| MUC-2 | Inflammatory genes | Mucin 2 | F- CCCTGGAAGTAGAGGTGACTG | 60 | 143 | ( | The physical and biological barrier protecting mucous epithelia |
| RPL4 | Housekeeping genes | Ribosomal protein L4 | F: TTATGCCATCTGTTCTGCC | 60 | 235 | ( | Component of the 60S subunit and encodes a |
| β-actin | Housekeeping genes | β-actin | F-CTCTGACTGACCGCGTTACTCC | 60 | 175 | This study | Cytoskeletal structural protein, nucleotide, and ATP binding |
Primer sequencing for the gene was done in the present study and not that reported in a published paper.
Effect of necrotic enteritis, phytase, and calcium on phytate esters and inositol concentration (μmol/g DM) in the gizzard digesta of broilers 29 D posthatch.
| Effects | Inositol | IP3 | IP4 | IP5 | IP6 | |||
|---|---|---|---|---|---|---|---|---|
| NE | Phy | Ca | ||||||
| Main effects | ||||||||
| NE | - | 2.404 | 0.610 | 1.221 | 0.219 | 0.365 | ||
| + | 3.840 | 0.648 | 1.424 | 0.176 | 0.350 | |||
| Phy | 500 | 3.044 | 0.388 | 2.038 | 0.262 | 0.441 | ||
| 1,500 | 3.201 | 0.870 | 0.607 | 0.133 | 0.275 | |||
| Ca | Low | 3.547 | 0.603 | 1.389 | 0.177 | 0.441 | ||
| High | 2.697 | 0.655 | 1.256 | 0.218 | 0.274 | |||
| SEM | 1.32 | 0.16 | 0.06 | 0.11 | 0.15 | |||
| P > f | ||||||||
| NE | 0.001 | 0.614 | 0.477 | 0.510 | 0.872 | |||
| Phy | 0.696 | 0.001 | 0.001 | 0.049 | 0.090 | |||
| Ca | 0.040 | 0.492 | 0.641 | 0.523 | 0.088 | |||
| NE × Phy | 0.784 | 0.161 | 0.192 | 0.261 | 0.808 | |||
| NE × Ca | 0.464 | 0.775 | 0.422 | 0.595 | 0.644 | |||
| Phy × Ca | 0.843 | 0.626 | 0.766 | 0.568 | 0.654 | |||
| NE × Phy × Ca | 0.622 | 0.203 | 0.411 | 0.231 | 0.496 | |||
a,b,cMeans in the same column with different superscripts are significantly different (P < 0.05).
Phytase (Quantum Blue 5G).
2 or 3-way interaction by Tukey.
Abbreviations: Ca, calcium; IP3, inositol triphosphate; IP4, inositol tetraphosphate; IP5, inositol pentaphosphate; IP6, inositol hexaphosphate; NE, necrotic enteritis; phy, phytase.
Effect of necrotic enteritis, phytase, and calcium on phytate esters and inositol concentration (μmol/g DM) in the ileal digesta of broilers 29 D posthatch.
| Effects | Inositol | IP3 | IP4 | IP5 | IP6 | |||
|---|---|---|---|---|---|---|---|---|
| NE | Phy | Ca | ||||||
| 2-Way interactions | ||||||||
| NE∗Ca | ||||||||
| - | Low | 23.90 | 0.368 | 1.790 | 0.554c | 3.52 | ||
| - | High | 13.50 | 1.982 | 7.194 | 5.143a | 17.46 | ||
| + | Low | 36.02 | 0.245 | 1.425 | 0.278c | 2.41 | ||
| + | High | 24.64 | 1.131 | 4.759 | 2.656b | 10.53 | ||
| Phy∗Ca | ||||||||
| 500 | Low | 27.97 | 0.345b | 1.885b,c | 0.397 | 3.88b,c | ||
| 500 | High | 17.15 | 1.009b | 4.681a,b | 4.779 | 19.53a | ||
| 1,500 | Low | 31.95 | 0.269b | 1.330c | 0.435 | 2.04c | ||
| 1,500 | High | 20.99 | 2.103a | 7.272a | 3.021 | 8.45b | ||
| Main effects | ||||||||
| NE | - | 18.70b | 1.175a | 4.492 | 2.849 | 10.49a | ||
| + | 30.33a | 0.688b | 3.092 | 1.467 | 6.47b | |||
| Ca | Low | 29.96a | 0.307 | 1.608 | 0.416 | 2.96 | ||
| High | 19.07b | 1.556 | 5.976 | 3.900 | 13.99 | |||
| SEM | 5.88 | 0.72 | 2.32 | 1.38 | 4.15 | |||
| P > f | ||||||||
| NE | 0.000 | 0.026 | 0.066 | 0.016 | 0.020 | |||
| Phy | 0.092 | 0.021 | 0.178 | 0.124 | 0.000 | |||
| Ca | 0.000 | 0.000 | 0.000 | 0.000 | 0.000 | |||
| NE × Phy | 0.094 | 0.273 | 0.875 | 0.571 | 0.456 | |||
| NE × Ca | 0.829 | 0.092 | 0.171 | 0.050 | 0.087 | |||
| Phy × Ca | 0.974 | 0.008 | 0.040 | 0.109 | 0.008 | |||
| NE × Phy × Ca | 1.000 | 0.279 | 0.587 | 0.343 | 0.322 | |||
a,b,cMeans in the same column with different superscripts are significantly different (P < 0.05).
Phytase (Quantum Blue 5G).
2-way or 3-way interaction by Tukey.
Abbreviations: Ca, calcium; IP3, inositol triphosphate; IP4, inositol tetraphosphate; IP5, inositol pentaphosphate; IP6, inositol hexaphosphate; NE, necrotic enteritis; phy, phytase.
Effect of necrotic enteritis, phytase, and calcium on gut permeability, day 16 posthatch.
| Effects | FITC-d (μg/mL) | |||
|---|---|---|---|---|
| NE | Phy | Ca | ||
| Main effects | ||||
| NE | - | 0.03b | ||
| + | 0.34a | |||
| SEM | 0.12 | |||
| P > f | ||||
| NE | 0.000 | |||
| Phy | 0.821 | |||
| Ca | 0.635 | |||
| NE × Phy | 0.939 | |||
| NE × Ca | 0.520 | |||
| Phy × Ca | 0.637 | |||
| NE × Phy × Ca | 0.418 | |||
a,b,cMeans in the same column with different superscripts are significantly different (P < 0.05).
Phytase (Quantum Blue 5G).
2-way or 3-way interaction by Tukey.
Abbreviations: Ca, calcium; FITC-d, fluorescein isothiocyanate dextran; NE, necrotic enteritis; phy, phytase.
Effect of necrotic enteritis, phytase, and calcium on jejunal gene expression, day 16 posthatch.
| Effects | CLDN1 | CLDN5 | JAM2D | MUC-2 | NaPi-IIb | OCLD | VDR | |||
|---|---|---|---|---|---|---|---|---|---|---|
| NE | Phy | Ca | ||||||||
| 2-Way interactions | ||||||||||
| Phy∗Ca | ||||||||||
| 500 | Low | 1.379a | 1.191 | 1.006 | 1.061 | 1.669 | 1.099 | 1.740a | ||
| 500 | High | 0.773c | 1.234 | 1.120 | 1.002 | 1.188 | 1.029 | 0.940b | ||
| 1,500 | Low | 0.864c | 0.997 | 0.999 | 0.965 | 1.285 | 1.115 | 0.930b | ||
| 1,500 | High | 1.014b | 1.192 | 1.043 | 1.365 | 1.187 | 1.011 | 1.050b | ||
| Main effects | ||||||||||
| NE | - | 0.513b | 0.771b | 0.974 | 1.247a | 1.787a | 1.294a | 1.500a | ||
| + | 1.502a | 1.537a | 1.110 | 0.949b | 0.878b | 0.832b | 0.830b | |||
| Ca | Low | 1.121 | 1.094 | 1.002 | 1.013 | 1.477 | 1.106 | 1.330 | ||
| High | 0.893 | 1.213 | 1.081 | 1.184 | 1.187 | 1.020 | 1.000 | |||
| SEM | 0.45 | 0.46 | 0.21 | 0.26 | 0.36 | 0.21 | 0.55 | |||
| P > f | ||||||||||
| NE | 0.000 | 0.000 | 0.115 | 0.013 | 0.000 | 0.000 | 0.003 | |||
| Phy | 0.435 | 0.506 | 0.621 | 0.251 | 0.279 | 0.999 | 0.112 | |||
| Ca | 0.199 | 0.502 | 0.358 | 0.146 | 0.106 | 0.287 | 0.120 | |||
| NE × Phy | 0.872 | 0.394 | 0.072 | 0.341 | 0.760 | 0.451 | 0.599 | |||
| NE × Ca | 0.552 | 0.658 | 0.060 | 0.382 | 0.467 | 0.613 | 0.203 | |||
| Phy × Ca | 0.036 | 0.667 | 0.683 | 0.052 | 0.280 | 0.820 | 0.038 | |||
| NE × Phy × Ca | 0.137 | 0.756 | 0.142 | 0.504 | 0.533 | 0.988 | 0.934 | |||
a,b,cMeans in the same column with different superscripts are significantly different (P < 0.05).
Phytase (Quantum Blue 5G).
2 or 3-way interaction by Tukey.
Abbreviations: Ca, calcium; CLDN1, claudin 1; CLDN5, claudin 5; JAM2D, junctional adhesion 2; MUC-2, mucin 2; NE, necrotic enteritis; NaPi-IIb, Na-dependent Pi cotransporters, type IIb; phy, phytase; OCLD, occluding; VDR, vitamin D.
Effect of necrotic enteritis, phytase, and calcium on jejunal gene expression (Cont.), 16 posthatch.
| Effects | CALB1 | ATP1A1 | ATP5A1W | ATP13A4 | ATP2A1 | ATP2B1 | CACNA | CASR | SLC8B | TPCN2 | TPCN3 | |||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| NE | Phy | Ca | ||||||||||||
| Treatment means | ||||||||||||||
| 1. | - | 500 | Low | 2.888 | 1.400 | 1.276 | 0.878 | 1.117 | 1.603 | 1.345 | 2.133a | 1.921 | 1.463 | 1.283 |
| 2. | - | 1,500 | Low | 1.835 | 1.458 | 1.271 | 0.908 | 1.047 | 1.247 | 0.900 | 1.158b | 1.549 | 1.266 | 1.398 |
| 3. | - | 500 | High | 2.081 | 1.269 | 1.121 | 0.946 | 1.112 | 1.271 | 1.047 | 0.796b | 1.488 | 1.283 | 1.238 |
| 4. | - | 1,500 | High | 1.365 | 1.565 | 1.344 | 0.979 | 1.237 | 1.334 | 1.020 | 0.917b | 2.177 | 1.403 | 1.463 |
| 5. | + | 500 | Low | 0.914 | 0.716 | 0.848 | 1.455 | 0.872 | 0.960 | 1.440 | 1.009b | 0.815 | 0.966 | 0.807 |
| 6. | + | 1,500 | Low | 1.072 | 0.817 | 0.812 | 0.928 | 0.880 | 0.854 | 0.983 | 1.026b | 0.584 | 0.839 | 0.810 |
| 7. | + | 500 | High | 0.863 | 0.759 | 0.864 | 1.207 | 0.912 | 0.783 | 0.988 | 1.074b | 1.124 | 0.869 | 0.792 |
| 8. | + | 1,500 | High | 0.624 | 0.760 | 0.864 | 1.268 | 1.062 | 0.862 | 0.909 | 0.860b | 1.037 | 0.798 | 0.746 |
| Main effects | ||||||||||||||
| NE | - | 1.423a | 1.253a | 2.042a | 0.928b | 1.128a | 1.364a | 1.078 | 1.251 | 1.784a | 1.354a | 1.345a | ||
| + | 0.763b | 0.847b | 0.868b | 1.214a | 0.932b | 0.865b | 1.080 | 0.992 | 0.890b | 0.868b | 0.789b | |||
| Phy | 500 | 1.036b | 1.027 | 1.686 | 1.121 | 1.003 | 1.154 | 1.205a | 1.253 | 1.337 | 1.145 | 1.030 | ||
| 1,500 | 1.150a | 1.073 | 1.224 | 1.021 | 1.056 | 1.074 | 0.953b | 0.990 | 1.337 | 1.077 | 1.104 | |||
| Ca | Low | 1.677b | 1.098 | 1.052 | 1.042 | 0.979 | 1.166 | 1.167 | 1.332 | 1.217 | 1.133 | 1.074 | ||
| High | 1.233a | 1.088 | 1.048 | 1.100 | 1.081 | 1.063 | 0.991 | 0.912 | 1.456 | 1.088 | 1.060 | |||
| SEM | 0.59 | 0.26 | 0.17 | 0.32 | 0.12 | 0.28 | 0.28 | 0.31 | 0.54 | 0.28 | 0.24 | |||
| P > f | ||||||||||||||
| NE | 0.000 | 0.000 | 0.000 | 0.051 | 0.004 | 0.000 | 0.989 | 0.040 | 0.003 | 0.000 | 0.000 | |||
| Phy | 0.075 | 0.216 | 0.538 | 0.485 | 0.415 | 0.531 | 0.064 | 0.037 | 1.000 | 0.590 | 0.408 | |||
| Ca | 0.087 | 0.917 | 0.962 | 0.687 | 0.125 | 0.421 | 0.191 | 0.001 | 0.400 | 0.722 | 0.868 | |||
| NE × Phy | 0.104 | 0.492 | 0.393 | 0.360 | 0.690 | 0.604 | 0.903 | 0.185 | 0.575 | 0.812 | 0.286 | |||
| NE × Ca | 0.448 | 0.976 | 0.612 | 0.933 | 0.889 | 0.880 | 0.516 | 0.004 | 0.616 | 0.851 | 0.780 | |||
| Phy × Ca | 0.953 | 0.707 | 0.374 | 0.306 | 0.201 | 0.240 | 0.140 | 0.083 | 0.290 | 0.464 | 0.865 | |||
| NE × Phy × Ca | 0.473 | 0.359 | 0.516 | 0.311 | 0.838 | 0.647 | 0.940 | 0.010 | 0.418 | 0.608 | 0.658 | |||
a,b,cMeans in the same column with different superscripts are significantly different (P < 0.05).
Phytase (Quantum Blue 5G).
2-way or 3-way interaction by Tukey.
Abbreviations: ATP1A1, ATPase Na+/K+ transporting subunit alpha 1; ATP5A1W, ATP synthase subunit alpha; ATP13A4, ATPase type 13A4; ATP2A1, ATPase, Ca++ transporting, cardiac muscle, fast twitch 1; ATP2B1, ATPase, Ca++ transporting, plasma membrane 1; Ca, calcium; CALB1, Calbindin 1; CACNA, calcium channel, voltage-dependent, P/Q type alpha 1A subunit; CASR, calcium-sensing receptor; NE, necrotic enteritis; phy, phytase; SLC8B, (sodium/lithium/calcium exchanger), member B1; TPCN2, 2-pore segment channel 2; TPCN3, 2-pore calcium channel 3.
Effect of necrotic enteritis, phytase, and calcium on intestinal morphology, 16 posthatch.
| Effects | Total height | Muscularis layer (μm) | Crypt depth (μm) | Villi height (μm) | Basal width (μm) | Apical width (μm) | Crypt:villi | Apparent villi area (μm2 × 103) | |||
|---|---|---|---|---|---|---|---|---|---|---|---|
| NE | Phy | Ca | |||||||||
| 2-Way interactions | |||||||||||
| NE∗Ca | |||||||||||
| - | Low | 1,468.8 | 206.5 | 184.1 | 1,078.2 | 57.44b | 37.15 | 6.28 | 38.50 | ||
| - | High | 1,472.2 | 183.2 | 189.5 | 1,099.6 | 57.20b | 34.55 | 6.17 | 38.13 | ||
| + | Low | 886.6 | 164.8 | 256.8 | 465.0 | 69.78a | 54.22 | 2.10 | 41.20 | ||
| + | High | 1,053.8 | 210.8 | 283.6 | 559.4 | 58.83b | 45.98 | 2.38 | 40.39 | ||
| Msin effects | |||||||||||
| NE | - | 1,470.5a | 194.8 | 186.8a | 1,088.9a | 57.32 | 35.85b | 6.22a | 50.67a | ||
| + | 970.2b | 187.8 | 270.2b | 512.2b | 64.31 | 50.10a | 2.24b | 28.43b | |||
| Ca | Low | 1,177.7 | 185.6 | 220.4 | 771.6 | 63.61 | 45.68 | 4.19 | 39.85 | ||
| High | 1,263.0 | 197.0 | 236.5 | 829.5 | 58.01 | 40.27 | 4.28 | 39.26 | |||
| SEM | 187.76 | 37.59 | 65.31 | 166.12 | 5.61 | 7.51 | 1.25 | 7.48 | |||
| P > f | |||||||||||
| NE | 0.000 | 0.713 | 0.005 | 0.000 | 0.006 | 0.000 | 0.000 | 0.000 | |||
| Phy | 0.801 | 0.442 | 0.823 | 0.476 | 0.475 | 0.672 | 0.649 | 0.413 | |||
| Ca | 0.256 | 0.552 | 0.569 | 0.301 | 0.027 | 0.055 | 0.851 | 0.846 | |||
| NE × Phy | 0.976 | 0.798 | 0.400 | 0.634 | 0.481 | 0.785 | 0.636 | 0.608 | |||
| NE × Ca | 0.275 | 0.074 | 0.704 | 0.512 | 0.033 | 0.310 | 0.684 | 0.926 | |||
| Phy × Ca | 0.876 | 0.897 | 0.885 | 0.928 | 0.902 | 0.305 | 0.658 | 0.942 | |||
| NE × Phy × Ca | 0.532 | 0.197 | 0.653 | 0.136 | 0.167 | 0.222 | 0.262 | 0.071 | |||
a,b,cMeans in the same column with different superscripts are significantly different (P < 0.05).
2-way or 3-way interaction by Tukey.
Phytase (Quantum Blue 5G).
Total height (muscularis layer + villi height).