| Literature DB >> 32943860 |
Xuan Zhou1, Jitian Wang1, Wenyan Liu1, Xuan Huang2, Yiqing Song3, Zuomin Wang1, Xingyuan Jia2,4.
Abstract
Purpose: To evaluate clinical periodontal status and microbiologic pathogens in Species">patients with <Species">span class="Disease">chronic obstructive pulmonary disease (COPD) and periodontitis. Patients andEntities:
Keywords: COPD; bacteria; observational research; periodontal
Mesh:
Year: 2020 PMID: 32943860 PMCID: PMC7478369 DOI: 10.2147/COPD.S266612
Source DB: PubMed Journal: Int J Chron Obstruct Pulmon Dis ISSN: 1176-9106
Sequences of Primers and Probes Used for Real-Time Quantitative PCR of Bacterial Pathogen Nucleic Acid Detection
| Bacterium Name | Primer Sequence (5ʹ→3ʹ) | Annealing Temperature (°C) |
|---|---|---|
| Pg | F: TTCGCTGTGGAAGCTTGACG | 60.0 |
| Aa | F: TTACGCACATGTCCGAGCAAG | 60.0 |
| Pi | F: AGATATCATGACGAACTCCGATTGC | 60.0 |
| Tf | F: TGGTCCGTGTCTCAGTACC | 60.0 |
| Td | F: CCGAATGTGCTCATTTACATAAAGGT | 60.0 |
| Pa | F: TTGGCACCTTCACCGGAAG | 60.0 |
| Total | F: GGTAAGGTTCTTCGCGTTGC | 55.0 |
Abbreviations: PCR, polymerase chain reaction; F, forward primer; R, reverse primer; P, probe; Pg, Porphyromonas gingivalis; Aa, Actinobacillus actinomycetemcomitans; Pi, Prevotella intermedia; Tf, Tannerella forsythensis; Td, Treponema denticola; Pa, Pseudomonas aeruginosa.
Demographic Characteristics in COPD Case and Control Groups
| Characteristics | COPD Group (n=60) | Control Group (n=60) | P-value |
|---|---|---|---|
| Age (y) (Mean±SD) | 63.1±10.1 | 60.0±9.4 | 0.97 |
| BMI (kg/m2) (Mean±SD) | 25.7±4.2 | 24.9±3.3 | 0.57 |
| Gender [n (%)] | 0.07 | ||
| Male | 49 (81.7) | 38 (63.3) | |
| Female | 11 (18.3) | 22 (36.7) | |
| Smoking status [n (%)] | 0.88 | ||
| Non-smoker | 14 (23.3) | 17 (28.3) | |
| Former smoker | 30 (50.0) | 29 (48.3) | |
| Current smoker | 16 (26.7) | 14 (23.3) | |
| Smoking pack-years (Mean±SD) | 8300±4000 | 6200±3200 | 0.21 |
| Quit smoking time (y) (Mean±SD) | 9.6±5.3 | 10.7±5.9 | 0.38 |
| Place of residence [n (%)] | 0.54 | ||
| Urban | 53 (88.3) | 55 (91.6) | |
| Rural | 7 (11.7) | 5 (8.3) | |
| Marriage status [n (%)] | 0.73 | ||
| Single | 5 (8.3) | 4 (6.7) | |
| Married | 55 (91.6) | 56 (93.3) | |
| Living status [n (%)] | 0.70 | ||
| Living alone | 4 (6.7) | 3 (5.0) | |
| Living with family | 56 (93.3) | 57 (95.0) |
Notes: P value obtained from Student’s t-test for continuous variables and Chi-squared test for categorical variables.
Abbreviations: COPD, chronic obstructive pulmonary disease; BMI, body mass index.
Lung Function and Periodontal Indexes in COPD Case and Control Groups
| Clinical Parameters | COPD Group (n=60) | Control Group (n=60) | |
|---|---|---|---|
| Lung function (Mean±SD) | |||
| FEV1% of predicted | 61.0±19.9 | 94.6±7.6 | <0.0001* |
| FEV1/FVC | 0.53±0.11 | 0.77±0.04 | <0.0001* |
| Periodontal index (Mean±SD) | |||
| Number of remaining teeth | 23.8±5.2 | 26.0±3.6 | 0.03* |
| Probing depth (PD) (mm) | 3.29±0.55 | 3.20±0.57 | 0.51 |
| Clinical attachment level (CAL) (mm) | 5.15±1.04 | 4.93±0.77 | 0.35 |
| Bleeding index (BI) | 2.45±0.54 | 2.42±0.62 | 0.86 |
| Plaque index (PLI) | 2.39±0.64 | 1.98±0.51 | 0.02* |
| Alveolar bone loss | 1.73±0.56 | 1.68±0.52 | 0.72 |
| Severe site percentages | |||
| PD ≥ 5mm site percentages | 13.0±5.5 | 12.7±6.3 | 0.77 |
| CAL ≥ 5mm site percentages | 30.3±15.5 | 19.1±10.4 | 0.02* |
Notes: P value obtained from Student’s t-test. *P<0.05 statistically significant.
Abbreviations: COPD, chronic obstructive pulmonary disease; FEV1, forced expiratory volume in one second; FVC, forced vital capacity.
Figure 1Mean ranks of natural log-transformed values of each bacterial species between COPD case and control groups.
Note: Since the log-transformed values of each bacterial species were abnormally distributed, Wilcoxon signed rank sum test was used to compare the median difference between case and control groups (n=60 in each group, all P >0.05).
Abbreviations: COPD, chronic obstructive pulmonary disease; Pg, Porphyromonas gingivalis; Aa, Actinobacillus actinomycetemcomitans; Pi, Prevotella intermedia; Tf, Tannerella forsythensis; Td, Treponema denticola; Pa, Pseudomonas aeruginosa; Sp, Streptococcus pneumonia; Hi, Haemophilus influenza; Kp, Klebsiella pneumonia.
Spearman Correlation Coefficients for Correlations Between Periodontal and Lung Pathogens Among Controls
| Periodontal Pathogens | Lung Pathogens | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| Pg | Aa | Pi | Tf | Td | Hi | Sp | Pa | Kp | |
| Pg | 0.11 | 0.13 | 0.23 | 0.14 | 0.03 | −0.13 | 0.03 | ||
| Aa | −0.02 | 0.18 | 0.18 | 0.20 | 0.23 | 0.11 | −0.12 | ||
| Pi | 0.21 | 0.24 | 0.14 | ||||||
| Tf | 0.12 | 0.10 | 0.06 | ||||||
| Td | 0.24 | 0.25 | 0.15 | 0.15 | |||||
| Hi | 0.13 | 0.22 | |||||||
| Sp | 0.13 | ||||||||
| Pa | 0.13 | ||||||||
| Kp | |||||||||
Notes: The bold values indicate the Spearman correlation coefficients between pathogens were statistically significant; **P <0.01 statistically significant; *P <0.05 statistically significant.
Abbreviations: Pg, Porphyromonas gingivalis; Aa, Actinobacillus actinomycetemcomitans; Pi, Prevotella intermedia; Tf, Tannerella forsythensis; Td, Treponema denticola; Pa, Pseudomonas aeruginosa; Sp, Streptococcus pneumonia; Hi, Haemophilus influenza; Kp, Klebsiella pneumonia.
Figure 2Principal component analysis of bacterial diversity in dental plaque in COPD case and control subjects.
Note: COPD case and control subjects are colored in blue and red, respectively (n=60 in each group).
Abbreviation: COPD, chronic obstructive pulmonary disease.
Multivariate-Adjusted ORs and 95% CIs of COPD Risk in Relation to Three Periodontal Variables
| Periodontal Variables | OR | 95% CI | |
|---|---|---|---|
| Pg | 0.91 | 0.82–1.02 | 0.09 |
| Plaque index (PLI) | 3.55 | 1.03–12.2 | 0.045* |
| CAL≥5mm site percentages | 1.05 | 1.01–1.10 | 0.01* |
Notes: The logistic regression analyses were adjusted for age, gender, body mass index and smoking status. *P <0.05 statistically significant.
Abbreviations: OR, odd ratio; CI, confidence interval; COPD, chronic obstructive pulmonary disease; Pg, Porphyromonas gingivalis; CAL, clinical attachment level.