Emodin alleviates gemcitabine resistance in pancreatic cancer by inhibiting MDR1/P-glycoprotein and MRPs expression.

Gemcitabine is a gold standard chemotherapeutic agent for pancreatic cancer. However, gemcitabine has limited effectiveness due to the short-term development of chemoresistance. Emodin, a natural anthraquinone derivative isolated from the roots of rheumatic palm leaves prevents immunosuppression and exerts anticancer effects. The present study aimed to evaluate the effect of emodin on gemcitabine resistance. Gemcitabine-resistant PANC-1 pancreatic cancer cell xenografts were established in athymic mice, which were randomly assigned into four treatments groups as follows: Gemcitabine group, Emodin group, Gemcitabine+Emodin group and Negative control group. Body weight, tumor volume and tumor weight were measured over the course of treatment. The effect of each treatment on tumor tissue proliferation and apoptosis from nude mice was evaluated by using immunohistochemistry. The effect of each treatment on the proliferation of gemcitabine-resistant PANC-1 cells was also determined by using the Cell Counting Kit-8. Then, reverse transcription-quantitative (RT-q) PCR and western blotting were used to detect the mRNA and protein expression, respectively, of multidrug resistance gene 1 (MDR1) and the drug resistance-related proteins MRP1 and MRP5. The function and expression level of DR1 gene product, p-glycoprotein, was also analysed by flow cytometry and RT-qPCR, respectively. The results demonstrated that the combination of gemcitabine and emodin significantly reduced xenograft volume and reduced tumor growth in mice compared with treatment with gemcitabine or emodin only. In addition, emodin treatment reduced resistance to gemcitabine, which was characterized by the downregulation of P-glycoprotein, MRP1 and MRP5 expression in the group receiving combination treatment. The level of P-glycoprotein was also decreased in the group treated with gemcitabine+emodin compared with the single treatment groups. Taken together, these results demonstrated that emodin enhanced gemcitabine efficacy in tumor treatment and alleviated gemcitabine resistance in PANC-1 cell xenografts in mice via suppressing MDR1/P-glycoprotein and MRP expression. Copyright: © Guo et al.

Introduction

Pancreatic cancer has become the fourth leading cause of cancer-associated mortality globally with 80,000 deaths each year in USA (1). It is predicted that pancreatic cancer could become the second leading cause of cancer-associated mortality in USA by 2030 (1). Pancreatic cancer is a malignant tumor with a strong ability to invade and metastasize, especially in the liver and lymph nodes, resulting in a high mortality rate (1). Pancreatic ductal adenocarcinoma (PDAC) is the most common type of pancreatic malignancy, and accounts for >95% of pancreatic tumors (2). Because PDAC progresses rapidly and exhibits no specific symptoms, it is usually at the end stage at the time of diagnosis (3). Although chemotherapy, radiation therapy and immunotherapy have made great progress in the treatment of cancer, the survival of patients with PDAC remains very poor. Only 24% of patients survive for one year after diagnosis, and <5% of all patients are expected to survive for five years after diagnosis (1).

At present, chemotherapy is the main treatment for patients with advanced PDAC (4). Gemcitabine, which is an S-phage DNA nucleotide analogue, has been widely used as chemotherapy for the treatment of various solid tumors, such as ovarian, breast, bladder, cervical, liver and biliary cancers (4). After a randomized clinical trial reported that gemcitabine can significantly improve symptoms of pancreatic carcinoma patients and prolong their median survival, gemcitabine has become the standard treatment choice for patients with advanced pancreatic carcinoma (5–7). In addition, a wide variety of gemcitabine-based combination therapies are currently being developed. For example, the researchers tried to use gemcitabine in combination with 5-FU, cisplatin and other anticancer drugs and alleviated the symptoms of patients with pancreatic cancer (8). However, patients treated with gemcitabine alone or in combination do not have a better survival, partly due to the development of gemcitabine chemoresistance within weeks of treatment in tumors that were initially sensitive to gemcitabine (8).

Emodin, a natural anthraquinone derivative (1,3,8-trihydroxy-6-methylanthraquinone) isolated from the roots of rheumatic palm leaves, has antibacterial properties (9), prevents immunosuppression (10) and exerts anticancer effects (11). Since normal cells have a stronger resistance to emodin compared to cancer cells (12), emodin can be used to inhibit pancreatic (13,14), ovarian (15), lung (16) and leukemic (17) cancer growth. Previous studies reported that emodin can enhance the antitumor efficacy of gemcitabine against pancreatic carcinoma by downregulating X-linked inhibitor of apoptosis protein expression and inhibiting Akt activation, stimulating therefore the mitochondrial-dependent cell apoptosis (18,19).

Although, the antitumor and bactericidal effects of emodin have been commonly recognized, the effects of emodin on gemcitabine efficiency and gemcitabine resistance remain unknown. The present study explored how emodin could enhance the antitumor efficacy of gemcitabine and might promote cancer cell apoptosis, and evaluated whether emodin may regulate gemcitabine chemoresistance in pancreatic cancer. As the most common type of multidrug resistance is associated with the involvement of the ABC (ATP-binding cassette transporter) transporter family (20). ABC transporters, which are ATP-dependent membrane proteins located in the plasma membrane in eukaryotes serve a crucial role in drug absorption, distribution and excretion by mediating drug efflux and decreasing intracellular drug accumulation (20). P-glycoprotein-mediated drug efflux is currently the most widely studied and in-depth drug resistance mechanism. The drug efflux pump MDR1/P-gp is highly expressed in pancreatic cancer cells (21). To do so, a xenograft mouse model using the pancreatic ductal epithelium-derived pancreatic cancer cell line PANC-1 was established, and the expression of multidrug resistance gene 1 (MDR1)/P-glycoprotein and MRPs was examined in the xenograft model. The ATP-dependent, membrane-bound drug efflux pumps MDR1/P-glycoprotein and MRP1 mediate clinically relevant chemical resistance/MDR (22). P-glycoproteins in the ATP-binding cassette (ABC) family are also thought to serve a crucial role in the chemotherapy resistance observed in breast cancer (23). This study also analysed the function of P-glycoprotein, which may reflect gemcitabine resistance.

Materials and methods

Materials

Emodin stock solution (Sigma-Aldrich; Merck KGaA) was dissolved in DMSO. Gemcitabine stock solution (Eli Lilly and Company) was dissolved in 0.9% sodium chloride. Total RNA was extracted using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). Reverse-transcribed complementary DNA was synthesized using the PrimeScript RT reagent kit (Vazyme Biotech Co., Ltd.). Real-time polymerase chain reaction was performed using SYBR Premix (Vazyme Biotech Co., Ltd.) on a StepOne RealTime PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The primers used were synthesized by Genomics Co. The sequences of the primers used for reverse transcription-quantitative (RT-q) PCR are listed in Table I. Rabbit anti-human anti-P-glycoprotein (P-gp) antibody (cat. no. 250820) was purchased from Abbiotec, and mouse anti-human MRP1 monoclonal antibody (cat. no. ab24102), goat anti-human MRP5 polyclonal antibody (cat. no. ab24107) and rabbit anti-human Ki-67 (cat. no. ab197234) were purchased from Abcam. Goat Anti-Rabbit secondary antibody (cat. no. ab205718) was purchased from Abcam.

Table I.

Sequence of the primers used for reverse transcription quantitative PCR.

Gene	Primer sequences	Products
MDR1		259 bp
Sense	5′-GAATCTGGAGGAAGACATGACC-3′
Antisense	5′- TCCAATTTTGTCACCAATTCC −3′
MRP1		353 bp
Sense	5′-CTGACAAGCTAGACCATGAATGT-3′
Antisense	5′-TCACACCAAGCCGGCGTCTTT −3
MRP5		481 bp
Sense	5′-GCTGTTCAGTGGCACTGTCAG-3′
Antisense	5′-TCAGCCCTTGACAGCGACCTT −3′
GAPDH		216 bp
Sense	5′-AACGGATTTGGTCGTATTGGG-3′
Antisense	5′-TCGCTCCTGGAAGATGGTGAT-3′

MDR1, multidrug resistance gene 1.

Cell lines and animals

The human pancreatic cancer cell line PANC-1 was purchased from The Cell Bank of Type Culture Collection of the Chinese Academy of Sciences. PANC-1 cells were cultured in RPMI 1640 medium (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc.) and 1% penicillin/streptomycin (Sigma-Aldrich; Merck KGaA) and placed at 37°C in a humidified incubator containing 5% CO2.

A gemcitabine-resistant PANC-1 cell line was established according to Yu et al (24) and Lou et al (25). PANC-1 cells were incubated with 0.1 µg/ml gemcitabine for 48 h at 37°C. After this point, most of the cells had died, and the viable cells grew slowly. The normal medium without gemcitabine was then replaced and cells were further cultured until the culture flasks were full of cells. The medium was subsequently replaced with culture medium containing 0.4 µg/ml gemcitabine and cultured with a cycle progress as mentioned previously, according to a four-fold increase in the drug concentration. Eventually, cells were cultured in medium containing 400 µg/ml gemcitabine. The remaining viable cells were determined as stably resistant to high concentrations of gemcitabine.

A total of 20 BALB/c nu/nu male mice (6-week-old) were purchased from the Shanghai Cancer Institute (http://www.shsci.org/) and housed in a pathogen-free environment at the Experimental Animal Center of Wenzhou Medical University (Wenzhou, China). The mice had free access to sterilized food and water, and the environment had a cycle of 12 h darkness and 12 h light. This protocol was approved by the Ethics Committee of the First Affiliated Hospital of Wenzhou Medical University.

Animal model establishment and experimental scheme

Tumor xenografts were established by subcutaneous inoculation of 5×106 PANC-1 cells into the right armpit flanks of BALB/c mice. After two weeks, mice were randomly divided into four groups of five mice as follows: The Negative control group, which was treated with 0.9% sodium chloride; the Gemcitabine group, which was treated with 125 mg/kg gemcitabine; the Emodin group, which was treated with 40 mg/kg emodin; and the Gemcitabine+Emodin group, which was treated with 125 mg/kg gemcitabine and 40 mg/kg emodin. Treatments were administered intraperitoneally every three days and for a total of nine times (Fig. 1A). Mice were sacrificed by carbon dioxide asphyxiation (5 L euthanasia box, 100% CO2, flow rate 0.5 l/min, 3 min) 6 days after the last injection, and tumors were collected. Tumor size was measured for each mouse. The tumor volume under the skin was evaluated every 6 days before mice were sacrificed. The tumor volume was calculated as follows: Tumor volume=π/6×a2xb (26), where a and b represent the short and long axes, respectively.

Figure 1.

Emodin combined with gemcitabine reduces the resistance of pancreatic cancer cells to gemcitabine and proliferation of pancreatic cancer by inhibiting the expression of MDR1/P-glycoprotein and MRPs. (A) Xenograft mice model establishment and experiment scheme. (B) Mice were sacrificed and tumors were measured. (C) Mice were sacrificed and tumor weight was measured. Compared with the negative control group, emodin combined with gemcitabine treatment reduced tumor weight. (D) Measure tumor volume every 6 days. Compared with the negative control group, emodin combined with gemcitabine treatment can reduce tumor size. (E) Immunohistochemical staining of Ki-67 expression in xenograft tumor tissues. Compared with the negative control group, emodin combined with gemcitabine treatment reduced tumor proliferation. (F) TUNEL assay in tumor tissue. Compared with the negative control group, combination treatment with gemcitabine and emodin increased the number of TUNEL-positive tumor cells. Magnification, ×200. Scale bar, 50 µm. (G) After treating anti-gemcitabine PANC-1 cells with different drugs, cell proliferation was detected. Compared with the negative control group, emodin combined with gemcitabine treatment reduced the proliferation of drug-resistant tumor cells. **P<0.01, ***P<0.001, ns, no significance. MDR, multidrug resistance; MRPs, multidrug resistance-related proteins; MRP1, multidrug resistance-related protein 1; MRP5, multidrug resistance-related protein 5.

Immunohistochemistry (IHC) and Terminal deoxynucleotidyl transferase-mediated dUTP digoxigenin nick-end-labelling (TUNEL) assay

The tumor tissue was collected and placed in 4% paraformaldehyde at 4°C overnight. Next the tissue was placed in different concentrations of alcohol for dehydration (70, 85, 95 and 100%), every concentration was performed for 1 h. The tumor tissue was placed in xylene for 1 h and embedded in paraffin and cut into 5-µm sections. The sections are dewaxed by heating in an oven at 60°C for 20 min. The sections were dehydrated in xylene and hydrated by gradient ethanol (100, 95 and 75%). Sections were placed in citrate buffer (pH 6.0), placed in a microwave oven with the container and heated for 25 min. Endogenous peroxidase activity was blocked by 3% H2O2 for 10 min. Block with TBST containing 5% goat serum (Beijing Solarbio Science & Technology Co., Ltd.) for 1 h at room temperature. Sections were incubated with primary antibody against Ki-67 (1:300) at 4°C overnight, and signal was detected with EnVisionTM detection kit (cat. no. DA1010; Beijing Solarbio Science & Technology Co., Ltd.). Sections were counterstained using haematoxylin (OriGene Technologies, Inc.). Images were captured using a TS100 light microscope (magnification, 100×; Nikon Corporation). TUNEL assay was used to detect apoptosis in tumor sections. This assay was performed by using the in situ Apoptosis Detection kit (cat. no. 11684817910; Roche Diagnostics) according to the manufacturer's protocol. All images were captured using a TS100 light microscope (magnification, 100×; Nikon Corporation).

In vitro proliferation assay

PANC-1 cells were seeded in 96-well plates (1×103 cells per well) and incubated for 24 h at 37°C. The 96-well plate was then divided into 4 groups: Group 1. 100 µl serum-free medium; group 2. 100 µl serum-free medium+60 µg/ml gemcitabine; group 3. 100 µl serum-free medium+40 µg/ml emodin and group 4. 100 µl serum-free medium+60 µg/ml gemcitabine +40 µg/ml emodin and incubated for 4 h. After 4 h, the cells were cultured in normal complete medium. Cell proliferation at 0, 24, 48 and 72 h time points was measured using Cell Counting Kit-8 (CCK-8) assay (Dojindo Molecular Technologies, Inc.) according to the manufacturers' instructions.

Western blotting

Tumor tissues were lysed using 400 µl RIPA (Beyotime Institute of Biotechnology) at 4°C for 15 min, and the protein concentration was measured using a bicinchoninic acid assay kit (Sigma-Aldrich; Merck KGaA). 15 µl total protein per lane was separated by 10% SDS-PAGE and transferred onto a polyvinylidene fluoride membrane (Invitrogen; Thermo Fisher Scientific, Inc.) Τhe membranes were blocked with 5% skim milk for 1 h at room temperature and washed 3 times with TBST for 5 min each. Subsequently, the membranes were incubated with primary antibodies against P-gp (1:800), MRP1 (1:30) or MRP5 (1 µg/ml) at 4°C overnight. The membranes were washed 3 times with TBST for 5 min each between incubations. The membrane was incubated with rabbit IgG secondary antibody (1:5,000; ZB-2301; Origene Technologies, Inc.) at 4°C for 1 h. The bands were visualized via an enhanced chemiluminescence (ECL) system (Beyotime Institute of Biotechnology). Protein bands were quantitated using ImageJ software v.1.52T (National Institute of Health) and sample loading was normalized by GAPDH protein level in each sample.

RT-qPCR

Total RNA was isolated from 50 mg tumor samples using TRIzol® according to the manufacturer's protocol. Reverse transcription was performed using PrimeScript RT reagent kit according to the manufacturers' instructions. RT-PCR was performed using SYBR Premix (Vazyme Biotech Co., Ltd.) on a StepOne RealTime PCR system (Applied Biosystems). The qPCR conditions used were as follows: Initial denaturation at 95°C for 3 min, followed by 40 cycles of 95°C for 5 sec and 58°C for 30 sec. The sequences of the primers used in the present study are presented in Table I. Each sample was assessed in triplicate. The relative expressions levels were normalized to the endogenous control GAPDH and were expressed as 2−ΔΔCq (27).

P-glycoprotein function

PANC-1 cells (1×106) were seeded in 24-well plates and incubated for 24 h at 37°C. Serum-free medium; 60 µg/ml gemcitabine; 40 µg/ml emodin and 60 µg/ml gemcitabine+40 µg/l emodin were incubated at 37°C for 4 h. Cells were harvested and incubated with Rho123 at 37°C in the dark for 1 h. Rhodamine 123 (Rho123) is a fluorescent dye that enters cell mitochondria. Since it is a substrate for P-glycoprotein, Rho123 can therefore be used as a molecular probe to study MDR phenotype. Cells were washed once with PBS to remove impurities, and the intracellular Rho123 fluorescence intensity was measured by flow cytometry (BDFACS Calibur; BD Biosciences).

Statistical analysis

Statistical analysis was performed using SPSS v.22.0 (IBM Corp.). Multiple comparisons of means were perfomed using one-way analysis of variance (ANOVA) followed by the post hoc Tukey's test, and unpaired samples were subjected to a two-tailed Student's t-test, assuming equal variance. Data were expressed as the means ± standard deviation. P<0.05 was considered to indicate a statistically significant difference.

Results

Emodin enhances the antitumor effect of gemcitabine

Two weeks after mice inoculation with the gemcitabine-resistant PANC-1 cell line, the mean tumor volume and mean mice body weight were 74.42±6.42 mm3 and 21.34±0.5 g, respectively. Mice were randomly assigned to four groups as aforementioned with no different in tumor volume or body weight. The Negative control group was treated with 0.9% sodium chloride, the Gemcitabine group was treated with 125 mg/kg gemcitabine, the Emodin group was treated with 40 mg/kg emodin and the Gemcitabine+Emodin group was treated with 125 mg/kg gemcitabine and 40 mg/kg emodin. Treatments were performed every three days for a total of nine times (Fig. 1A). Six days after the final treatment, tumor tissues were harvested, and their volumes and weights were measured (Fig. 1B-D). The gemcitabine group compared with the negative control group did not reduce the weight and volume of the tumor and the emodin and emodin+gemcitabine groups could reduce the weight and volume of the tumor. Compared with the emodin group, the combined group significantly reduced tumor weight and volume (Fig. 1C and D).

Emodin inhibits PANC-1 cell proliferation by enhancing the antitumor effect of gemcitabine

IHC staining for Ki-67 expression and the CCK-8 assay were performed in tumor tissues and PANC-1 cells, respectively, and were both used to assess cell proliferation. As presented in Fig. 1E and G, gemcitabine and emodin treatments alone did not significantly inhibit tumor cell proliferation. Combination treatment with gemcitabine and emodin had a stronger inhibitory effect on cell proliferation compared with treatment with gemcitabine or emodin alone (P<0.001; Fig. 1E and G).

The ability to inhibit apoptosis and exhibit sustained survival is one characteristic of cancer cells. Apoptosis is a tightly controlled type of programmed cell death that can be induced by chemotherapeutic drugs. In the present study, the effect of emodin treatment on cell apoptosis was investigated. The results from TUNEL assay demonstrated that combination treatment with gemcitabine and emodin increased the number of TUNEL-positive tumor cells (Fig. 1F), suggesting that emodin may enhance the apoptosis-inducing effect of gemcitabine on tumor cells.

Emodin reverses gemcitabine resistance in PANC-1 cells

To investigate whether emodin could reverse gemcitabine chemoresistance, the expression of MRP1, MRP5 and MDR1/P-glycoprotein was examined in tumor tissues. The results demonstrated that the mRNA and protein expression of MRP1, MRP5 and P-glycoprotein were significantly decreased (P<0.05) in the Emodin and Gemcitabine+Emodin groups compared with the negative control group (Fig. 2A and B). The function of P-glycoprotein in the 4 groups was also evaluated using Rho123 staining. There was no change in P-glycoprotein function in the gemcitabine group compared with the negative control group. Compared with the negative control group, the emodin group inhibited the function of P-glycoprotein and reduced the efflux function of tumor cells. Combining emodin with gemcitabine significantly inhibited the function of P-glycoprotein and reduced the efflux function of tumor cells (Fig. 2C). Considering the role of P-glycoprotein, MRP1 and MRP5 in chemoresistance, these findings suggested that emodin may reverse PANC-1 cell resistance to gemcitabine.

Figure 2.

Detection of p-glycoprotein and efflux function. (A) mRNA expression of MRP1, MRP5 and MDR1-P-glycoprotein examined by reverse transcription quantitative-PCR. Compared with the negative control group, emodin and emodin+gemcitabine treatment all reduced the expression of MDR1/P-glycoprotein and MRP1 and MRP5 in tumor tissues. (B) Expression of MRP1, MRP5 and MDR1-P-glycoprotein determined by western blotting. Compared with the negative control group, emodin and emodin combined with gemcitabine treatment reduced the expression of MDR1/P-glycoprotein and MRP1 and MRP5 in tumor tissues. (C) P-glycoprotein function was investigated in the 4 groups and evaluated using Rho123 staining. Compared with the negative control group, emodin and emodin combined with gemcitabine all increased intracellular fluorescence of Rhodamine 123 intensity in tumor cells. Emodin alone and emodin+gemcitabine treatment reduced the efflux of drug-resistant tumor cells Rho123. **P<0.01, ***P<0.001, ns, no significance. MDR, multidrug resistance; MRPs, multidrug resistance-related proteins; MRP1, multidrug resistance-related protein 1; MRP5, multidrug resistance-related protein 5.

Discussion

The resistance of pancreatic cancer to chemotherapeutic drugs has become a major obstacle to cancer treatment. The mechanisms involved in cancer chemoresistance include the increased activity of drug efflux pumps at the cell membrane such as P-glycoprotein-mediated efflux of drugs, decreased drug accumulation and alterations in drug targeting (28). The most common type of multidrug resistance is associated with the involvement of the ABC transporter family. ABC transporters, which are ATP-dependent membrane proteins located in the plasma membrane in eukaryotes, serve a crucial role in drug absorption, distribution and excretion by mediating the drug efflux and decreasing the intracellular drug accumulation (29). P-glycoprotein-mediated drug efflux is currently the most widely studied and in-depth drug resistance mechanism (28). O'Driscoll et al (22) reported that the drug efflux pump MDR1/P-gp is highly expressed in pancreatic cancer cells (22). MDR1/P-gp has also been demonstrate to be involved in the development of chemotherapy resistance in lung cancer (30). Inhibition of multidrug efflux pumps could therefore reverse the MDR phenotype (22). The results of the present study demonstrated that compared with the negative control group, the levels of MDR1 and P-gp protein expression in tumor tissues of the emodin group were reduced, and emodin combined with gemcitabine treatment significantly reduced the expression of MDR1 and P-gp proteins in tumor tissues. Emodin may enhance the therapeutic effect of gemcitabine by reversing the expression of MDR1 and P-gp proteins in tumor tissues and reverse the resistance of tumor tissues. Furthermore, the Rhod123 efflux test showed that compared with the negative control group and the gemcitabine group, the treatment of emodin alone and the combined treatment of emodin and gemcitabine reduced the P-gp function of drug-resistant tumor cells and decreased the efflux function. Subsequently, compared with the negative control group, the use of emodin in combination with gemcitabine may decrease cell resistance to chemotherapy in PANC-1 ×enograft mice by inhibiting P-glycoprotein.

Previous studies reported that MRP3 and MRP5 expression in pancreatic cancer tissues is significantly compared with normal pancreatic tissues (31). Noma et al (32), examined the expression of the MRP1, MRP2 and MRP3 in pancreatic cancer and determined the correlation between MRP2 expression and chemotherapeutic drug resistance. MRP2 and MRP3 were reported to be highly expressed in pancreatic cancer tissues after chemotherapy, and that MRP2 expression is associated with intrinsic and acquired resistance to gemcitabine+cisplatin in human pancreatic cancer. In the present study, compared with the negative control group, the use of emodin alone or in combination with gemcitabine significantly reduced tumor volume, and increased apoptotic cell death and MRP1 and MRP5 expression. Emodin may therefore increase the sensitivity of gemcitabine-resistant PANC-1 cells to gemcitabine by downregulating the expression of MRP1 and MRP5.

In conclusion, emodin, which is a broad-spectrum anticancer agent, has a good anti-cancer effect (10–17). The results from the present study demonstrated that gemcitabine combined with emodin had better anti-tumor effect compared with emodin alone. Emodin may enhance the anticancer effect of gemcitabine and reverse the resistance of pancreatic cancer to gemcitabine by inhibiting the expression of MDR1/P-glycoprotein and MRP1 and MRP5. In addition, because the MDR1/P-gp and MRP1 and MRP5 proteins are involved in the development of resistance to other chemotherapeutic drugs, including 5-fluorouracil and cisplatin, emodin may also attenuate or delay the resistance of pancreatic cancer to these drugs. Addition of emodin in first-line chemotherapy may therefore help reducing chemotherapy resistance and improve treatment efficacy. Further investigation will evaluate the underlying mechanism of emodin in enhancing chemotherapy efficiency.