Molecular species identification of bushmeat recovered from the Serengeti ecosystem in Tanzania.

Bushmeat harvesting and consumption represents a potential risk for the spillover of endemic zoonotic pathogens, yet remains a common practice in many parts of the world. Given that the harvesting and selling of bushmeat is illegal in Tanzania and other parts of Africa, the supply chain is informal and may include hunters, whole-sellers, retailers, and individual resellers who typically sell bushmeat in small pieces. These pieces are often further processed, obscuring species-identifying morphological characteristics, contributing to incomplete or mistaken knowledge of species of origin and potentially confounding assessments of pathogen spillover risk and bushmeat offtake. The current investigation sought to identify the species of origin and assess the concordance between seller-reported and laboratory-confirmed species of origin of bushmeat harvested from in and around the Serengeti National Park in Tanzania. After obtaining necessary permits, the species of origin of a total of 151 bushmeat samples purchased from known intermediaries from 2016 to 2018 were characterized by PCR and sequence analysis of the cytochrome B (CytB) gene. Based on these sequence analyses, 30%, 95% Confidence Interval (CI: 24.4-38.6) of bushmeat samples were misidentified by sellers. Misreporting amongst the top five source species (wildebeest, buffalo, impala, zebra, and giraffe) ranged from 20% (CI: 11.4-33.2) for samples reported as wildebeest to 47% (CI: 22.2-72.7) for samples reported as zebra although there was no systematic bias in reporting. Our findings suggest that while misreporting errors are unlikely to confound wildlife offtake estimates for bushmeat consumption within the Serengeti ecosystem, the role of misreporting bias on the risk of spillover events of endemic zoonotic infections from bushmeat requires further investigation.

Introduction

Bushmeat, meat and organs from wildlife species, is an important source of animal protein in the diets of communities in the sub-tropics of the Americas and Africa. The hunting and harvesting of bushmeat is commonly practiced by those living in close proximity to national parks and protected areas and is an important source of income for rural and forest dwellers who depend on this natural resource [1]. This is particularly true for many rural populations in Tanzanian where it found that bushmeat makes its way to urban markets and neighboring countries. Non-specific snare poaching is the most common form of bushmeat hunting in the Serengeti ecosystem in Tanzania [2] and often targets migratory wildebeests, taking off an estimated 100,000–140,000 individuals per year, or 6–10% of their population [3]. Unfortunately, studies of bushmeat populations often focus on limited species. Offtake estimates are typically based on either markets, which focus on species that are for sale, or censuses counts, which typically consider only a single species. Recent modeling studies have begun to evaluate multiple species however, the interspecific dynamics of hunting remain poorly understood [4].

Globally, mammalian biodiversity is declining, with many wildlife species under threat of dramatic population losses due to the combined effects of habitat loss and illegal hunting. The effects of bushmeat hunting are estimated to put over 300 terrestrial mammal species at risk of extinction [5]. Bushmeat hunting not only threatens wildlife populations, but consumption of bushmeat also poses a significant threat to human health–of the 60% of emerging diseases that are zoonotic, more than 70% originate in wildlife [6]. This study focused on the Serengeti National Park in Northern Tanzania, which is well known for the abundance and biodiversity of wildlife within the ecosystem and the high prevalence of bushmeat hunting performed regularly in the region [7]. Further, the presence of potentially zoonotic pathogens in Tanzania has been well documented [8-13], however, such studies do not regularly include the ramifications of zoonotic transfer of pathogens or risks of disease associated with the handling and consumption of bushmeat.

Given the link between human population densities and offtake of wildlife for bushmeat, the nationwide human population increase of 2.8% per year in Tanzania and up to 3.5% per year near the Serengeti park boundary [14], is particularly concerning, and constitutes a substantial threat to the viability of wildlife populations inside and outside protected areas. Due to the illegal nature of bushmeat hunting in Tanzania, the supply chain may involve numerous players between the hunter and consumer, which could include, whole-sale sellers, retailers, and other community members who all have the potential to contribute to the mistaken or incomplete knowledge of the species of origin [1, 15–18]. Opportunities for morphological identification of bushmeat are limited since specimens are either sold as small pieces or processed in a manner that obscures indicative features. Furthermore, the reliability of the information given by the seller may also be affected by the desire to satisfy consumer preference [17, 19]. Therefore, verbal information accompanying bushmeat may not be credible. Species misinformation may have substantial effects on the response to identified spillover events or the source ascertainment of detected pathogens of human concern. Further, misreported bushmeat species may poses a threat to conservation efforts and species offtake estimates.

Nucleotide sequences in genomic regions, such as those of the mitochondrial cytochrome (CytB) gene, have been successfully used to identify a diverse set of species in studies ranging from epidemiological surveys to forensic screening of legal and illegal trade in wildlife and wildlife products [20-23]. Hence, the molecular identification of species presents an opportunity to test the reliability of seller-reported species of origin.

Due to the limitations involved with seller-reported species of origin of bushmeat and the need for correct species identification for disease surveillance and offtake estimates, this study applied PCR amplification and DNA sequencing of the CytB gene to test the accuracy of seller-reported versus laboratory-confirmed species of origin of bushmeat collected from in and around the Serengeti ecosystem in Tanzania.

Methods

Study area

The Serengeti Ecosystem (Serengeti) extends from northern Tanzania into southern Kenya (1°30´ to 3°30´ S and 34° 00´ to 35° 45´ E), and covers some 25,000 km2. The ecosystem is well known for its diversity of wildlife and the annual migration of ~1.5 million wildebeest (Connochaetes taurinus mearnsi) and ~200,000 zebra (Equus quagga). The Serengeti National Park in Tanzania and the Masai Mara National Reserve in Kenya have the highest levels of protection, excluding all human uses except for tourism and research, and form the core of the protected area system. In Tanzania, the Serengeti National Park is bordered by a protected area known as the Ngorongoro Conservation Area. It is also bordered by game reserves, including the Maswa Game Reserves, Kijereshi Game Reserves, and Ikorongo-Grumeti Game Reserves, which allow trophy hunting, game-controlled areas, and wildlife management areas, along with certain other human uses including livestock grazing, farming, and habitation. A distinct rainfall gradient from 500 mm/year in the southeast to 1200 mm/year in the northwest helped shape the livelihoods of people living around the ecosystem, with trans-human pastoralism dominant in the east, and agro-pastoralism dominant in the west[14].

Bushmeat sample collection

Permissions and permits to collect samples in the Serengeti National Park was granted through the Tanzania Commission for Science and Technology, Tanzania Wildlife Research Institute (permit number TWRI/RS-331/VOL.II/2013/58 and TWRI/RS-331/VOL.II/2013/88), Tanzania National Parks (permit number TNP/HQ/C.10/1), Ngorongoro Conservation Area Authority (permit number NCAA/D/240/Vol.XXVIII/54), and Tanzania Wildlife Authority (permit number CB.517/519/01/14). Before sample collection took place, enumerator networks were formed through obtaining proper permissions from the district and village governments as well. Given the illegal nature of the bushmeat trade, local enumerators are better able to acquire the samples without raising the suspicions of those hunting or selling the bushmeat. Recruitment of enumerators was based on being resident in the study villages and having prior experience in buying bushmeat. Enumerators were instructed not to purchase multiple samples from the same seller to reduce the chances of samples being from the same animal. In an effort to mitigate bias caused by the enumerator purchasing process, they were instructed to not actively source specific species, question the seller’s identification of the meat or divulge the purpose for obtaining the meat. Sampling locations were recorded using hand-held Global Positioning System (GPS) devices (Fig 1).

Fig 1

Sample distribution and metadata from selected samples collected in the Serengeti ecosystem.

A. The map shows the sites from where the 151 samples selected for molecular speciation were collected. The red dots represent the samples that speciated as the same species as reported (match), and the blue dots represent samples that did not match the reported species (mismatch). The number collected at each site is represented on the map with the percentage of mismatch samples. B. The proportion of samples collected from each different category is represented in the pie charts. The condition was either fresh (red, n = 91) or processed (blue, n = 60), the season was dry (red, n = 66) or rainy (blue, n = 85), whether the samples matched (red, n = 105) or mismatched (blue, n = 46) the reported species. The two pie charts on the bottom represent the reported species versus the species after speciation with the species represented by the legends associated with each pie.

The enumerators purchased ~250–500 g bushmeat from local sellers. Meat was categorized as either fresh or processed at the time of purchase. Samples were considered to be ‘fresh’ if they did not appear to be treated in any way upon visual inspection at the time of collection. Samples were considered ‘processed’ if they appeared to be boiled, semi-boiled, highly salted, dried, or some combination of methods when purchased. The samples were placed in double zip lock freezer bags containing non-toxic silica gel desiccant moisture absorbers/dehumidifiers and stored in -20°C vehicle freezers prior to transferring to -20°C solar freezers. Samples were then transported in a -20°C vehicle freezer to the Nelson Mandela African Institution of Science and Technology (NM-AIST) in Arusha, Tanzania where they were stored at -80°C until processing. Cold chain was ensured through temperature trackers stored with the samples throughout the entire process. Sample identification sheets were completed for all collected samples and the metadata, including sample condition (fresh or processed), collection site (GPS units), seasonality (rainy or dry), and reported wildlife species of origin were recorded.

DNA extraction

By sterile, disposable Rapid Core punch (World Precision Instruments, Sarasota, FL) or sterile disposable safety scalpels (VWR, Bridgeport, NJ), three small pieces (~120 mg total) from the tissue samples were dissected and placed in the MagMAX™ Lysis/Binding Solution Concentrate buffer (Thermo Fisher Scientific, Waltham, Massachusetts). Homogenization was performed using the Bead Ruptor 24 Bead Mill Homogenizer (Omni International, Kennesaw, GA) according to company’s recommendations, with slight modifications. In brief, fresh samples were homogenized for 45 seconds at 5.5 m/s using 2.3 MM zirconia beads (BioSpec Products, Bartlesville, OK) in the MagMAX™ Lysis/Binding buffer. Processed samples were pre-soaked in the UltraPure DNase/RNase-Free Distilled Water (Thermo Fisher Scientific, Grand Island, NY) at 4°C overnight, and were homogenized for three 30-second intervals at 5.5 m/s with 2.3 MM zirconia beads in the MagMAX™ Lysis/Binding buffer. Nucleic acid extractions were performed using the KingFisher Flex automated DNA purification system (Thermo Fisher Scientific, Grand Island, NY) from tissue samples per manufacturer’s instructions. If the DNA concentration was less than 4 ng/μl and/or if the quality of the amplicons analyzed by the Bioanalyzer did not pass the quality control, DNA was extracted manually using DNeasy PowerSoil Kit (Qiagen, Hilden, Germany) per manufacturer’s instructions. Extracted DNA was quantified using Qubit™ 3.0 Fluorometer (Thermo Fisher scientific, Grand Island, NY). DNA was also visualized through agarose gel electrophoresis.

Molecular species identification

A highly informative fragment of the CytB gene was characterized by DNA sequence analysis to determine the species of origin of the collected samples. The primer pairs used in the PCR and sequencing reactions included: Forward Mcb 5’ TACCATGAGGACAAATATCATTCTG 3’ and Reverse Mcb 5’ CCTCCTAGTTTGTTAGGGATTGATCG 3’ [24]. The PCR reaction was performed in a 30 ul volume comprising of 15 ul master One Taq 2X Master Mix with standard buffer (New England BioLabs Inc., Ipswich, MA, USA), 20 ng genomic DNA, 0.5 μM each primer, and 8 ul nuclease free water. The cycling conditions were: initial denaturation at 95°C for 10 min; subsequent 35 cycles of denaturation at 95°C for 45s; annealing at 51°C for 1 min; extension at 72°C for 2 min and a final extension of 72°C for 10 min [25].

The PCR products were analyzed using a 1.5% agarose gel electrophoresis to confirm presence and quality of a 480–490 bp fragment. The amplicons were purified and sequenced at the Inqaba Biotechnical Industries (Pty) Ltd, South Africa. Sequencing was carried out in both forward and reverse directions.

Data analysis

The sequences were examined using CLC Main Work Bench v.7 (www.qiagenbioinformatics.com) to detect base calling conflicts. The forward and reverse sequences were aligned to generate consensus sequences, then compared to available sequences in the NCBI database by using BLAST tools. A cutoff point of 95% of sequence similarity [Curr Protoc Bioinformatics. 2013 ">26-28] was used to identify species for each bushmeat sample, however, the top hit (in most cases > 98% similarity) was recorded as the species of origin.

All statistical analyses were performed in R v3.4.4 [29]. The kappa2 function of the IRR package was used to determine concordance between seller-reported and laboratory-confirmed results[30]. A Chi-squared test was performed to test whether the match/mismatch percentages were similar between different reported species using the prop.test function in R. The prop.test function was also used to perform pairwise analysis of the individual species (seller-reported versus laboratory-confirmed) [16]. One-sample t-test power analysis was performed to calculate the sample size with the following assumptions: power = 0.95, Significance = 0.05, an Effect size of 0.25.

Results

A total of 151 samples were selected for molecular characterization of the wildlife species of origin. Based on the power analysis performed, a sample size of 208 was calculated however, our strategy for this study was to perform informative research and we collected opportunistic samples from a network of enumerators and from the market. We are in the process of large-scale work in Tanzania and will consider this suggestion as well as other valuable suggestions in designing a better and more informative study.

The map in Fig 1A shows the sample collection sites. Fig 1B shows the distribution of samples with respect to the sample condition, season at collection and molecular speciation (Fig 1B). Overall, roughly one third of the samples were misreported, meaning the seller-reported species of origin was not consistent with the laboratory-confirmed species of origin.

Of the 151 samples categorized using the CytB gene, 46 (30%, CI: 23.4–38.6) represented a mismatch between seller-reported and molecular species identification (Figs 2A and 3). Overall, 47% (CI: 22.2–72.2) of the bushmeat samples reported as zebra were misreported followed by giraffe (Giraffa camelopardalis tippelskirchii), buffalo (Syncerus caffer), wildebeest, and impala (Aepyceros melampus) (36% CI: 14–64.4, 32% CI: 17.3–51.5, 20% CI: 11.4–33.2, 20% CI: 6.61–44.3 respectively, Fig 2A). However, there is no significant difference in the percentage of misreporting between the different species as well as compared to the overall misreporting according to a pairwise comparison of proportions (all p-values > 0.01, S1 and S2 Tables), suggesting a lack of systematic bias. For example, of the 59 wildebeest samples that were selected, 47 samples were correctly reported and 12 samples incorrectly reported as wildebeest according to the laboratory-confirmed species (Fig 2C). Of these 12 samples, 10 were laboratory-identified as buffalo, 1 as eland, and 1 as impala (Fig 2C). Overall, these data showed moderate concordance (Cohen’s kappa = 0.598) between seller-reported and laboratory-confirmed species of origin. Further, there appears to be no bias with regard to the IUCN Red List designation.

Fig 2

A. Bar graph and heatmap showing the number of bushmeat samples reported for each species, and the discrepancy between reported and speciated species. Total counts of seller-reported species of origin are in the bar graphs. The points and lines represent correctly reported (matched—filled circles) and mismatched (open circles) counts of the speciation results. For each species, the heatmap shows the number of seller-reported species that were confirmed with laboratory characterization, and for those misidentified, shows the actual species of each laboratory-confirmed species as well as the International Union for Conservation of Nature (IUCN) Red List Categories for each species (N = 150). The x-axis represents the laboratory-confirmed species and the y-axis represents seller-reported species. Shown IUCN categories are least concern–LC; near threatened–NT; vulnerable–VU; not applicable—NA. B. The percent misreporting for the top five most abundant species. The table shows the top five most abundant species and the misreporting percentage with the 95% confidence interval (CI). The graph shows the percentage as the point and the 95% CI as the range. All confidence intervals overlap, so there is no difference in misreporting percentage among the different species demonstrating no systematic bias.

Fig 3

Proportions of the total collected species, seller-reported species, and laboratory confirmed species.

The table shows the total number of species from which samples were collected, reported, or speciated and the proportion of the total that each species represents (Reported n = 151, Laboratory-confirmed n = 151) and the 95% confidence interval. The plot is the graphical representation of the percentage (as a proportion) of each species (the point) and the 95% CI (range). The total collected species are shown in gray, the seller-reported species in black and the laboratory-confirmed species in red.

Similar to the rate of mismatch of the most abundant species (Fig 2C), the overall misreporting of species from collected bushmeat samples was 30%. Despite this observation, there is no difference in the species proportions after molecular characterization (all p-values > 0.01, Fig 3) suggesting a lack of systematic bias or misreporting error (Fig 3). Fig 3A shows the number of each species as they were reported from the enumerators, for example 59 wildebeest, and the total proportion of each species of the total samples that were selected for molecular species identification, for example 39.1% (CI: 31.3–47.4) of the samples were wildebeest (59/151). Similar numbers are shown using the results from molecular characterization (Fig 3A). For example, of the total samples tested (n = 151), 58 or 38.4% (CI: 30.7–46.7) were identified through laboratory confirmation as wildebeest suggesting no significant difference between the seller-reported or the laboratory-confirmed proportions within each species since confidence intervals are overlapping (Fig 3B).

Discussion

Overall, approximately one third of the 151 bushmeat samples selected for laboratory-confirmation of species of origin were misidentified by the traditional methods of self-reporting. Although misreporting ranged from 20–47% (6.61–64.4) for the five most abundant species, these between species differences were not significant, suggesting that there is no predilection to misreporting one species over another. Several factors may contribute to the misreporting. Enumerators recruited and trained by project personnel recorded the species of bushmeat as reported by the seller, who may or may not have been the person who actually hunted the animal. Similarly, the seller might not actually know from which species the bushmeat was sourced or might have purposeful misreporting as a reaction to consumer preferences or differences in severity of penalties associated with the poaching of different species. For example, penalties for killing elephants (Loxodonta africana) are more severe than for impala [31]. Hunter preferences on where to hunt and what species to target could also influence reporting, and are in turn affected by consumer preference, threat of enforcement, severity of penalties, species abundance and proximity to the hunters’ home village [22, 31]. Interestingly, misreporting is significantly more during the dry season in comparison with the rainy season (S2 Table). This difference could be explained as during the dry season, the bushmeat is typically processed under the sun and as it gets dried, it makes it even more difficult to identify the origin.

Wildebeest was the most abundant species reported, and accounted for the most samples classified by seller-reported and molecular species identification. Since wildebeest are the most abundant ungulate in the Serengeti ecosystem, and thus heavily hunted, particularly when the migration is close to the villages surrounding the ecosystem, it is not surprising that this is the most common type of bushmeat sold in this area [3]. The misreporting of 20% (11.4–33.2) of wildebeest samples is perhaps a lower bound estimate of misreporting in this region given that it is an expected and regular source of bushmeat and may even be a preferred source of meat in this region [32]. Zebra, on the other hand, had the highest misreporting percentage (47%, 22.2–71.7), with 15 specimens reported as Zebra but only 9 confirmed as such (Fig 2). While this could simply be an artefact of the relatively small sample size as also reflected in the large confidence intervals, it may also suggest that zebra may be preferred as meat source by consumers in this region, or more susceptible to snaring than some species, or might fetch a higher price in local markets or face lower penalties or poaching than do other species, such as wildebeest (since 4 samples that speciated as wildebeest were reported as zebra; Fig 2). In the case of giraffe, the higher number of this species reported is surprising since these are the national animal symbol of Tanzania, and were seldom hunted in the ecosystem because of rumored harsh penalties [33]. However, during the past decade, there has been an increase in giraffe poaching in Serengeti, with snares set high in trees to deliberately target this large herbivorous species [33].

Unintentional misreporting of the species from the hunters to village sellers to the hands of consumer could further complicate the identification of the species. Bushmeat is presented in markets in small quantities, which make it difficult to differentiate the species from which it originated. In most cases, processed meat is more similar in appearance regardless of species, which may account for some of the misreporting if sellers are relying on morphological identification of the species [34]. Misreporting is likely a combination of lack of knowledge of the bushmeat species being sold and conscious misreporting, although the motivations for counterfeiting are not immediately clear from these data. Regardless of the reason, moderate concordance between reported species versus molecular species identification results in our study argues that validation of reported species is necessary to properly understand the dynamics of the bushmeat trade.

Accurate identification of the species being sold is particularly important for disease surveillance studies and for estimating offtake of threatened and declining species, such as the giraffe. From an ecological perspective, although the analysis was able to identify an overall relatively high (~30%) rate of misreporting of species, this is unlikely to contribute to major errors in estimations of species offtake, since the relative proportions of each species compared to the overall number of samples were not significantly different (Fig 3). However, further studies need to be conducted with larger sample sizes and specific sampling from other national parks and protected areas throughout Tanzania to confirm these findings and for more robust estimates of species offtake.

The overall ~30% misreporting rate however may potentially confound disease surveillance studies, since the species of origin in which pathogens are found plays an important role in understanding the risks of spillover and transmission dynamics associated with the pathogens. It is well documented that many zoonotic select agents, including B. anthracis, Brucella spp., and Coxiella are endemic in Tanzania, and in particular in ecosystems where wildlife, livestock, and humans live in proximity increasing the chances for spillover events to occur [35-39]. It is important to note that in the Serengeti, there are many Anthrax outbreaks that affect humans, livestock, and wildlife [37]. Studies have also shown that high-risk wildlife species that are also consumed as bushmeat including bats, rodents, and non-human primates are known to be reservoirs for viruses such as Ebola, Marburg, and Monkeypox [40-45]. Hence, misreporting bushmeat sources might considerably affect inferences and risk assessments during outbreak reporting and response [46, 47]. For instance, if a sample positive for a zoonotic pathogen is seller-reported as buffalo, but laboratory-confirmed as a zebra, this might confound both risk assessments and potential outbreak response. This is particularly relevant since the emergence and transmission of many zoonotic pathogens relies heavily on host factors and host-environment interactions, and hence the accurate identification of species in which the pathogens are present are important to understanding pathogen spillover risk and transmission dynamics [46]. In addition, since many different factors, such as environmental, ecological, and climatic differences, influence the emergence of infectious diseases and epidemiological modeling [46], accurate species identification is likely to help reduce variability caused by other confounding variables when parameterizing epidemiological models and conducting risk assessments by introducing bias, inaccurate estimates of power, and deceptive estimates of standard errors [48-50].

Limitations of this study include the small sample size for some of the minor species within the Serengeti ecosystem that precludes accurate assessments of overall misreporting risk. In addition, since the study was performed in only one ecosystem, it is unclear whether these observations can be extrapolated to other ecosystems or to the informal bushmeat markets in urban and peri-urban areas. Hence, future studies with larger sample sizes and expanding to other national parks and protected areas will provide a more robust assessment of seller-reported versus laboratory-confirmed species of origin of bushmeat in Tanzania. Finally, consideration for including consumer-preference data (which type of meat is preferred, if any), or costs of certain types of meat versus others, and any cultural or medicinal beliefs regarding the different species may help refine estimates of misreporting within the bushmeat supply chain.

Conclusion

Although our results were from only a single ecosystem in Tanzania, they provide compelling evidence of ~30% seller-misreporting of bushmeat species. Molecular species identification of a larger number of samples in multiple ecosystems and habitat types may provide more robust and generalizable variations in misreporting and preference of species. The results also show that molecular species identification of bushmeat samples using the CytB gene sequence is a valuable tool to assist biosurveillance measures aimed at understanding the human health risks associated with the illegal harvesting and consumption of bushmeat.

Pairwise comparison of misreporting percentages between the top 5 most abundant species.

This table corresponds to the data and proportions in Fig 2.

(DOCX)

Click here for additional data file.

Proportion of mismatched samples during the dry and rainy seasons.

Proportions were compared using a two-tailed Z Score analysis at a significance level of 0.05.

(DOCX)

Click here for additional data file.

27 Apr 2020

PONE-D-20-05756

Speciation of bushmeat recovered from the Serengeti ecosystem in Tanzania

PLOS ONE

Dear Dr Schilling,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Both reviewers agree that your study addresses an important subject, and is timely. However, there are also significant concerns about study design and analysis that need to be addressed.

We would appreciate receiving your revised manuscript by Jun 11 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Ulrike Gertrud Munderloh, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. In your Methods section, please provide additional location information of the sampling locations, including geographic coordinates for the data set if available.

3. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: .

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: No

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: This is a useful paper showing seller-perceived consumer preferences for illegal bushmeat based on misidentifications of covertly purchased bushmeat in Tanzania. I recommend this paper for publication after ra few fairly minor edits.

- Though the writing is generally of high quality, there is repeated misuse of the word 'speciation' too describe their labotratory identifications of the vertebrate species identified. Speciation refers to an evolutionary process. Therefore the authors should remove the word 'speciation' throughout the ms and replace it with molecular species identification, or something along these lines.

- In the abstract and a couple of times in the main text, common species names (e.g., wildebeest, zebra' are incorrectly capitalised.

- Line 36: Changer to "Based on these sequence analyses, 30% (96% CI:....) of bushmeat were misidentified by sellers"

- Though clear in the results section, it is not clear in the abstract (lines 38-40) whether misreporting statistics are of samples of other species misidentified as zebra or wildebeest or the reverse. Please clarify.

-Line 47: delete 'the' before 'proper'

-Line 61: Delete 'are' before 'processed'

-Lines 62-63L: "to satisfy consumer preferences"

-Line 66: Comm after 'generally'

-Line69: change to "...used to identify diverse species in studies..."

-Line 147: Replace 'using a' with 'by'

-Line 312: Delete 'the' before 'inferences'

Reviewer #2: Review of: Speciation of bushmeat recovered from the Serengeti ecosystem in Tanzania by MA Schilling et al. PLOS ONE.

This manuscript reports on a study to evaluate the levels and patterns of discordance between vendor reported and molecular genetic species identification of illegally harvested wildlife (bushmeat) in the Serengeti ecosystem of Tanzania. The motivation of the study was to evaluate the possible consequences of species misidentification for estimating harvest offtake rates and monitoring possible zoonotic disease transfer and outbreaks. While significant vendor misreporting was detected, the authors found no systematic pattern in species misidentification and concluded that harvest monitoring studies (based on market sampling) would likely be unbiased. The authors do conclude, however, that such misreporting may have serious consequences for wildlife and zoonotic disease monitoring and response. The study appears to be well conceived, but I have several concerns about the description of their basic methods, some of the analyses themselves, and the presentation of their results. I offer both major and minor comments, although several of my minor comments shouldn’t be taken lightly, in my opinion.

Major comments

Introduction. Authors do not provide a sense of the magnitude of the problem they are trying to address. Surely there are estimates of the quantity of bushmeat hunting, the degree of economic reliance or food-security contribution, the proportion of the population engaged in harvesting, transport and selling of wild game. How many villages constitute “most” (L54), what is the average number of hunters in a village? What are the market conditions in which bushmeat is sold? All or some of this information would provide the reader with a sense of the degree of risk of zoonotic disease transmission, which is stated as the primary motivation of this study. Some of this information might be better placed in the Methods-Study Area section, but providing some additional context and justification for these concerns is certainly relevant information for the introduction.

The authors do a better job making this justification in the discussion, but I think this motivation is missing in the introduction and should be included to some degree. There are many genetic papers on market species mis-identification, so a contribution related to disease transmission monitoring and response is a nice advance. From the introduction, however, this seems like a bit of a reach as there is very little offered in terms of motivation or details on the risks or history of zoonotic disease in the region. Some quantification of disease risk, rate or prevalence in wild or domestic populations, from the literature, would go a long way to further set up the rationale for this study in addition to the point above about harvest magnitude and dynamics. As it is now, I feel the authors have missed the chance to bring these 2 concepts together in the introduction to make a more impactful contribution to this literature.

L271, 298, 326, 330. The authors recognize the limitations of their inference based on small sample sizes and also mention the concern for inadequate statistical power (L323), but did not take the opportunity to conduct a power analysis themselves to estimate Type II error and determine necessary sample sizes for detecting desired effects (i.e., in risk assessment). This should be a straight-forward analysis and an important recommendation for the study to provide future researchers and resource managers.

Minor comments

L2 and elsewhere. Ok, I’ve done looked around in the literature and do see that the term ‘speciation’ or the verb ‘speciate’ have been used synchronously with ‘species identification’ but I can’t find anything authoritative (e.g., OED, Merriam Webster) on whether this is a correct usage. To me, speciation is an evolutionary process of taxon genesis rather than an observational process to distinguish among recognized species. I’ll grant that I may just be unfamiliar with the use of this term, but I’m guessing for the average ecologist, using in this way may add unnecessary ambiguity. For me the title suggested a focus on species radiation or investigation of cryptic lineages.

L27. While the manuscript title specified this work focuses on Tanzania, the abstract introduces what appear to be very general comments on bushmeat harvesting, risks of zoonotic disease, supply chains, etc. Unless the authors make these statements clearly in reference to Tanzania, they should avoid such phrases as ‘harvesting and selling of bushmeat is illegal’ because this is not true in all contexts. Other African (possibly Asian & L. American) countries allow some form of legal harvesting and selling of wild game, so caution must me taken in making such blanket statements. In L48 you add an additional caveat (proper permits) but this is not reflected in the abstract.

L63-66. Somewhat awkward phrasing with the mixing of disease detection, as the primary topic, and general conservation efforts. Suggest splitting or rephrasing.

L83. Is the fact that the Maasai don’t kill for food relevant here? Is there no risk of disease transfer (in either direction) between humans and lions (which they do hunt) that is worthy of mention?

L114, L173. What is meant by ‘processed’? The methods suggest all samples were processed in the sense of being butchered to a point where morphological features were not present. How does processed then differ from fresh and then from ‘dried’ (L124)? It wasn’t clear if by ‘dried’ the authors are referring to a function of how the collected samples were handled (i.e., silica beads) vs market condition. Please clarify your methods description to resolve these ambiguities.

L115. I understand the complications of working in African bushmeat markets, but since the primary unit of comparison with genetic species identification is that reported by the bushmeat seller, was a methodology developed, and were the sample collectors trained in how to systematically and unbiasedly elicit and record species identities in the markets? I’m not suggesting such bias exits in your data, but untrained observers can easily ask leading questions to vendors which could result in another species origin being proffered than what might have been stated. What was the protocol, for example, if one species identity was provided by a vendor but due to some morphological evidence (e.g., remaining fur, dentition, etc.) suggested an incorrect or questionable identification? Was the data collector permitted to question the identity and allow the vendor to re-identify the sample? If not permitted by the methodology, was their any attempt to evaluate whether leading questions were asked of the vendors? Reporting on how these verbal data were collected, given their basis for the subsequent analysis and conclusions, is equally if not more important than details of the cold chain process.

L157. Is a 95% similarity cutoff an appropriate measure for positive species identification? I think including some justification for this and/or a citation to other studies that have done similar. What is the distribution of sequence variability in cyt-b within and between recognized taxa? A suggestion to consider: it might be helpful to provide visual support (as well as quantified node support) for your species identification/misidentification by placing sequences in a phylogenetic tree.

L169-170. It might be helpful to provide the mean and range of samples per reported-species. Was there a minimum cutoff number of samples/reported species for species poorly represented in the market? Given that part of your analysis seems to be spatial, how many samples collected/analyzed per village location? The analyzed subset was selected based on species proportion in the collected sample, but how was the spatial distribution of these analyzed samples determined? Was it also somehow representative of the spatial distribution of the total samples collected? In L104-105, you describe recording sample collection locations but there is no description in the data analysis section of how these spatial points contribute to your analysis or findings. Generally, it is unclear the reasons for collecting the localities of sample collections and whether the spatial considerations are contributing to conclusions or inference gained.

L182 (Fig 1). There are far more blue than red dots in the figure. Are the red dots where no samples were mismatched? Just one mismatch at a location (NB: error on L183) results in a blue dot, but we don’t know what proportion of site-samples were mislabeled. More generally, do these patterns tell us anything about harvest or market dynamics?

L197-200. This is just a suggestion, but I would be curious if there is a way to test whether species reporting differed from a random assignment of species identity. Maybe a Mantel test or some sort of null-model (e.g., Ulrich & Gotelli 2012)? In addition to testing for possible bias, I think it might be interesting to evaluate how far off from just guessing meat vendors might be.

222-224. This is repetitious of what is reported earlier in results.

224-227. This is a bit confusing as written. Partly due to what appears to be a repeat of most of the table in Figure S1 and Fig 3A, with what seems to be a mistake in S1 (wildebeest, lab confirmed = 60, whereas = 58 in Fig 3A). If this is a mistake and the tables should be the same, what is the need for the repetition. If not a mistake, I am not following the difference between these tables.

L237 (Fig 3). At least for wildebeest, graph in Fig 3B appears to be backwards from the table 3A. Possibly from the confusion mentioned in previous comment?

General comment (results/discussion). Which of these species have greater national or international (e.g., CITES, IUCN) protection? I would hypothesize (a priori) that more regulated species might have been more commonly mis-identified by bushmeat sellers (i.e., possibly greater repercussions for identifying correctly). Since you do provide some hypotheses in the discussion along these lines, it might makes sense for you to include the conservation status of each species more systematically (e.g., in tabular form).

L264-265. Were there differences in wildebeest, or other species, reportings between seasons? Such information could be helpful in establishing a priori expectations for harvest composition. Since you mention this factor, you might consider reporting your observations to support this.

L272. “may be [a] preferred meat source”?

L311-312. What does “sampling must be representative of the…sample being investigated” mean?

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

5 Jul 2020

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

Done.

2. In your Methods section, please provide additional location information of the sampling locations, including geographic coordinates for the data set if available.

Due to the sensitivity associated with bushmeat hunting in Tanzania, specific coordinates are not provided. However, the general locations of sampling are identified in the methods section and indicated on the map in Figure 1.

3. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.

Done.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Partly

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: No

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: This is a useful paper showing seller-perceived consumer preferences for illegal bushmeat based on misidentifications of covertly purchased bushmeat in Tanzania. I recommend this paper for publication after ra few fairly minor edits.

- Though the writing is generally of high quality, there is repeated misuse of the word 'speciation' too describe their labotratory identifications of the vertebrate species identified. Speciation refers to an evolutionary process. Therefore the authors should remove the word 'speciation' throughout the ms and replace it with molecular species identification, or something along these lines.

- In the abstract and a couple of times in the main text, common species names (e.g., wildebeest, zebra' are incorrectly capitalised.

- Line 36: Changer to "Based on these sequence analyses, 30% (96% CI:....) of bushmeat were misidentified by sellers"

- Though clear in the results section, it is not clear in the abstract (lines 38-40) whether misreporting statistics are of samples of other species misidentified as zebra or wildebeest or the reverse. Please clarify.

-Line 47: delete 'the' before 'proper'

-Line 61: Delete 'are' before 'processed'

-Lines 62-63L: "to satisfy consumer preferences"

-Line 66: Comm after 'generally'

-Line69: change to "...used to identify diverse species in studies..."

-Line 147: Replace 'using a' with 'by'

-Line 312: Delete 'the' before 'inferences'

Response Reviewer 1: Thank you for your constructive comments and recommendation for publication. The authors appreciate your suggested edits and these have been included in the revised manuscript. The authors also thank you for highlighting the inappropriate use of the term speciation. This has now been changed to “molecular species identification” instead, as is now noted throughout the manuscript.

Reviewer #2: Review of: Speciation of bushmeat recovered from the Serengeti ecosystem in Tanzania by MA Schilling et al. PLOS ONE.

This manuscript reports on a study to evaluate the levels and patterns of discordance between vendor reported and molecular genetic species identification of illegally harvested wildlife (bushmeat) in the Serengeti ecosystem of Tanzania. The motivation of the study was to evaluate the possible consequences of species misidentification for estimating harvest offtake rates and monitoring possible zoonotic disease transfer and outbreaks. While significant vendor misreporting was detected, the authors found no systematic pattern in species misidentification and concluded that harvest monitoring studies (based on market sampling) would likely be unbiased. The authors do conclude, however, that such misreporting may have serious consequences for wildlife and zoonotic disease monitoring and response. The study appears to be well conceived, but I have several concerns about the description of their basic methods, some of the analyses themselves, and the presentation of their results. I offer both major and minor comments, although several of my minor comments shouldn’t be taken lightly, in my opinion.

Major comments

Introduction. Authors do not provide a sense of the magnitude of the problem they are trying to address. Surely there are estimates of the quantity of bushmeat hunting, the degree of economic reliance or food-security contribution, the proportion of the population engaged in harvesting, transport and selling of wild game. How many villages constitute “most” (L54), what is the average number of hunters in a village? What are the market conditions in which bushmeat is sold? All or some of this information would provide the reader with a sense of the degree of risk of zoonotic disease transmission, which is stated as the primary motivation of this study. Some of this information might be better placed in the Methods-Study Area section, but providing some additional context and justification for these concerns is certainly relevant information for the introduction.

The authors do a better job making this justification in the discussion, but I think this motivation is missing in the introduction and should be included to some degree. There are many genetic papers on market species mis-identification, so a contribution related to disease transmission monitoring and response is a nice advance. From the introduction, however, this seems like a bit of a reach as there is very little offered in terms of motivation or details on the risks or history of zoonotic disease in the region. Some quantification of disease risk, rate or prevalence in wild or domestic populations, from the literature, would go a long way to further set up the rationale for this study in addition to the point above about harvest magnitude and dynamics. As it is now, I feel the authors have missed the chance to bring these 2 concepts together in the introduction to make a more impactful contribution to this literature.

Response: Thank you for the suggestion to strengthen the introduction and better setting up our study by highlighting what is known regarding bushmeat hunting in Tanzania and risks of zoonotic disease in the region. This is now done, and the scope and scale of the problem is now better addressed in the first three paragraphs of the introduction. We anticipate and plan follow-on studies to directly estimate of the prevalence of major endemic zoonotic pathogens in bushmeat recovered from this region.

L271, 298, 326, 330. The authors recognize the limitations of their inference based on small sample sizes and also mention the concern for inadequate statistical power (L323), but did not take the opportunity to conduct a power analysis themselves to estimate Type II error and determine necessary sample sizes for detecting desired effects (i.e., in risk assessment). This should be a straight-forward analysis and an important recommendation for the study to provide future researchers and resource managers.

Response: Thank you for pointing this out. We have now done a power analysis to determine the target number of samples (see Lines 193-194 and 198-200). In brief using a significance level of 0.05, and an effect size of 0.25 we determined that a sample size of 208. We note that the current investigation represents formative research to use molecular tools to better assess species of bushmeat from opportunistic samples ascertained by a network of enumerators in the region. We agree that the results of our investigations provide and opportunity to inform future research and resource managers, and anticipate that forthcoming larger-scale, follow-on investigations of bushmeat in Tanzania in this regard.

Minor comments

L2 and elsewhere. Ok, I’ve done looked around in the literature and do see that the term ‘speciation’ or the verb ‘speciate’ have been used synchronously with ‘species identification’ but I can’t find anything authoritative (e.g., OED, Merriam Webster) on whether this is a correct usage. To me, speciation is an evolutionary process of taxon genesis rather than an observational process to distinguish among recognized species. I’ll grant that I may just be unfamiliar with the use of this term, but I’m guessing for the average ecologist, using in this way may add unnecessary ambiguity. For me the title suggested a focus on species radiation or investigation of cryptic lineages.

Response: Good point, we agree - and this was also raised by Reviewer 1. We now use the term “molecular species identification” to more accurately represent the use of DNA sequence information identity species of origin of bushmeat samples, and this is changed throughout the manuscript.

L27. While the manuscript title specified this work focuses on Tanzania, the abstract introduces what appear to be very general comments on bushmeat harvesting, risks of zoonotic disease, supply chains, etc. Unless the authors make these statements clearly in reference to Tanzania, they should avoid such phrases as ‘harvesting and selling of bushmeat is illegal’ because this is not true in all contexts. Other African (possibly Asian & L. American) countries allow some form of legal harvesting and selling of wild game, so caution must me taken in making such blanket statements. In L48 you add an additional caveat (proper permits) but this is not reflected in the abstract.

Response: Good point. Done. We have now clarified in the abstract and throughout the revised manuscript that the harvesting and selling of bushmeat is considered to be illegal in Tanzania and the possession of bushmeat requires numerous permits from various Government ministries as were obtained (through a long process) for our studies.

L63-66. Somewhat awkward phrasing with the mixing of disease detection, as the primary topic, and general conservation efforts. Suggest splitting or rephrasing.

Response: Agreed. We have separated these concepts to clarify. (Lines 63-66)

L83. Is the fact that the Maasai don’t kill for food relevant here? Is there no risk of disease transfer (in either direction) between humans and lions (which they do hunt) that is worthy of mention?

Response: Agreed. Thank you for pointing this out and we have removed this line from the manuscript.

L114, L173. What is meant by ‘processed’? The methods suggest all samples were processed in the sense of being butchered to a point where morphological features were not present. How does processed then differ from fresh and then from ‘dried’ (L124)? It wasn’t clear if by ‘dried’ the authors are referring to a function of how the collected samples were handled (i.e., silica beads) vs market condition. Please clarify your methods description to resolve these ambiguities.

Response: To better explain these differences, we have included further details in the Methods section (Lines 131-135). In brief, samples were considered ‘fresh’ if they did not appear to be treated in any way upon visual inspection at the time of collection. Samples were considered ‘processed’ if they appeared to be boiled, semi-boiled, highly salted, dried, or some combination of methods when purchased.

L115. I understand the complications of working in African bushmeat markets, but since the primary unit of comparison with genetic species identification is that reported by the bushmeat seller, was a methodology developed, and were the sample collectors trained in how to systematically and unbiasedly elicit and record species identities in the markets? I’m not suggesting such bias exits in your data, but untrained observers can easily ask leading questions to vendors which could result in another species origin being proffered than what might have been stated. What was the protocol, for example, if one species identity was provided by a vendor but due to some morphological evidence (e.g., remaining fur, dentition, etc.) suggested an incorrect or questionable identification? Was the data collector permitted to question the identity and allow the vendor to re-identify the sample? If not permitted by the methodology, was their any attempt to evaluate whether leading questions were asked of the vendors? Reporting on how these verbal data were collected, given their basis for the subsequent analysis and conclusions, is equally if not more important than details of the cold chain process.

Response: This was also a concern of ours. To mitigate potential for unintended bias in sample ascertainment but focus on whatever was available in the “market”, enumerators were instructed not to actively source any specific species, not to question what the sellers were stating, as well as to not divulge the purpose of obtaining the bushmeat. This is now better described in the methods (Lines 124-129).

L157. Is a 95% similarity cutoff an appropriate measure for positive species identification? I think including some justification for this and/or a citation to other studies that have done similar. What is the distribution of sequence variability in cyt-b within and between recognized taxa? A suggestion to consider: it might be helpful to provide visual support (as well as quantified node support) for your species identification/misidentification by placing sequences in a phylogenetic tree.

Response: Good point. Yes, 95% identity cut-off is indeed an appropriate and frequently used cut-off for positive species identification based on CytB gene. For instance {Schrago, Pearson, and Priorac have recently used this same cut-off, and this is now referred to in the MS (Ref #s 26-28). We did consider presenting the results as a phylogenetic tree – but given the number of taxa – the summary tables and heatmaps as presented appeared more informative and relevant.

L169-170. It might be helpful to provide the mean and range of samples per reported-species. Was there a minimum cutoff number of samples/reported species for species poorly represented in the market? Given that part of your analysis seems to be spatial, how many samples collected/analyzed per village location? The analyzed subset was selected based on species proportion in the collected sample, but how was the spatial distribution of these analyzed samples determined? Was it also somehow representative of the spatial distribution of the total samples collected? In L104-105, you describe recording sample collection locations but there is no description in the data analysis section of how these spatial points contribute to your analysis or findings. Generally, it is unclear the reasons for collecting the localities of sample collections and whether the spatial considerations are contributing to conclusions or inference gained.

Response: Done, The mean and range is now included in Figure 3. We used an opportunistic cross-sectional sampling approach in this study with a particular focus on the Serengeti ecosystem and did not attempt to achieve a minimum number of samples per species or category as this may have biased seller and enumerator behavior. We have also updated the map in Figure 1 to reflect the proportions of mismatched samples at each site. As can be noted, visual assessment does not suggest any evidence of biased spatial distribution in match / mismatch.

L182 (Fig 1). There are far more blue than red dots in the figure. Are the red dots where no samples were mismatched? Just one mismatch at a location (NB: error on L183) results in a blue dot, but we don’t know what proportion of site-samples were mislabeled. More generally, do these patterns tell us anything about harvest or market dynamics?

Response: Thank you for pointing this out. To better reflect the site sources for the matched vs mismatched samples, we have updated the map in Figure 1 to include proportions at each site. Additional data, well beyond the scope of the current investigations, needs to be collected as part of specifically designed future studies to derive meaningful conclusions regarding harvest or market dynamics and hence these are not presented herein.

L197-200. This is just a suggestion, but I would be curious if there is a way to test whether species reporting differed from a random assignment of species identity. Maybe a Mantel test or some sort of null-model (e.g., Ulrich & Gotelli 2012)? In addition to testing for possible bias, I think it might be interesting to evaluate how far off from just guessing meat vendors might be.

Response: Great suggestion. And indeed, we did earlier try as well and together with the statistician / ecologist on our team (IMC) revisited this matter. Unfortunately, the appropriate use of the Mantel or similar test best requires larger sample sizes in each strata to derive meaningful and robust estimates and hence was not applied in this context.

222-224. This is repetitious of what is reported earlier in results.

Response: Agree. We have better clarified this statement to avoid repetition (Line 253-254).

“Similar to the rate of mismatch of the most abundant species (Figure 2C), the overall misreporting of species from collected bushmeat samples was 30%”.

224-227. This is a bit confusing as written. Partly due to what appears to be a repeat of most of the table in Figure S1 and Fig 3A, with what seems to be a mistake in S1 (wildebeest, lab confirmed = 60, whereas = 58 in Fig 3A). If this is a mistake and the tables should be the same, what is the need for the repetition. If not a mistake, I am not following the difference between these tables.

Response: Thank you for pointing this out. This was an error which we have corrected. To simplify the data presentation, we have added the overall percentage to Figure 3 and removed the relevant data in the supplement.

L237 (Fig 3). At least for wildebeest, graph in Fig 3B appears to be backwards from the table 3A. Possibly from the confusion mentioned in previous comment?

Response: Good catch. This is now corrected.

General comment (results/discussion). Which of these species have greater national or international (e.g., CITES, IUCN) protection? I would hypothesize (a priori) that more regulated species might have been more commonly mis-identified by bushmeat sellers (i.e., possibly greater repercussions for identifying correctly). Since you do provide some hypotheses in the discussion along these lines, it might makes sense for you to include the conservation status of each species more systematically (e.g., in tabular form).

Response: Thank you, this is a great suggestion. We have now added this information in Figure 2C as well as the Results section (Lines 234-235).

L264-265. Were there differences in wildebeest, or other species, reporting between seasons? Such information could be helpful in establishing a priori expectations for harvest composition. Since you mention this factor, you might consider reporting your observations to support this.

Response: Thank you for this suggestion. We have now added an additional supplemental table to present this analysis.

L272. “may be [a] preferred meat source”?

Response: Done.

L311-312. What does “sampling must be representative of the…sample being investigated” mean?

Response: We have changed phrasing (Lines 339-343).

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

In compliance with data protection regulations, you may request that we remove your personal registration details at any time. (Remove my information/details). Please contact the publication office if you have any questions.

Submitted filename: Response to Reviewers 2.docx

Click here for additional data file.

30 Jul 2020

Molecular species identification of bushmeat recovered from the Serengeti ecosystem in Tanzania

PONE-D-20-05756R1

Dear Dr. Schilling,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Ulrike Gertrud Munderloh, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

3 Sep 2020

PONE-D-20-05756R1

Molecular species identification of bushmeat recovered from the Serengeti ecosystem in Tanzania

Dear Dr. Schilling:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Ulrike Gertrud Munderloh

Academic Editor

PLOS ONE