Literature DB >> 32863763

Circular RNA circ_0000517 regulates hepatocellular carcinoma development via miR-326/IGF1R axis.

Shuwei He1, Jianzeng Yang1, Shitao Jiang1, Yuan Li1, Xingmin Han1.   

Abstract

BACKGROUND: Circular RNAs (circRNAs) play vital roles in hepatocellular carcinoma development. However, the role and mechanism of circRNA hsa_circ_0000517 (circ_0000517) in hepatocellular carcinoma development were largely unknown.
METHODS: 45 paired tumor and adjacent nontumor samples were collected from hepatocellular carcinoma patients. The levels of circ_0000517, miR-326 and insulin-like growth factor type 1 receptor (IGF1R) were detected via quantitative reverse transcription polymerase chain reaction or western blot. Cell viability, colony ability, migration, invasion and glycolysis were assessed via 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), colony formation, western blot, transwell assay, glucose consumption, lactate production or adenosine triphosphate (ATP) production. The target correlation between miR-326 and circ_0000517 or IGF1R was analyzed via dual-luciferase reporter analysis. The function of circ_0000517 in vivo was assessed via xenograft model.
RESULTS: circ_0000517 expression was elevated in hepatocellular carcinoma tissues and cell lines. circ_0000517 knockdown suppressed cell viability, colony formation, migration, invasion and glycolysis. miR-326 was sponged via circ_0000517 and miR-326 knockdown reversed the effect of circ_0000517 silence on hepatocellular carcinoma development. miR-326 overexpression inhibited hepatocellular carcinoma development through targeting IGF1R. circ_0000517 knockdown decreased IGF1R expression by modulating miR-326. circ_0000517 downregulation reduced xenograft tumor growth.
CONCLUSION: circ_0000517 knockdown repressed hepatocellular carcinoma development in vitro and in vivo by modulating miR-326 and IGF1R.
© The Author(s) 2020.

Entities:  

Keywords:  Hepatocellular carcinoma; IGF1R; circ_0000517; miR-326

Year:  2020        PMID: 32863763      PMCID: PMC7448484          DOI: 10.1186/s12935-020-01496-1

Source DB:  PubMed          Journal:  Cancer Cell Int        ISSN: 1475-2867            Impact factor:   5.722


Background

Liver cancer is one of the main causes of cancer-associated death with rising incidence and mortality [1]. Hepatocellular carcinoma accounts for majority of liver cancer [2]. Improvements have been gained in prevention and management of hepatocellular carcinoma [3]. Nevertheless, some patients have poor prognosis. To improve the treatment and prognosis of hepatocellular carcinoma, the mechanism modulating the progression of hepatocellular carcinoma is sorely wanted. Circular RNAs (circRNAs) are a group of noncoding RNAs generated via covalently linking the 5′ cap and 3′ end [4]. Many circRNAs are ubiquitously expressed in eukaryotes [5]. Moreover, circRNAs play essential roles in development and treatment of cancers [6]. The emerging evidence demonstrates that circRNAs have pivotal roles in diagnosis and therapy of hepatocellular carcinoma [7]. A previous study analyzes the expression of many circRNAs using two hepatocellular carcinoma-associated databases (GSE97332 and GSE94508), and finds circRNA hsa_circ_0000517 (circ_0000517) is the only one circRNA up-regulated in hepatocellular carcinoma in both databases [8]. However, the exact function and mechanism of circ_0000517 in hepatocellular carcinoma development remain poorly understood. CircRNAs could take part in the regulation of cancer development via functioning as competing endogenous RNAs (ceRNAs) for microRNAs (miRNAs) to affect the stability of targeted genes [9]. miRNAs are a group of small noncoding RNAs which are implicated in hepatocellular carcinoma development [10]. miR-326 is one of lowly expressed miRNAs and associated with patients’ outcomes in hepatocellular carcinoma [11]. Moreover, miR-326 could inhibit hepatocellular tumorigenesis [12]. However, whether miR-326 is required for circ_0000517-mediated mechanism is unclear. In addition, insulin-like growth factor system is reported to participate in liver disorders [13]. Insulin-like growth factor type 1 receptor (IGF1R) is a member of insulin-like growth factor system, which is aberrantly expressed in hepatocellular carcinoma [14]. Furthermore, accruing studies suggest IGF1R plays an oncogenic role in hepatocellular carcinoma [15, 16]. Besides, the bioinformatics analysis predicts that miR-326 might bind with circ_0000517 and IGF1R. Therefore, we hypothesized circ_0000517 could serve as a ceRNA for miR-326 to target IGF1R to be involved in hepatocellular carcinoma development. In this research, we investigated the effect of circ_0000517 on hepatocellular carcinoma development in vitro and in vivo. Furthermore, we analyzed the ceRNA network of circ_0000517/miR-326/IGF1R.

Materials and methods

Patients and tissues

45 patients with hepatocellular carcinoma were recruited from The First Affiliated Hospital of Zhengzhou University, and they all did not receive other therapy before tissues collection. The tumor and adjacent nontumor tissues were harvested and stored at − 80 °C. This research was permitted via the Ethics Committee of The First Affiliated Hospital of Zhengzhou University, and written informed consent was obtained from all subjects.

Cell culture

Normal liver cell line THLE-2 and hepatocellular carcinoma cell lines HCCLM3 and Huh7 were provided via BeNa Culture Collection (Beijing, China) and maintained in Dulbecco’s Modified Eagle Medium (Thermo Fisher, Waltham, MA, USA) plus 10% fetal bovine serum (Gibco, Gran Island, NY, USA) and 1% antibiotic (Thermo Fisher) in 5% CO2 at 37 °C.

RNA extraction and quantitative reverse transcription polymerase chain reaction (qRT-PCR)

Tissues or cells were lysed using Trizol reagent (Thermo Fisher) and were used for RNA extraction. For circRNA extraction, the obtained RNA was further incubated with RNase R (GeneSeed, Guangzhou, China) following instructions of manufacturer. The RNA was reversely transcribed to cDNA with specific reverse transcription kit (Thermo Fisher). The cDNA together with SYBR Green (Solarbio, Beijing, China) and specific primers (Sangon, Shanghai, China) was used for qRT-PCR. The primers included: circ_0000517 (sense, 5′-GGGAGGTGAGTTCCCAGAG-3′; antisense, 5′-CAGGGAGAGCCCTGTTAGG-3′), IGF1R (sense, 5′-AGTATGGAGGGGCCAAGCTA-3′; antisense, 5′-CTTTTGGCCTGGACATAGAAGA-3′), miR-326 (sense, 5′-CATCTGTCTGTTGGGCTGGA-3′; antisense, 5′-AGGAAGGGCCCAGAGGCG-3′), U6 (sense, 5′-CTCGCTTCGGCAGCACA-3′; antisense, AACGCTTCACGAATTTGCGT), and GAPDH (sense, 5′-CATGAGAAGTATGACAACAGCCT-3′; antisense, 5′-AGTCCTTCCACGATACCAAAGT-3′). GAPDH or U6 was used as reference. Relative RNA level was calculated through 2−ΔΔCt method [17].

Cell transfection

IGF1R overexpression vector was generated through inserting the sequence of IGF1R into pcDNA3.1 vector. The pcDNA3.1 vector (Thermo Fisher) served as negative control (pcDNA). siRNA for circ_0000517 (si-circ_0000517#1, 5′-GGCUCCGCGCGAGGUCUGAGA-3′; si-circ_0000517#2, 5′-UCCGCGCGAGGUCUGAGACUA-3′; si-circ_0000517#3, 5′-GGGCUCCGCGCGAGGUCUGAG-3′), negative control of siRNA (si-NC, 5′-AACAGUCGCGUUUGCGACUGG-3′), miR-326 mimic (5′-CCUCUGGGCCCUUCCUCCAG-3′), mimic negative control (miR-NC, 5′-CGAUCGCAUCAGCAUCGAUUGC-3′), miR-326 inhibitor (anti-miR-326, 5′-CUGGAGGAAGGGCCCAGAGG-3′), and inhibitor negative control (anti-NC, 5′-CUAACGCAUGCACAGUCGUACG-3′) were synthesized by Ribobio (Guangzhou, China). Transfection was conducted in HCCLM3 and Huh7 cells with above vectors or oligonucleotides through Lipofectamine 2000 (Thermo Fisher) for 24 h.

3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and colony formation assay

MTT method was employed for analysis of cell viability. HCCLM3 and Huh7 cells (5 × 103 cells/well) were added into 96-well plates and incubated for 0, 24, 48 or 72 h. At each time point, 10 μL MTT (Solarbio) with final concentrations of 0.5 mg/mL was added. Next, cells were maintained for 4 h. Subsequently, the medium was changed to 100 μL dimethyl sulfoxide (Solarbio). Then the optical density (OD) value at 490 nm was examined through microplate reader (Bio-Gene Technology, Guangzhou, China). For colony formation assay, 1 × 103 HCCLM3 and Huh7 cells were placed into 6-well plates and maintained for 10 days. Next, cells were fixed via 4% paraformaldehyde (Solarbio) and dyed with 0.5% crystal violet (Solarbio). The colonies were photographed and counted under microscope (Nikon, Tokyo, Japan).

Western blot

Protein was extracted via RIPA lysis buffer (Solarbio), and sample concentration was examined through BCA kit (Solarbio). Equal amounts of proteins were subjected to sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transfer of nitrocellulose membranes (Solarbio). The membranes were blocked with 5% fat-free milk. Subsequently, the blocked membranes were interacted with primary and secondary antibodies. The antibodies included anti-Ki67 (AF0198, 1:1000 dilution, Affinity Biosciences, Changzhou, China), anti-proliferating cell nuclear antigen (PCNA) (ab152112, 1:3000 dilution, Abcam, Cambridge, MA, USA), anti-E-cadherin (ab15148, 1:300 dilution, Abcam), anti-Vimentin (ab137321, 1:2000 dilution, Abcam), anti-lactate dehydrogenase A (LDHA) (ab125683, 1:3000 dilution, Abcam), anti-hexokinase II (HK2) (ab227198, 1:3000 dilution, Abcam) and anti-IGF1R (ab131476, 1:100 dilution, Abcam). β-actin (ab8227, 1:5000 dilution, Abcam) was used as reference, and IgG conjugated via horseradish peroxidase (ab97051, 1:10,000 dilution, Abcam) served as secondary antibody. Next, the membranes were exposed to ECL kit (Solarbio). The protein signaling was assessed using Quantity One software (Bio-Rad, Hercules, CA, USA).

Transwell analysis

Cell migration and invasion were measured through transwell analysis using 24-well transwell chambers (Corning, Corning, NY, USA). The procedures of migration and invasion were similar, but the chambers were coated with Matrigel (BD Bioscience, San Jose, CA, USA) for invasion assay. HCCLM3 and Huh7 cells (1 × 104 cells/well) in non-serum medium were seeded into upper chambers, while 500 μL medium with 10% serum was injected into the lower chambers. After culture for 20 h, cells passed the membranes were dyed with 0.5% crystal violet. The number of migrated or invasive cells was analyzed under microscope with three random fields.

Glucose consumption, lactate production and adenosine triphosphate (ATP) production

HCCLM3 and Huh7 cells (4 × 104 cells/well) were placed into 24-well plates, and cultured for 72 h. Next, the culture supernatants were collected for detection of glucose consumption, lactate production and ATP production using Glucose Uptake Assay Kit (Abcam), Lactate Assay Kit (Abcam) or ATP Assay Kit (Abcam) according to the protocols of manufacturer. The relative level of glucose consumption, lactate production or ATP production was normalized to total protein concentration and control group.

Dual-luciferase reporter analysis

The target correlation between circ_0000517 and miR-326 or between miR-326 and IGF1R was predicted via circBank (http://www.circbank.cn/), circinteractome (https://circinteractome.nia.nih.gov/) or starBase (http://starbase.sysu.edu.cn/). The wild-type luciferase reporter plasmids (circ_0000517-WT and IGF1R 3′UTR-WT) and their mutants (circ_0000517-MUT and IGF1R 3′UTR-MUT) were generated through inserting the wild-type or mutant-type sequence of circ_0000517 or IGF1R 3′UTR containing miR-326 complementary sites within psiCHECK-2 (Promega, Madison, WI, USA), respectively. The constructed luciferase reporter plasmids were co-transfected with miR-326 mimic or miR-NC into HCCLM3 and Huh7 cells. The luciferase activity was analyzed via dual-luciferase analysis system (Promega) after 24 h.

Xenograft model

12 BALB/c nude mice (male, 4-week-old) were provided via Shanghai SLAC Laboratory Animal Co., Ltd. (Shanghai, China). The lentiviral vector of shRNA for circ_0000517 (sh-circ_0000517) and its negative control (sh-NC) were produced via GenePharma (Shanghai, China), and then transduced into Huh7 cells. Huh7 cells (4 × 106 cells/mouse) with stable transfection of sh-circ_0000517 or sh-NC were subcutaneously injected into the left flank of nude mice, and the mice were classified as sh-circ_0000517 or sh-NC group (n = 6/group) after corresponding inoculation. The size of the formed tumors was measured every 7 days and the volume was analyzed with the formula: 0.5 × length × width2. 28 days after cell injection, mice were killed via cervical dislocation. All generated tumors were harvested for weight and further molecular analyses. The current experiments had procured the permission of the Animal Ethical Committee of The First Affiliated Hospital of Zhengzhou University.

Statistical analysis

The experiments were conducted 3 times. Statistical analysis was processed via GraphPad Prism 7 (GraphPad, La Jolla, CA, USA). Data were validated to meet normal distribution with equal variances. The data were shown as mean ± SD. The difference was compared through Student’s t-test or ANOVA with Tukey post hoc test. The linear correlation among circ_0000517, miR-326 and IGF1R was assessed via Pearson’s test. P < 0.05 indicated the significant difference.

Results

circ_0000517 expression is increased in hepatocellular carcinoma

To explore circ_0000517 level in hepatocellular carcinoma, 45 pair of tumor and adjacent nontumor tissues were collected. The result of qRT-PCR displayed that circ_0000517 level was higher in tumor than adjacent nontumor tissues (P < 0.05) (Fig. 1a). Furthermore, circ_0000517 level was detected in hepatocellular carcinoma cell lines. Compared with that in THLE-2 cells, circ_0000517 expression was markedly enhanced in HCCLM3 and Huh7 cells (Fig. 1b). These data indicated that dysregulated circ_0000517 was associated with hepatocellular carcinoma progression.
Fig. 1

circ_0000517 expression in hepatocellular carcinoma. a circ_0000517 expression was measured in tumor and adjacent nontumor tissues from patients with hepatocellular carcinoma via qRT-PCR. n = 45. b circ_0000517 level was examined in hepatocellular carcinoma cell lines HCCLM3 and Huh7 and normal liver cell line THLE-2 via qRT-PCR. *P < 0.05

circ_0000517 expression in hepatocellular carcinoma. a circ_0000517 expression was measured in tumor and adjacent nontumor tissues from patients with hepatocellular carcinoma via qRT-PCR. n = 45. b circ_0000517 level was examined in hepatocellular carcinoma cell lines HCCLM3 and Huh7 and normal liver cell line THLE-2 via qRT-PCR. *P < 0.05

circ_0000517 knockdown inhibits cell viability, colony formation, migration, invasion and glycolysis in hepatocellular carcinoma cells

To explore the role of circ_0000517 in hepatocellular carcinoma, circ_0000517 expression was knocked down in HCCLM3 and Huh7 cells. The 3 siRNAs targeting circ_0000517 (si-circ_0000517#1, #2 and #3) induced more than 50% reduction in circ_0000517 level, and si-circ_0000517#3 with highest efficacy was used for further experiments (Fig. 2a). MTT assay showed that circ_0000517 knockdown remarkably decreased the viability of HCCLM3 and Huh7 cells at 24, 48 or 72 h (Fig. 2b, c). Moreover, circ_0000517 downregulation obviously suppressed colony formation ability in the two cell lines (Fig. 2d). Meanwhile, the viability-associated with markers Ki67 and PCNA were measured. Silence of circ_0000517 significantly reduced the expression of these two proteins (Fig. 2e, Additional file 1: Figure S1A). In addition, interference of circ_0000517 suppressed migration and invasion of HCCLM3 and Huh7 cells (Fig. 2f, g). Furthermore, knockdown of circ_0000517 repressed epithelial-mesenchymal transition (EMT), revealed via increase of E-cadherin and decrease of Vimentin, which also indicated the inhibition of migration and invasion (Fig. 2h, Additional file 1: Figure S1B). Besides, inhibition of circ_0000517 evidently suppressed glycolysis, revealed via suppression of glucose consumption, lactate production, ATP production and protein levels of LDHA and HK2 (Fig. 2i–l, Additional file 1: Figure S1C). These results suggested that circ_0000517 knockdown could repress hepatocellular carcinoma progression in vitro.
Fig. 2

Effect of circ_0000517 knockdown on hepatocellular carcinoma progression. a circ_0000517 expression was examined in HCCLM3 and Huh7 cells with transfection of si-circ_0000517#1, #2, #3 or si-NC. Cell viability (b, c), colony formation (d), Ki67 and PCNA protein levels (e), migration (f), invasion (g), E-cadherin and Vimentin protein levels (h), glucose consumption (i), lactate production (j), ATP production (k), and LDHA and HK2 protein levels (l) were detected in HCCLM3 and Huh7 cells transfected with si-circ_0000517#3 or si-NC. *P < 0.05

Effect of circ_0000517 knockdown on hepatocellular carcinoma progression. a circ_0000517 expression was examined in HCCLM3 and Huh7 cells with transfection of si-circ_0000517#1, #2, #3 or si-NC. Cell viability (b, c), colony formation (d), Ki67 and PCNA protein levels (e), migration (f), invasion (g), E-cadherin and Vimentin protein levels (h), glucose consumption (i), lactate production (j), ATP production (k), and LDHA and HK2 protein levels (l) were detected in HCCLM3 and Huh7 cells transfected with si-circ_0000517#3 or si-NC. *P < 0.05

circ_0000517 is a sponge for miR-326

miR-326 and miR-1296-5p were predicted as targets of circ_0000517 via circInteractome, circBank and StarBase (Fig. 3a). Moreover, miR-326 abundance was upregulated by circ_0000517 knockdown in HCCLM3 and Huh7 cells, and the expression change of miR-326 was more significant than miR-1296-5p (Fig. 3b, c). Hence, miR-326 was selected for further experiments. The binding sites of circ_0000517 and miR-326 were shown in Fig. 3d. Furthermore, dual-luciferase reporter analysis was conducted to validate this interaction. miR-326 overexpression reduced over 60% of luciferase activity in circ_0000517-WT group, but it could not alter the luciferase activity in circ_0000517-MUT group (Fig. 3e, f). Additionally, miR-326 abundance was evidently declined in hepatocellular carcinoma tumor tissues and cell lines in comparison to adjacent nontumor tissues or THLE-2 cells (Fig. 3g, h). Besides, miR-326 level in hepatocellular carcinoma tissues was negatively associated with circ_0000517 level (r = − 0.525, P = 0.0002) (Fig. 3i). These results indicated that miR-326 was a target of circ_0000517 in hepatocellular carcinoma.
Fig. 3

The relationship between circ_0000517 and miR-326. a The targets of circ_0000517 were analyzed via circBank, StarBase and circinteractome. b, c miR-1296 and miR-326 levels were detected in HCCLM3, Huh7 and THLE-2 cells with transfection of si-circ_0000517#3 or si-NC. d The binding site of circ_0000517 and miR-326. e, f Luciferase activity was examined in HCCLM3 and Huh7 cells transfected with circ_0000517-WT or circ_0000517-MUT and miR-326 mimic or miR-NC. g miR-326 expression was measured in tumor and adjacent nontumor tissues from patients with hepatocellular carcinoma. h miR-326 level was examined in HCCLM3, Huh7 and THLE-2 cells. i The relationship between miR-326 and circ_0000517 levels in hepatocellular carcinoma tissues. *P < 0.05

The relationship between circ_0000517 and miR-326. a The targets of circ_0000517 were analyzed via circBank, StarBase and circinteractome. b, c miR-1296 and miR-326 levels were detected in HCCLM3, Huh7 and THLE-2 cells with transfection of si-circ_0000517#3 or si-NC. d The binding site of circ_0000517 and miR-326. e, f Luciferase activity was examined in HCCLM3 and Huh7 cells transfected with circ_0000517-WT or circ_0000517-MUT and miR-326 mimic or miR-NC. g miR-326 expression was measured in tumor and adjacent nontumor tissues from patients with hepatocellular carcinoma. h miR-326 level was examined in HCCLM3, Huh7 and THLE-2 cells. i The relationship between miR-326 and circ_0000517 levels in hepatocellular carcinoma tissues. *P < 0.05

miR-326 knockdown reverses effect of circ_0000517 silence on cell viability, colony formation, migration, invasion and glycolysis in hepatocellular carcinoma cells

To probe if miR-326 was required for circ_0000517-mediated hepatocellular carcinoma development, HCCLM3 and Huh7 cells were transfected with si-NC, si-circ_0000517#3, si-circ_0000517#3 + anti-miR-326 or anti-NC. The efficacy of anti-miR-326 was identified in Fig. 4a. In addition, downregulation of miR-326 attenuated the suppressive effect of circ_0000517 silence on cell viability, colony formation, migration, invasion and glycolysis in HCCLM3 and Huh7 cells (Fig. 4b–l, Additional file 2: Figure S2A–C). Taken together, circ_0000517 knockdown inhibited hepatocellular carcinoma progression via increasing miR-326.
Fig. 4

Effect of miR-326 down-regulation on silence of circ_0000517-mediated hepatocellular carcinoma progression. a miR-326 abundance was examined in HCCLM3 and Huh7 cells transfected with anti-miR-326 or anti-NC. Cell viability (b, c), colony formation (d), Ki67 and PCNA protein levels (e), migration (f), invasion (g), E-cadherin and Vimentin protein levels (h), glucose consumption (i), lactate production (j), ATP production (k), and LDHA and HK2 protein expression (l) were measured in HCCLM3 and Huh7 cells transfected with si-NC, si-circ_0000517#3, si-circ_0000517#3 + anti-miR-326 or anti-NC. *P < 0.05

Effect of miR-326 down-regulation on silence of circ_0000517-mediated hepatocellular carcinoma progression. a miR-326 abundance was examined in HCCLM3 and Huh7 cells transfected with anti-miR-326 or anti-NC. Cell viability (b, c), colony formation (d), Ki67 and PCNA protein levels (e), migration (f), invasion (g), E-cadherin and Vimentin protein levels (h), glucose consumption (i), lactate production (j), ATP production (k), and LDHA and HK2 protein expression (l) were measured in HCCLM3 and Huh7 cells transfected with si-NC, si-circ_0000517#3, si-circ_0000517#3 + anti-miR-326 or anti-NC. *P < 0.05

IGF1R is targeted via miR-326

starBase predicted 10 targets of miR-326 including IGF1R, and the effect of miR-326 on their levels was assessed in HCCLM3 cells. IGF1R was the only down-regulated target (Fig. 5a), which was selected for further experiments. The complementary sequence of miR-326 and IGF1R was displayed in Fig. 5b. To confirm the correlation between miR-326 and IGF1R, we constructed IGF1R 3′UTR-WT and IGF1R 3′UTR-MUT, and found that miR-326 overexpression induced more than 50% loss of luciferase activity in IGF1R 3′UTR-WT group, but it did not affect the activity in IGF1R 3′UTR-MUT group (Fig. 5c, d). Moreover, IGF1R expression was decreased via miR-326 overexpression (Fig. 5e, f). In addition, IGF1R mRNA and protein abundances were markedly elevated in hepatocellular carcinoma tissues and cell lines compared with adjacent nontumor tissues or THLE-2 cells (Fig. 5g–j). Besides, IGF1R expression in hepatocellular carcinoma tissues was negatively associated with miR-326 level (r = − 0.496, P = 0.0012) and positively correlated with circ_0000517 (r = 0.735, P < 0.0001) (Fig. 5k). These data suggested that IGF1R was targeted via miR-326 in hepatocellular carcinoma cells.
Fig. 5

The interaction between miR-326 and IGF1R. a The effect of miR-326 on the 10 targets levels was measured in HCCLM3 cells. b The binding sequence of miR-326 and IGF1R. (c, d) Luciferase activity was examined in HCCLM3 and Huh7 cells transfected with IGF1R 3′UTR-WT or IGF1R 3′UTR-MUT and miR-326 mimic or miR-NC. e, f IGF1R expression was measured in HCCLM3 and Huh7 cells with transfection of miR-326 mimic or miR-NC. g, h IGF1R expression was measured in tumor and adjacent nontumor tissues from patients with hepatocellular carcinoma. n = 3. i, j IGF1R level was examined in HCCLM3, Huh7 and THLE-2 cells. k The relationship between IGF1R and miR-326 or circ_0000517 levels in hepatocellular carcinoma tissues. *P < 0.05

The interaction between miR-326 and IGF1R. a The effect of miR-326 on the 10 targets levels was measured in HCCLM3 cells. b The binding sequence of miR-326 and IGF1R. (c, d) Luciferase activity was examined in HCCLM3 and Huh7 cells transfected with IGF1R 3′UTR-WT or IGF1R 3′UTR-MUT and miR-326 mimic or miR-NC. e, f IGF1R expression was measured in HCCLM3 and Huh7 cells with transfection of miR-326 mimic or miR-NC. g, h IGF1R expression was measured in tumor and adjacent nontumor tissues from patients with hepatocellular carcinoma. n = 3. i, j IGF1R level was examined in HCCLM3, Huh7 and THLE-2 cells. k The relationship between IGF1R and miR-326 or circ_0000517 levels in hepatocellular carcinoma tissues. *P < 0.05

miR-326 overexpression represses cell viability, colony formation, migration, invasion and glycolysis via targeting IGF1R in hepatocellular carcinoma cells

To analyze the function of miR-326 in hepatocellular carcinoma development and whether it required IGF1R, HCCLM3 and Huh7 cells were transfected with miR-NC, miR-326 mimic, miR-326 mimic + pcDNA or IGF1R overexpression vector. The transfection of IGF1R overexpression vector effectively upregulated IGF1R abundance (Fig. 6a, b). In addition, miR-326 overexpression obviously suppressed cell viability, colony formation, migration, invasion and glycolysis in HCCLM3 and Huh7 cells (Fig. 6c–m, Additional file 3: Figure S3 A–C). Nevertheless, upregulation of IGF1R alleviated the effect of miR-326 on these events (Fig. 6c–m, Additional file 3: Figure S3A–C). These results indicated that miR-326 overexpression suppressed hepatocellular carcinoma progression via decreasing IGF1R.
Fig. 6

Effect of miR-326 and IGF1R on hepatocellular carcinoma progression. a, b IGF1R expression was examined in HCCLM3 and Huh7 cells transfected with IGF1R overexpression vector or pcDNA. Cell viability (c, d), colony formation (e), Ki67 and PCNA protein levels (f), migration (g), invasion (h), E-cadherin and Vimentin protein levels (i), glucose consumption (j), lactate production (k), ATP production (l), and LDHA and HK2 protein levels (m) were examined in HCCLM3 and Huh7 cells transfected with miR-NC, miR-326 mimic, miR-326 mimic + pcDNA or IGF1R overexpression vector. *P < 0.05

Effect of miR-326 and IGF1R on hepatocellular carcinoma progression. a, b IGF1R expression was examined in HCCLM3 and Huh7 cells transfected with IGF1R overexpression vector or pcDNA. Cell viability (c, d), colony formation (e), Ki67 and PCNA protein levels (f), migration (g), invasion (h), E-cadherin and Vimentin protein levels (i), glucose consumption (j), lactate production (k), ATP production (l), and LDHA and HK2 protein levels (m) were examined in HCCLM3 and Huh7 cells transfected with miR-NC, miR-326 mimic, miR-326 mimic + pcDNA or IGF1R overexpression vector. *P < 0.05

circ_0000517 knockdown reduces IGF1R expression by miR-326

To analyze the effect of circ_0000517 on IGF1R, HCCLM3 and Huh7 cells were transfected with si-NC, si-circ_0000517#3, si-circ_0000517#3 + anti-miR-326 or anti-NC. As displayed in Fig. 7a, b, IGF1R mRNA and protein abundances were evidently declined via silence of circ_0000517, which was restored via miR-326 inhibition. These data suggested that circ_0000517 could regulate IGF1R via sponging miR-326.
Fig. 7

Effect of circ_0000517 and miR-326 on IGF1R expression in hepatocellular carcinoma cells. a, b IGF1R expression was detected in HCCLM3 and Huh7 cells transfected with si-NC, si-circ_0000517#3, si-circ_0000517#3 + anti-miR-326 or anti-NC. *P < 0.05

Effect of circ_0000517 and miR-326 on IGF1R expression in hepatocellular carcinoma cells. a, b IGF1R expression was detected in HCCLM3 and Huh7 cells transfected with si-NC, si-circ_0000517#3, si-circ_0000517#3 + anti-miR-326 or anti-NC. *P < 0.05

circ_0000517 knockdown reduces xenograft tumor growth

To explore the function of circ_0000517 in hepatocellular carcinoma in vivo, Huh7 cells with stable transfection of sh-circ_0000517 or sh-NC were subcutaneously injected into nude mice to induce xenograft model. After 28 days, the tumor volume and weight were obviously declined in sh-circ_0000517 group in comparison to sh-NC group (Fig. 8a, b). Additionally, circ_0000517 and IGF1R levels were markedly decreased and miR-326 expression was enhanced in sh-circ_0000517 group compared with sh-NC group (Fig. 8c–e). These results indicated the tumor-suppressive role of circ_0000517 silence in hepatocellular carcinoma in vivo.
Fig. 8

Effect of circ_0000517 on xenograft tumor growth. Huh7 cells stably transfected with sh-circ_0000517 or sh-NC were used to establish subcutaneous xenograft model (n = 6 per group). a Tumor volume was detected every week. b Tumor weight was detected in sh-circ_0000517 or sh-NC group. c circ_0000517 and miR-326 expression, and (d, e) IGF1R expression were examined in sh-circ_0000517 or sh-NC group. n = 6. *P < 0.05

Effect of circ_0000517 on xenograft tumor growth. Huh7 cells stably transfected with sh-circ_0000517 or sh-NC were used to establish subcutaneous xenograft model (n = 6 per group). a Tumor volume was detected every week. b Tumor weight was detected in sh-circ_0000517 or sh-NC group. c circ_0000517 and miR-326 expression, and (d, e) IGF1R expression were examined in sh-circ_0000517 or sh-NC group. n = 6. *P < 0.05

Discussion

Hepatocellular carcinoma represents about 90% cases of liver cancer [18]. Great advance has been gained in causes, pathways and therapy of hepatocellular carcinoma in recent years [19]. CircRNAs are identified as potential targets for diagnosis, prognosis and treatment of hepatocellular carcinoma [20]. In this research, we were the first to validate the anti-cancer role of circ_0000517 knockdown in hepatocellular carcinoma. Moreover, we confirmed that was associated with miR-326 and IGF1R. The previous study analyzed the dysregulated circRNAs in hepatocellular carcinoma, and found upregulation of circ_0000517 indicated poor outcomes of hepatocellular carcinoma [8]. Similarly, we also found high expression of circ_0000517 in hepatocellular carcinoma, indicating circ_0000517 might be involved in hepatocellular carcinoma development. Ki67 and PCNA are two key viability-related proteins in human cancers, including hepatocellular carcinoma [21, 22]. By MTT, colony formation assay and detecting expression of Ki67 and PCNA, results showed that circ_0000517 silence suppressed cell viability. Furthermore, cell migration and invasion are important factors of hepatocellular carcinoma malignancy, and EMT is responsible for these two processes [23, 24]. Here we found that circ_0000517 knockdown repressed migration and invasion by blocking EMT. Besides, glycolysis is the important hallmark of cancers, contributing to development of hepatocellular carcinoma. Through detecting glycolysis-related biomarkers (glucose consumption, lactate production and ATP production) and targeted enzymes (LDHA and HK2) [25-27], we found that circ_0000517 downregulation restrained glycolysis of hepatocellular carcinoma. Collectively, circ_0000517 inhibition played an anti-cancer role in hepatocellular carcinoma in vitro, which was also in agreement with a previous study [28]. The ceRNA crosstalk of circRNA/miRNA/mRNA is the key mechanism by which circRNA modulating cancer development [9]. Zhang et al. reported that circ_0000517 could regulate miR-1296-5p/TXNDC5 axis to promote HCC development [28]. In this work, we wanted to explore an additional regulatory network. miR-326 was a candidate target of circ_0000517, and this study identified miR-326 was sponged via circ_0000517 and was lowly expressed in hepatocellular carcinoma. Furthermore, our data showed the tumor-suppressive role of miR-326 in hepatocellular carcinoma, which was also in agreement with previous studies [12, 29]. Additionally, downregulation of miR-326 reversed the regulatory function of circ_0000517 silence on hepatocellular carcinoma development, implying that circ_0000517 regulated hepatocellular carcinoma development via sponging miR-326. The dysregulation of IGF1R was a crucial target for development and treatment of hepatocellular carcinoma [14]. Here we confirmed IGF1R was targeted via miR-326. Moreover, we confirmed the oncogenic role of IGF1R in hepatocellular carcinoma via promoting cell proliferation, migration and invasion, which was also consistent with former works [15, 30, 31]. In addition, IGF1R upregulation also facilitated glycolysis in hepatocellular carcinoma, which was similar to that in mammary gland tumor and gliomas [32, 33]. Meanwhile, the rescue experiments displayed that IGF1R mitigated the effect of miR-326, suggesting miR-326 targeted IGF1R to take part in the regulation of hepatocellular carcinoma development. Besides, we found that circ_0000517 could modulate IGF1R level via competitively binding with miR-326, supporting the ceRNA network of circ_0000517/miR-326/IGF1R. Furthermore, the anti-cancer role of circ_0000517 knockdown was identified using xenograft model in vivo.

Conclusion

In conclusion, interference of circ_0000517 repressed hepatocellular carcinoma development, possibly via miR-326/IGF1R axis, indicating a new mechanism for circ_0000517 in hepatocellular carcinoma development. This study suggested circ_0000517 as a novel target for treatment of hepatocellular carcinoma. Additional file 1: Figure S1. Effect of circ_0000517 knockdown on hepatocellular carcinoma progression. Ki67 and PCNA protein levels (A), E-cadherin and Vimentin protein levels (B), and LDHA and HK2 protein levels (C) were detected in HCCLM3 and Huh7 cells transfected with si-circ_0000517#3 or si-NC. *P < 0.05. Additional file 2: Figure S2. Effect of miR-326 down-regulation on silence of circ_0000517-mediated hepatocellular carcinoma progression. Ki67 and PCNA protein levels (A), E-cadherin and Vimentin protein levels (B), and LDHA and HK2 protein levels (C) were detected in HCCLM3 and Huh7 cells transfected with si-NC, si-circ_0000517#3, si-circ_0000517#3 + anti-miR-326 or anti-NC. *P < 0.05. Additional file 3: Figure S3. Effect of miR-326 and IGF1R on hepatocellular carcinoma progression. Ki67 and PCNA protein levels (A), E-cadherin and Vimentin protein levels (B), and LDHA and HK2 protein levels (C) were detected in HCCLM3 and Huh7 cells transfected with miR-NC, miR-326 mimic, miR-326 mimic + pcDNA or IGF1R overexpression vector. *P < 0.05.
  33 in total

1.  Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.

Authors:  K J Livak; T D Schmittgen
Journal:  Methods       Date:  2001-12       Impact factor: 3.608

Review 2.  Hepatocellular Carcinoma.

Authors:  Augusto Villanueva
Journal:  N Engl J Med       Date:  2019-04-11       Impact factor: 91.245

Review 3.  Ki67, PCNA, and MCM proteins: Markers of proliferation in the diagnosis of breast cancer.

Authors:  Miroslava Juríková; Ľudovít Danihel; Štefan Polák; Ivan Varga
Journal:  Acta Histochem       Date:  2016-05-28       Impact factor: 2.479

Review 4.  Circular RNAs in hepatocellular carcinoma: Biomarkers, functions and mechanisms.

Authors:  Lipeng Qiu; Han Xu; Mengchen Ji; Dongsheng Shang; Ziwen Lu; Yihang Wu; Zhigang Tu; Hanqing Liu
Journal:  Life Sci       Date:  2019-07-15       Impact factor: 5.037

5.  LncRNA SNHG3 Promotes Hepatocellular Tumorigenesis by Targeting miR-326.

Authors:  Qian Zhao; Chensi Wu; Jingwen Wang; Xidong Li; Yuchen Fan; Shuai Gao; Kai Wang
Journal:  Tohoku J Exp Med       Date:  2019-09       Impact factor: 1.848

Review 6.  A global view of hepatocellular carcinoma: trends, risk, prevention and management.

Authors:  Ju Dong Yang; Pierre Hainaut; Gregory J Gores; Amina Amadou; Amelie Plymoth; Lewis R Roberts
Journal:  Nat Rev Gastroenterol Hepatol       Date:  2019-08-22       Impact factor: 73.082

Review 7.  MicroRNAs: Emerging Novel Clinical Biomarkers for Hepatocellular Carcinomas.

Authors:  Sumadi Lukman Anwar; Ulrich Lehmann
Journal:  J Clin Med       Date:  2015-08-18       Impact factor: 4.241

8.  Circ_0000517 Contributes to Hepatocellular Carcinoma Progression by Upregulating TXNDC5 via Sponging miR-1296-5p.

Authors:  Hongliang Zang; Yuhui Li; Xue Zhang; Guomin Huang
Journal:  Cancer Manag Res       Date:  2020-05-14       Impact factor: 3.989

9.  miR-29a-3p suppresses cell proliferation and migration by downregulating IGF1R in hepatocellular carcinoma.

Authors:  Xiao Wang; Shasha Liu; Ling Cao; Tengfei Zhang; Dongli Yue; Liping Wang; Yu Ping; Qianyi He; Chaoqi Zhang; Meng Wang; Xinfeng Chen; Qun Gao; Dan Wang; Zhen Zhang; Fei Wang; Li Yang; Jieyao Li; Lan Huang; Bin Zhang; Yi Zhang
Journal:  Oncotarget       Date:  2017-09-23

10.  KIFC1 promotes the proliferation of hepatocellular carcinoma in vitro and in vivo.

Authors:  Xing Wang; Meng Wang; Xing-Yue Li; Jian Li; Dian-Peng Zhao
Journal:  Oncol Lett       Date:  2019-10-14       Impact factor: 2.967

View more
  13 in total

1.  Identification of Circular RNA-Based Immunomodulatory Networks in Colorectal Cancer.

Authors:  Zongfeng Feng; Leyan Li; Yi Tu; Xufeng Shu; Yang Zhang; Qingwen Zeng; Lianghua Luo; Ahao Wu; Wenzheng Chen; Yi Cao; Zhengrong Li
Journal:  Front Oncol       Date:  2022-01-27       Impact factor: 6.244

2.  A six-miRNA signature as a novel biomarker for improving prediction of prognosis and patterns of immune infiltration in hepatocellular carcinoma.

Authors:  Zhitao Chen; Lele Zhang; Chenchen Ding; Kuiwu Ren; Dalong Wan; Shengzhang Lin
Journal:  Am J Transl Res       Date:  2022-06-15       Impact factor: 3.940

3.  Dysregulated circ_0004913, circ_0008160, circ_0000517, and their potential as biomarkers for disease monitoring and prognosis in hepatocellular carcinoma.

Authors:  Xiaoqian Li; Jun Yang; Xuefeng Yang; Ting Cao
Journal:  J Clin Lab Anal       Date:  2021-05-21       Impact factor: 2.352

Review 4.  Circular RNAs in Hepatocellular Carcinoma: Emerging Functions to Clinical Significances.

Authors:  Yucheng Zhang; Yali Wang
Journal:  Front Oncol       Date:  2021-05-14       Impact factor: 6.244

5.  lncRNA PCAT6 facilitates cell proliferation and invasion via regulating the miR-326/hnRNPA2B1 axis in liver cancer.

Authors:  Jun Luo; Jiaping Zheng; Weiyuan Hao; Hui Zeng; Zhewei Zhang; Guoliang Shao
Journal:  Oncol Lett       Date:  2021-04-13       Impact factor: 2.967

6.  Circular RNA circ_0000517 Facilitates The Growth and Metastasis of Non-Small Cell Lung Cancer by Sponging miR-326/miR-330-5p.

Authors:  Qiyan Tan; Changyu Liu; Ying Shen; Tao Huang
Journal:  Cell J       Date:  2021-10-30       Impact factor: 2.479

7.  The novel circular RNA HIPK3 accelerates the proliferation and invasion of hepatocellular carcinoma cells by sponging the micro RNA-124 or micro RNA-506/pyruvate dehydrogenase kinase 2 axis.

Authors:  Qiangfeng Yu; Wenxiang Chen; Yiming Li; Jun He; Yu Wang; Sijia Yang; Jianyin Zhou
Journal:  Bioengineered       Date:  2022-03       Impact factor: 3.269

8.  Hsa_circ_0005230 is up-regulated and promotes gastric cancer cell invasion and migration via regulating the miR-1299/RHOT1 axis.

Authors:  Yan-Yu Peng; Dan Sun; Yan Xin
Journal:  Bioengineered       Date:  2022-03       Impact factor: 3.269

9.  circSYPL1 Promotes the Proliferation and Metastasis of Hepatocellular Carcinoma via the Upregulation of EZH2 Expression by Competing with hsa-miR-506-3p.

Authors:  Da Lei; Tao Wang
Journal:  J Oncol       Date:  2022-03-19       Impact factor: 4.375

Review 10.  Current Molecular Biology and Therapeutic Strategy Status and Prospects for circRNAs in HBV-Associated Hepatocellular Carcinoma.

Authors:  Rui Liao; Lei Liu; Jian Zhou; Xufu Wei; Ping Huang
Journal:  Front Oncol       Date:  2021-07-02       Impact factor: 6.244

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.