Effects of polymorphism of myostatin and fatty acid-binding protein 4 genes on the chemical composition of meat in cull female Aceh cattle.

AIM: This study aimed to investigate the association of single nucleotide polymorphism of the myostatin (MSTN) and fatty acid-binding protein 4 (FABP4) genes on the total water, ash, fat, protein, and cholesterol contents of sirloin (gluteus medius muscle) and silverside (biceps femoris muscle) meats of cull female Aceh cattle.
MATERIALS AND METHODS: This analysis covered a total of 27 cull female Aceh cattle slaughtered at the Animal Slaughterhouse of Banda Aceh that was purposively selected based on hair color referred to the criteria described in the Decree of Ministry of Agriculture of the Republic of Indonesia. Genomic DNA was extracted from 25 mg of fresh meat using the spin column method before subjected to a polymerase chain reaction amplification using primer sets specific for 1346-bp and 275-bp fragments of MSTN and FABP4, respectively. A 4-h digestion reaction was done separately for the MSTN/HaeIII and FABP4/NlaIII loci genotyping. The total protein, ash, and fat of the meat were measured using the Indonesian National Standard (SNI) methods whereas its cholesterol content was determined using the AOAC method. The association between each polymorphism and the variation in meat chemical parameters was analyzed using the Pearson correlation test.
RESULTS: The results showed that the MSTN/HaeIII locus was polymorphic in Aceh cattle, but the FABP4/NlaIII locus was monomorphic. Meat chemical parameters were not influenced by different commercial cuts and MSTN genotypes, showing that there was no association between different commercial cuts, cattle hair colors, and MSTN/HaeIII and FABP4/NlaIII markers with the meat chemical parameters in Aceh cattle.
CONCLUSION: These results suggest that focusing on the novel effects of MSTN and FABP4 gene polymorphisms on meat production traits might not be useful for marker-assisted selection in Aceh cattle. Copyright: © Azhar, et al.

Introduction

Interaction of one or more genetic polymorphisms with environmental factors is responsible for the inheritance of many economically desired traits of domesticated animals [1] such as higher production (dressing percentage, meat quality, and milk result) [2], reproduction [3], and disease resistance [4], as well as better adaptation to moisture, a hot tropical climate [5], low-quality food, and traditional farming [6]. These traits of economic importance, however, are not concurrently inherited in animals. Indigenous cattle, for example, are well known for good adaptation and low maintenance price, but have slow growth, delayed puberty, and low production compared to exotic cattle [7]. Slow growth, delayed puberty, and low production are traits generally attributed to Bos indicus (zebu) cattle [8]. The occurrence of the zebu genotype is also responsible for low meat tenderness [9] and texture [10], but higher fat content [11], three of the most important parameters of meat quality in the beef industry. Searching for the genetic basis of the desired phenotypic variations followed by integrating the data obtained in the currently used conventional breeding selection might shorten the selection process of Indonesian beef cattle.

Several genetic factors have been identified to be associated with varying meat nutritional quality trait. Among them, myostatin (MSTN) and fatty acid-binding protein 4 (FABP4) genes are the most interesting candidate factors. Inconsistent relationships may be found between these potential genetic markers and the meat quality of several cattle populations [12]. While some of the previously identified 20 polymorphisms (due to nucleotide deletion, insertion, or substitution) of MSTN are known to be linked to increased muscle [13,14], polymorphisms found in either the exon or intron of FABP4 have been shown to affect bovine backfat thickness [15], marbling, and carcass weight [16]. In Indonesia, unfortunately, there are limited information about meats chemical composition and nutritional value of local beef cattle. Furthermore, are not available scientific data about the potential genetic variations related to meat chemical and physical parameters. Although the diversity of exon-3 of MSTN has been studied in Indonesian Madura cattle[17], a previous study by Nugroho et al. [18] in Bali cattle is the only one that shows positive effects of MSTN polymorphism on the chest girth, weaning weight, and chest circumference.

At present, no research has addressed the effect of single polymorphism of MSTN and FABP4 on meat chemical parameters in Aceh cattle, a genetic resource of Indonesian beef cattle native to Aceh Province which originated from the cross-breeding of Indonesian local cattle (Bos sondaicus), Java cattle (Bos javanicus), and zebu cattle (Bos indicus) [19,20]. Naturally Aceh cattle have different hair colors, but only Aceh cattle have brick red hair color which fulfills the criteria mentioned in the Indonesian National Standard. We hypothesized the MSTN and FABP4 polymorphisms, different commercial cuts, and cattle hair colors might have some effects on meat chemical parameters and the physical quality of Aceh cattle, but there is no scientific information to prove this assumption.

Therefore, this study aimed to investigate the effect of MSTN and FABP4 polymorphisms on the chemical parameters of sirloin (gluteus medius [GM] muscle) and silverside (biceps femoris [BF] muscle) meats of Aceh cattle with different hair colors. Information obtained might provide a scientific basis for setting Aceh cattle with brick red hair color as the Indonesian National Standard criteria and might have some benefits to the existing cattle breeding selection programs in Indonesia.

Materials and Methods

Ethical approval

All protocols used in this study have been approved by the Faculty of Veterinary Medicine Committee of Animal Ethics, Universitas Syiah Kuala, Banda Aceh (Ref: 28/KEPH/II/2018).

Samples collection

This study was conducted from May 2018 to March 2019. Fresh sirloin (GM muscle) and silverside (BF muscle) meats, 250 g each, of 27 cull female Aceh cattle aged 8-12 years old with different hair colors (three light brown, three red brown/brick red, five grayish black, four black, six straight yellow, three grayish yellow, and three white) were purposively purchased from the Animal Slaughterhouse of Banda Aceh. This was to accommodate the naturally existing hair color variations among Aceh cattle herds as mentioned in the Decree of the Ministry of Agriculture of the Republic Indonesia Number 54/Permentan/OT.140/10/2006. The meats were kept cool (4°C), brought to the Faculty of Veterinary Medicine Laboratory of Research at Universitas Syiah Kuala, and stored at −20°C before examination. Molecular characterizations were performed on 27 sirloin meat samples collected and chemical analysis was performed on 40 (20 sirloin and 20 silverside) out of 54 meat samples due to limited research funding.

Meat chemical analysis

Using the commercial service at the Center for Agro-based Industry of Bogor, the total water, ash, fat, and protein contents of the meat samples were determined using the Indonesian National Standard (SNI) test methods of food and beverage [21], whereas meat cholesterol content was measured using the AOAC method [22]. Meat moisture was analyzed using the SNI protocol No. 01-2891-1992 point 5.1 (oven method). Here, 1-2 mg of meat sample was put in a pre-weighed closed bottle, and dried in an oven (105°C) for 3 h. The sample was cooled and reweighed. The procedure was repeated until a constant weight was achieved. Water content was quantified as a percentage of the sample mass [21].

The SNI method No. 01-2891-1992 point 6.1 (dry method) was used to determine meat ash content. Briefly, a porcelain cup was pre-conditioned in a furnace at an ashing temperature of 550°C for 30 min, cooled at room temperature, and weighed. Meat samples, 1-2 g, were individually weighed using this porcelain cup, placed in a furnace, and dried to charcoal before an ashing step at 550°C. The porcelain cup containing ash was cooled to room temperature in a desiccator and weighed. Total ash content was quantified as a percentage of the sample mass [21].

Meat protein content was measured using the SNI method No 01-2891-1992 point 7.1 (Kjeldahl method). Here, 0.51 g of meat sample was combined with 2 g of selenium and 25 mL of concentrated H2SO4, and heated for 2 h. The mixture was cooled and diluted to 100 mL with distilled water. Five milliliters of aliquot mixture were mixed with 5 mL of 30% NaOH and 3-5 mL of phenolphthalein indicator and distillated for 10 min with 2% boric acid. The volume of 0.01 N HCl solution used to neutralize distillate was measured to determine the nitrogen percentage. The protein content was calculated by multiplying the nitrogen percentage with 6.25 [21].

The Soxhlet method (SNI No. 01-2891-1992 point 8.2) was used to measure meat fat content. In brief, approximately 1-2 g of meat samples were put into a cotton-lined paper sleeve and dried for 1 h using an oven heated to <80°C. The dry meat was put into a Soxhlet apparatus connected with a fat jar containing a pre-weighed boiling stone. The fat was extracted using a hexane for 6 h. After distilling the hexane, the extracted fat was dried in an oven (105°C), cooled and weighed. Fat content was quantified as a percentage of the sample mass [20].

Meat cholesterol content was determined using gas chromatography according to the Association of Official Analytical Chemists (AOAC, USA) No. 994.10 [21]. Briefly, 2 g of fresh meat (W1) was saponified with 40 mL of 95% ethanol and 8 mL of 50% potassium hydroxide for approximately 70 min at 60°C. The mixture was combined with 60 mL of 95% ethanol, incubated for 15 min, and cooled in a closed flask at room temperature. The non-saponified fraction was extracted 3 times using 100 mL of toluene (V), mixed with 110 mL of 1M KOH by vigorous shaking for 10 min, and incubated at room temperature to allow layers formation. The toluene layer was mixed with 40 mL of 0.5 M KOH and washed ≥3 times with distilled water. The clear toluene layer formed was poured into a new 125 mL Erlenmeyer flask, added with 2 g of Na2SO4, and incubated at room temperature for ≥15 min. The extract, 25 mL (V), was evaporated to dryness on a rotary evaporator at 40±3°C, and mixed with 3 mL of acetone. After evaporating the extract to dryness again, the residue was dissolved in 3 mL of dimethylformamide (V). Standard aliquots (0.0025-0.2 mg/mL), 1 mL each, were mixed with 2.0 mL of hexamethyldisilane, incubated at room temperature for 15 min, and then mixed with 1 mL of 5α-cholesterol internal standard solution (1 mg/mL in heptane). After centrifugation for 2 min, the heptane layer was collected. Standards and test solutions, 1 μL each, were injected to a gas chromatograph. Peak areas of 5α-cholestane and cholesterol were determined using height-weight measurements. Standard response ratio was calculated by dividing cholesterol peak area by internal standard peak area. The ratio response of the four highest standards was plotted against cholesterol concentrations. The amount of meat sample portion per milliliter (in grams) was determined by multiplying the ratio of meat sample examined and the volume of toluene used with the ratio of aliquot taken to dryness and the volume of dimethylformamide used to solve residue (W/V x W/V). Meat cholesterol content (mg) was determined by dividing the amount of cholesterol in the meat sample examined based on a standard curve by the amount of sample portion per milliliter [22].

DNA extraction

Genomic DNA was isolated from each sirloin meat sample at room temperature using a PureLink™ Genomic DNA Mini Kit (Invitrogen Life Technologies, USA) following protocol provided by the manufacturer. In brief, 20-25 mg of fresh meats were minced, immersed in digestion buffer mix, and incubated at 55°C for 2 h with occasional vortexing. After spinning for 3 min at 16,000× g, supernatant was mixed with 20 μL of RNase A and incubated for 2 min. The lysate was mixed with 200 μL of genomic lysis/binding buffer, added with 200 μL of absolute ethanol, and mixed by short vortexing. The entire mixture was transferred to a spin column in a collection tube and spun at 1000× g for 1 min. After replacing the collection tube, 500 μL of wash buffer-1 was added, and the column was respun at 10,000× g for 1 min. This washing step was repeated using wash buffer-2 and 3-min spinning at 16,000× g. Genomic DNA was eluted from the spin column by 1 min incubation with 50 μL of elution buffers followed by spinning at 16,000× g for 1 min. The quality of DNA extract was checked by electrophoresis on a 1% agarose/1×TAE gel stained with a SYBR™ Safe (Invitrogen Life Technologies, USA) stain using a 100-bp ladder as a molecular size marker, and visualized using a digital imaging system (Bio-Rad, USA). Purified DNA extract was stored at −20°C [23].

Genotyping

Polymorphism of MSTN and FABP4 was examined with the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) approach. Primer sequences, PCR conditions and restriction enzymes used are presented in Table-1 [16,18,24]. The PCR reaction mixture (25 μL) was prepared by adding 3 μL of template DNA (5-10 pg), 12.5 μL of PCR-master mix (Invitrogen Life Technologies, USA), forward and reverse primers (1 μL each), and 7.5 μL of nuclease-free water. The DNA amplification was done in a Bio-Rad (USA) thermal cycler. After amplification, 5 μL of PCR products were added with 15 units of the corresponding restriction enzyme, and incubated at 37°C for 4 h. The digestion products were analyzed by electrophoresis on 1.5% agarose/1×TAE gel (Invitrogen Life Technologies, USA) stained with a SYBR™ Safe stain using a 100-bp ladder as molecular size marker. The electrophoresis was run at 80V for 1.5 h and visualized using a digital imaging system (Bio-Rad, USA) [23].

Table-1

Fragment size, PCR primers and conditions, and restriction enzymes used in the analysis of MSTN and FABP4 polymorphisms.

Gene	Fragment size (bp)	PCR primers (5′ to 3′)	PCR conditions	Restriction enzyme	Reference
MSTN	1,346	F: 5′CCCTACAGAGGCCACTTCAA3′ R: 5′CTCGCTGTTCTCATTCAGATC3′	94°C 3′, (94°C 3 s, 63°C 30 s, 72°C 1′) 39 cycles, 72°C 10′	HaeIII	[24] [18]
FABP4	565	F: 5′ACCCCTATGATGCTATTCCACA3′ R: 5′ATACGGTTCACATTGAGAGGGA3′	95°C 4′, (94°C 1′, 60°C 1′,72°C 1.5 min−1) 35 cycles, 72°C 5′	NlaIII	[16]

Statistical analysis

Based on the DNA pattern, genetic polymorphism was tested using the formula: PiCi = 1 - Σp2ij. PiCi is the polymorphic information contained for the ith locus and pij is frequency of the jth allele for the ith locus. A Chi-square test was used to determine the agreement of allele distribution to the Hardy-Weinberg equilibrium. Data allele and genotype frequencies were analyzed by SPSS software version 23 for Windows (IBM, USA). While difference in meat composition between different commercial cuts was determined using a one-way ANOVA, the relationship between meat chemical parameters and gene polymorphism was analyzed using Pearson’s correlation test.

Results

Meat chemical composition

The meat chemical parameters in the two commercial cuts of the cattle analyzed were comprised of water, ash, protein, fat, and cholesterol, as presented in Table-2. Silverside meats of Aceh cattle tended to have higher moisture, ash, protein, and cholesterol contents than sirloin meats. Sirloin meats, on the other hand, slightly contained more fat than silverside meats. The differences in meat chemical parameters observed, however, were not significant (p>0.05).

Table-2

Meat chemical parameters (±SD) of two commercial cuts of Aceh cattle.

Chemical parameters	Commercial cut		Average
	Sirloin	Silverside
Water (%)	69.65±4.60ns	71.50±4.64ns	70.57±4.66
Ash (%)	0.96±0.09ns	0.97±0.10ns	0.96±0.09
Protein (N x 6.25%)	16.93±2.56ns	17.48±2.72ns	17.20±2.62
Fat (%)	3.62±2.87ns	2.52±1.71ns	3.07±2.40
Cholesterol (%)	71.62±17.03ns	72.18±28.14ns	71.90±22.96

ns=differences presented in the same row were not significant

Meat chemical parameters of Aceh cattle with different hair colors are listed in Table-3. The water, ash, protein, fat, and cholesterol contents in the meats of Aceh cattle with black hair were not significantly different from Aceh cattle with grayish black hair, straight yellow hair, white hair, and brick red hair.

Table-3

Meat chemical parameters (±SD) of Aceh cattle with different hair colors.

Chemical parameters	Cattle hair color
	Black	Grayish black	Straight yellow	White	Brick red
Water (%)
Sirloin	69.40±6.45ns	67.63±5.57ns	70.57±5.28ns	69.73±0.51ns	70.43±4.55ns
Silverside	70.90±6.20ns	68.93±5.45ns	72.00±4.36ns	72.97±4.69ns	72.65±4.61ns
Ash (%)
Sirloin	0.96±0.16ns	0.96±0.04ns	0.96±0.07ns	0.95±0.16ns	0.97±0.11ns
Silverside	0.87±0.10ns	0.95±0.06ns	0.99±0.09ns	0.99±0.11ns	1.00±0.11ns
Protein (%)
Sirloin	16.87±4.60ns	17.28±1.15ns	17.05±2.14ns	16.03±3.54ns	17.13±2.98ns
Silverside	16.33±3.96ns	18.10±2.05ns	17.72±1.77ns	16.33±4.68ns	18.20±2.92ns
Fat (%)
Sirloin	2.42±0.78ns	4.89±2.76ns	4.89±4.32ns	2.13±0.33ns	2.44±1.44ns
Silverside	3.24±0.56ns	4.36±2.81ns	1.50±0.89ns	1.50±0.37ns	2.42±0.97ns
Cholesterol
Sirloin	64.10±8.82ns	79.38±21.57ns	75.75±19.89ns	65.37±22.65ns	67.98±9.53ns
Silverside	60.20±8.88ns	69.53±20.51ns	74.95±18.95ns	97.53±64.26ns	60.63±14.24ns

ns=differences presented in the same row were not significant

Polymorphism of MSTN and FABP4 and meat chemical composition

The results from PCR-RFLP experiment using the HaeIII restriction enzyme on 27 sirloin meat samples revealed that the MSTN is polymorphic in Aceh cattle as shown by the occurrence of AA, AB, and BB genotypes in the population [23]. The FABP4, on the other hand, is monomorphic in Aceh cattle by the presence of a single uncut AA genotype. The results of PCR-RFLP of MSTN and FABP4 fragments from several samples are presented in Figure-1 and 2 [23], respectively.

Figure-1

Results of agarose gel electrophoresis of myostatin reaction restriction fragment length polymorphism fragments (1346, 700, 646, and 600 bp). Lane M, 100 bp ladder. Lane 01-05, Aceh cattle examined [23].

Figure-2

Results of agarose gel electrophoresis of FABP4 restriction fragment length polymorphism fragment (200 bp). Lane M, 100 bp ladder. Lane 01-15, Aceh cattle examined.

As shown in Figure-1, the PCR-RFLP analysis using the HaeIII enzyme showed that the 1346 bp MSTN fragment was cut into 700 and 646 bp fragments (AA), 700, 646, 618, and 28 bp fragments (AB) or 618 and 28 bp fragments (BB). With a polymorphism degree of 0.51 (Table-4) [23], the MSTN genotype distribution in the Aceh cattle population agreed well with the Hardy-Weinberg equilibrium (χ2=0.55). The respective frequency of allele A and B was 0.45 and 0.55.

Table-4

MSTN allele and genotype frequencies and polymorphism in Aceh cattle*.

Total genotype		Frequency		Polymorphism degree	Hardy-Weinberg Equilibrium (χ2 test)
Observed	Expected	Genotype	Allele
AA=5	AA=4.1	AA=0.18	A=0.45	0.51	χ2=0.55
AB=11	AB=12.1	AB=0.41	B=0.55
BB=11	BB=10.8	BB=0.41

Modified from Azhar et al. [23]

The meat chemical parameters of Aceh cattle with different MSTN genotypes are presented in Table-5. The data showed that meat chemical parameters analyzed were not markedly different among the cattle carry certain MSTN genotypes, showing that the chemical parameters of Aceh cattle meat were not influenced by MSTN gene.

Table-5

Average meat chemical parameters of Aceh cattle with different MSTN genotypes.

Meat chemical parameters	Commercial cut	MSTN genotype
		AA	AB	BB
Water (%)	Sirloin	70.57±4.05ns	68.57±5.34ns	71.17±3.31ns
	Silverside	70.93±5.97ns	70.32±4.14ns	73.93±4.80ns
Ash (%)	Sirloin	0.94±0.09ns	0.98±0.09ns	0.95±0.12ns
	Silverside	0.95±0.12ns	0.97±0.09ns	0.98±0.11ns
Protein (n×6.25%)	Sirloin	18.13±0.31ns	17.10±2.56ns	16.02±3.12ns
	Silverside	18.13±1.72ns	17.51±2.72ns	17.07±3.41ns
Fat (%)	Sirloin	5.83±4.72ns	3.74±2.82ns	2.28±1.18ns
	Silverside	2.26±2.25ns	3.09±1.86ns	1.59±0.65ns
Cholesterol (%)	Sirloin	63.60±22.39ns	75.81±16.54ns	67.82±16.13ns
	Silverside	61.27±23.18ns	70.72±15.51ns	63.63±16.66ns

ns=differences presented in the same row were not significant

Discussion

Meat is a complex biological system made of water up to 75% that is in balance circumstance with 20% protein, 2% fat, and 3% other small components such as minerals, phosphoric containing molecules, and vitamins [25]. Water, ash, protein, and fat contents of sirloin (GM muscle) and silverside (BF muscle) meats of female Aceh cull cattle obtained in this study (Table-2) were different from those reported in other cattle, either B. indicus or B. taurus. The moisture composition of sirloin and silverside meats of Aceh cattle, 69.12±4.50% and 69.95±3.76%, respectively, is lower than that reported in Bali cattle meats (72.84±0.79%) [26], GM and Longissimus dorsi (LD) muscles of adult Limousin x Luxi crossbreed steers, 74.4% [27].

Comparing the meats from Bali (GM 1.13%-2.15%) [24] and Limousin x Luxi crossbreed cattle (GM 1.77% and LD 1.66%) [27], the Aceh’s meat contains, in the same muscles, less ash 1.00±0.06% and 1.00±0.06% (GM and LD, respectively). While the protein content of the Aceh cattle meats (GM muscle 17.76±1.73% and BF muscle 18.28±1.92%) is in agreement with those reported by Buckle et al. [28], 16-22%; they are lower than those found in Bali cattle meats, protein 21.64±1.08% [26] or GM and Ld muscles of adult male Limousin x Luxi crossbreed (22.9% and 22.8%, respectively) [27].

In addition to water, ash, and protein, the fat content of the sirloin and silverside meats of Aceh cattle found in this study, 3.53±2.64% and 2.77±1.81%, respectively, were in agreement with the range reported in Aceh cattle, 3-6% [29] and male Limousin x Luxi crossbreed (1.7%) [27], but markedly lower than that found in Bali cattle, 13.82-19.05% [26]. The cholesterol content of Aceh cattle meats, GM 76.59±14.78 mg/100 g and BF 72.69±13.23 mg/100 g, was comparable to those reported in the semi membranosus and BF muscles of indigenous cattle in southern Brazil measured by enzymatic (60.63±2.33 mg/100 g and 63.02±3.62 mg/100 g, respectively) and HPLC (51.97±1.40 mg/100 g and 63.44±3.75 mg/100 g, respectively) methods [30]. No information is available about the cholesterol content of both Bali and Limousin x Luxi crossbreed cattle to make a comparison.

Khasrad et al. [31] reported that cattle breed significantly affected water, protein, and fat contents of the LD muscle of Bali, Pesisir, Simmental cross, and Brahman cross cattle. The average water content of meat in B. indicus 77.50±0.40% [32] is higher than that in B. taurus, 72.40-74.80% [31]. Evidence for the influence of breed on chemical content of meat is also shown by a higher percentage of meat ash of B. taurus compared to that of B. indicus [32].

The effect of cattle age on meat composition is not only shown by a decreased meat fat content according to age of the Bali cattle but also from the fact that the meat of young (2.0-2.5 years old) and old (7-10 years old) Bali cattle has significantly lower ash content than that of adult (3.5-6 years old) Bali cattle [26]. In addition, the effect of age on the profile of meat chemical parameters was also seen in 1- and 2-year-old Limousin x Luxi crossbreed cattle [27].

Data in Table-2 also show that the differences in protein, fat, and cholesterol contents between sirloin and silverside meats were not significant. This indicated that different commercial cuts did not have an obvious effect on the chemical composition of the meat of the Aceh cattle evaluated. This finding is different from that reported by Rhee et al. [33], who found that muscle types have a great effect on the chemical traits of beef meats when analyzed palatability and biochemical traits variation in 11 beef meats. Wang et al. [27] also found an effect of muscle types on the nutrient profile of Limousin x Luxi crossbreeds.

The occurrence of naturally different hair colors might have some benefits in Aceh cattle. The results of this study did not show the effect of hair color variations on chemical parameters of Aceh cattle (Table-3). Although chemical parameter differences were observed among Aceh cattle with different hair colors, they were not significant. Some factors that might contribute to these facts are that relatively high individual variations existed in some chemical parameters among the cattle and the small sample size. Further study must be done to confirm this prediction.

As one of the potential genes that influence the muscle growth and the depth of intramuscular fat in some cattle [13], it is possible that MSTN polymorphism affects the chemical composition of meat, a hypothesis that we wanted to analyze in this study. We found the polymorphic condition and balance distribution of MSTN in Aceh cattle, situations that are in agreement with the findings reported in Bali cattle by Nugroho et al. [18]. Dunner et al. [34] also reported a breed-specific haplotype in the MSTN of many European cattle breeds. The monomorphic condition of the MSTN genotype, on the other hand, was observed in several European [35,36], Indian [7], and native Turkish breed cattle [37]. The presence of three (AA, AB, and BB) genotypes in Aceh cattle (this study) was different from the finding of Nugroho et al. [18] showing only AB and BB genotypes identified in Bali cattle.

The RFLP digestion using the HaeIII restriction enzyme on Aceh cattle MSTN performed in this study resulted in flank cut 1346-bp B fragment into 700, 646, 618, and 28 bp fragments. Nugroho et al. [18] interestingly found five fragments 90, 100, 250, 450, and 546 bp fragments from the digestion of the 1346-bp MSTN of Bali cattle amplified using the same primer set. These facts show that different numbers of restriction sites of HaeIII enzyme are available in MSTN between Bali and Aceh cattle.

To confirm the difference, MSTN amplified from one genomic DNA sample with AB genotype (its HaeIII digestion resulting in 700, 646, 618, and 28 bp fragments) was sent to PT Genetika Science Indonesia for a commercial sequencing service. Nucleotide sequences of Aceh cattle MSTN obtained from sequencing using forward and reverse primers were then individually analyzed using APE Software (University of Utah, Salt Lake City, UT). The results showed the absence of a HaeIII restriction site along the 556 nucleotide sequence product of Aceh cattle MSTN sequenced using forward primer. The 597 nucleotide sequence resulting from MSTN sequencing using a reverse primer, on the other hand, contained one HaeIII restriction site at the nucleotide position of 53 (Figure-3). The occurrence of another HaeIII restriction between nucleotide 556 and 749 is assumed, thus confirming the possible occurrence of 1-2 HaeIII restriction sites along the 1346 bp of the MSTN fragment of Aceh cattle shown by the results of PCR-RFLP analysis. This is a novel finding which shows the specific number and locations of HaeIII restriction sites in the MSTN gene Aceh cattle.

Figure-3

Sequence alignment of Aceh cattle myostatin (MSTN) gene fragment amplified using forward primer and Bos indicus MSTN gene (a) and Aceh cattle MSTN gene fragment amplified using reverse primer and B. indicus MSTN gene (b) (a) sequence alignment of MSTN gene B. indicus and Aceh cattle (b) Sequence alignment of MSTN gene Bos taurus and Aceh cattle.

Deeper analysis on the HaeIII restriction sites along bovine MSTN was performed by comparing MSTN sequences of Bos Taurus Hereford (3147 bp, gene ID: 281187) and B. indicus (6686 bp, accession number AY794986), downloaded from GenBank database. The results showed the occurrence of 6 HaeIII restriction sites along the MSTN of B. taurus, which resulted in seven gene fragments after digestion, namely, 1622, 421, 404, 218, 215, 94, and 23 bp [23]. The MSTN of B. indicus, interestingly, has nine HaeIII restriction sites, three of them in intron 1 (2 sites) and two that resulted in ten gene fragments after digestion. The result of sequence alignment analysis showed that Aceh cattle MSTN was aligned with the nucleotide (nt) 1 – 217 of B. indicus MSTN and nt1 – nt501 of B. taurus MSTN sequences deposited in the GenBank (Figure-3a). The rest of the 1129 and 845 nucleotide sequences of B. indicus and B. taurus MSTN, respectively, are located on the upper part of the sequences. There is no sequence available to make a comparison between the MSTN sequences amplified by forward primer. Altogether, the data presented in this study show that MSTN is highly variable in Indonesian beef cattle. This finding is in agreement with the condition found in several cattle, where five out of nine mutations identified in the MSTN are located in coding sequences [38]. The different size of DNA fragments, however, indicates possible species specificity of HaeIII restriction sites in cattle. Further PCR experiments to get enough DNA products for sequencing are now performed in our laboratory to provide better results and analysis.

The effect of the MSTN genotype on meat chemical parameters of Aceh cattle is presented in Table-5. The invariant genotype of FABP4 found in Aceh cattle showed no possible effect of the gene in the chemical composition of the cattle meat, meaning it is not a potential marker for beef production in Aceh cattle. The data show meat moisture, ash, protein, fat, and cholesterol contents were not influenced by genotype during the current research trial. Although slight variation existed in meat chemical levels between cattle with the AA, AB, and BB MSTN genotypes, the differences were not significant (p>0.05). The potential effect of certain MSTN mutation on meat chemical content is shown by reduced external and internal intramuscular fat deposition in cattle carrying a single mutant allele from Belgian Blue or Piedmontese sire crossbreed compared to the pure breed [39]. These results suggest that selection for meat chemical parameters profile in Aceh cattle should be done not only based on MSTN/HaeIII variation but also other potential genes influencing meat composition such as calpain and calpastatin, the genes have been known and extensively studied their polymorphisms relationship with meat quality in cattle [40,41].

Conclusion

The presence of different HaeIII restriction sites of MSTN gene, but not FABP4 gene, is responsible for the polymorphism of genes in Aceh cattle. The frequency of MSTN genotype agreed well with Hardy-Weinberg equilibrium, showing a balanced inheritance of the gene in the Aceh cattle population. The study showed that meat chemical parameters are influenced by breed but not by different commercial cuts and MSTN or FABP4 genotypes. This suggests that either MSTN or FABP4 is not a potential gene to be used for meat quality related-molecular assisted selective breeding in Aceh cattle.

Authors’ Contributions

AA, MA, and MS designed and performed the experiments. MH and TSR extracted DNA from the samples and were responsible for PCR-RFLP analysis. MS and MH analyzed the data. AA, MA, and TSR wrote the manuscript. All authors read and approved the final manuscript.