An In Vitro Bovine Cellular Model for Human Schlemm's Canal Endothelial Cells and Their Response to TGFβ Treatment.

Purpose: Due to the limited availability of primary human Schlemm's canal (SC) endothelial cells, we aimed to develop an in vitro cellular model using the angular aqueous plexus (AAP) cells from bovine eyes.
Methods: We harvested a mixture of cells from the trabecular meshwork region including AAP loops from multiple donors, followed by puromycin treatment and immunostaining of Von Willebrand factor and vascular endothelial (VE)-cadherin to confirm identity. Previously identified differentially expressed genes in glaucomatous SC cells were examined in non-glaucomatous SC cells (n = 3) under 0% or 15% equibiaxial strain for 24 hours using droplet digital polymerase chain reaction (ddPCR) and analyzed using the Ingenuity Pathway Analysis (IPA) software application to identify upstream regulators. To compare the cellular responses to candidate regulators of these mechanoresponsive genes, AAP and human SC cells (n = 3) were treated with 5 or 10 ng/mL transforming growth factor beta-2 (TGFβ2) for 24 or 48 hours, followed with expression profiling using real-time PCR or ddPCR.
Results: We found that the isolated AAP cells displayed uniform cobblestone-like morphology and positive expression of two endothelial markers. In stretched SC cells, nine glaucoma-related genes were upregulated, and IPA implicated TGFβ as a potential upstream regulator. The effects of TGFβ2 treatment were similar for both AAP and SC cells in a dose- and time-dependent manner, activating TGFBR1 and SMAD2, inhibiting BMP4, and altering expression of three glaucoma-related genes (DCN, EZR, and CYP1B1). Conclusions: Bovine AAP cells may serve as an alternative cellular model of human SC cells. Translational Relevance: These AAP cells may be used to study the functional pathways related to the outflow facility. Copyright 2020 The Authors.

Introduction

Glaucoma is the leading cause of irreversible blindness worldwide., Intraocular pressure (IOP) is the only modifiable major risk factor for glaucoma, and lowering IOP has proven to be an effective treatment to delay glaucoma progression. The juxtacanalicular connective tissue (JCT) region, which is comprised of the inner wall of Schlemm's canal (SC) endothelium and adjacent trabecular meshwork (TM) cells, provides the majority of resistance to aqueous humor (AH) outflow and subsequently regulates IOP., Compared to age-matched normal donor eyes, the stiffness of the intact JCT region and isolated primary cultures of SC cells is dramatically increased in glaucomatous eyes.– These findings emphasize the important role of SC cells in glaucoma development and motivate their further study.

As the last barrier prior to AH drainage into systemic circulation, SC cells are under significant biomechanical stress due to the intraocular versus episcleral venous pressure gradient. This basal-to-apical pressure gradient manifests as dramatic cellular distention of SC cells, which form giant vacuoles when they lift off from their basal lamina and open pores. Although the size and density of giant vacuoles are dependent on changes in IOP, the pore density is also reduced in SC cells derived from glaucomatous eyes. Because pore density can also change with controlled strains applied to SC cells in vitro, the stretch model is useful to study the biomechanics of SC cells in culture.

Unfortunately, due to the anatomical location of SC cells and the technical difficulty associated with isolating sufficient numbers of cells, human SC cell studies have been limited.– Other attempts to explant dissected SC or to sort SC cells from TM mixed cultures using CD31+ immunostaining were limited by the number of isolated cells and potential contamination from other cells.,, Moreover, the limited availability and high cost of human donor eyes restrict those that can commit resources to routine isolations of SC cells. Thus, it is necessary to establish an alternative cellular model for SC cell studies.

The anatomy and genetic background of non-human primates are similar to those of humans but the SC is even less accessible, and there have been no reports of successful isolation of SC cells. Like non-human primates, rodents have a similar SC, but the small size of the anterior chamber makes it even more difficult to isolate sufficient numbers of SC cells for study., Bovine and porcine eyes have an anatomical variation of SC called the angular aqueous plexus (AAP). The identification of underlying JCT regions and micron-sized pores on the inner wall endothelial cells supports its equivalent function to SC., The similarity and easy accessibility promote usages of bovine and porcine eyes in perfusion studies and outflow facility measurements.– Both SC and AAP cells are connected to each other by tight junctions, which serve to prevent the reflux of blood into the anterior chamber of the eye, similar to microvascular endothelial cells that function as blood–brain barriers.– Thus, a puromycin selection of AAP cells from porcine eyes was developed that takes advantage of increased expression of P-glycoprotein, a multidrug resistance efflux pump expressed in AAP cells but not neighboring TM cells. Because access to porcine or bovine eyes can be limited depending on locations, and because our laboratory has access to bovine but not porcine eyes, we hypothesized that bovine AAP cells can also be differentially induced by P-glycoprotein and selected from TM cells by puromycin treatment, serving as an alternative in vitro cellular model for the functional pathway study of SC cells.

Methods

SC Cell Isolation and Culture

Human SC cells were isolated from three normal donor eyes within 36 hours of death, with enucleation occurring ≤6 hours after death according to the established techniques (Table 1). These cells were cultured in complete culture medium containing low-glucose Gibco Dulbecco's Modified Eagle Medium (DMEM; Thermo Fisher Scientific, Waltham, MA), 10% fetal bovine serum (R&D Systems, Minneapolis, MN), 100-U/mL penicillin, and 100-µg/mL streptomycin (Gibco). Primary SC cells were maintained at 37°C in humidified air containing 5% CO2 and passaged at a ratio of 1:3. All SC cell strains were characterized by positive staining of endothelial marker vascular endothelial (VE)-cadherin, a net transepithelial electrical resistance ≥ 10 ohms⋅cm2, and negative myocilin induction with dexamethasone to exclude mixtures of trabecular meshwork cells. All cells were tested between the third and fifth passage and treated before passage six.

Table 1.

Clinical Characteristics of Three Primary Human SC Endothelial Cell Donors

Cell Strain No.	Gender	Age (y)	Glaucoma
SC69	Male	45	No
SC70	Male	42	No
SC71b	Male	44	No

Stretch Assay

Three primary SC cell strains were used in stretch experiments that involved dividing the cells into non-stretched and stretched groups with duplicates. Cells were loaded onto six-well BioFlex culture plates (Flexcell International Corporation, Burlington, NC) coated with collagen type I. Plates were inserted in the Flexcell FX-5000 Tension System and either were stretched by 15% equibiaxial strain at 1 Hz or remained non-stretched for 24 hours. Total RNA was extracted using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific). RNA quality and quantity were evaluated using an Agilent Bioanalyzer 2100 with RNA 6000 Pico Chips (Agilent Technologies, Santa Clara, CA). All RNA samples had high RNA integrity number scores > 8.5, indicating good quality for downstream expression analyses.

Gene Expression Profiling

Isolated total RNA from stretched and non-stretched human SC cells was reverse transcribed to cDNA using the SuperScript IV First-Strand cDNA Synthesis System (Thermo Fisher Scientific) according to the manufacturer's recommended protocols. Droplet digital polymerase chain reaction (ddPCR) EvaGreen-based expression assays for specific human genes were obtained from Bio-Rad Laboratories, Inc. (Hercules, CA) (Table 2). The Bio-Rad QX200 ddPCR system was used to generate and measure the partitioned droplets for absolute quantification (copies/20 µl) of target genes as previously described. GAPDH and HPRT1 were used as the internal reference genes to normalize the gene expression across different samples.

Table 2.

Selected Bio-Rad ddPCR Human Gene Expression Assays

Gene Symbol	Gene Description	Bio-Rad Assay ID	Amplicon Size (bp)
ABCA1	ATP-binding cassette subfamily A member 1	dHsaEG5022809	85
BMP4	Bone morphogenetic protein 4	dHsaEG5001721	127
CAV1	Caveolin 1	dHsaEG5024315	107
CAV2	Caveolin 2	dHsaEG5002420	65
CDH2	Cadherin 2	dHsaEG5020622	151
CLDN23	Claudin 23	dHsaEG5005462	172
CYP1B1	Cytochrome P450, family 1, subfamily B, polypeptide 1	dHsaEG5019693	139
DCN	Decorin	dHsaEG5004873	133
EZR	Ezrin	dHsaEG5021343	60
GAS7	Growth arrest-specific 7	dHsaEG5014776	132
FMOD	Fibromodulin	dHsaEG5014378	114
SMAD2	SMAD family member 2	dHsaEG5024257	115
TGFBR1	Transforming growth factor beta receptor 1	dHsaEG5016420	91
TGFBR3	Transforming growth factor beta receptor 3	dHsaEG5016301	102
TJP1	Tight junction protein 1	dHsaEG5022982	142
GAPDH a	Glyceraldehyde-3-phosphate dehydrogenase	dHsaEG5006642	117
HPRT1 a	Hypoxanthine phosphoribosyltransferase 1	dHsaEG5189658	90

These two assays are reference genes used in expression profiling of stretched primary human SC endothelial cells.

Ingenuity Pathway Analysis

Differentially expressed genes in stretched SC cells were uploaded to the “My Pathway” function in the Ingenuity Pathway Analysis (IPA) software application (QIAGEN, Hilden, Germany) to determine potential relationships. Pathways and upstream regulators were ranked by P value according to the possibility of genes being altered simultaneously. Additionally, we generated a merged and customized network in accordance with known associations between genes to connect the genes of interest and examine the primary factors that play a role in response to the mechanical strain of SC cells.

Isolation and Culture of Bovine Outflow Cells

Bovine eyes from 1- to 2-year-old cows were obtained from a local slaughterhouse and stored on ice for up to 24 hours until dissection. Tissues outside the globes, such as fat, muscles, connective tissue, and optic nerve, were removed, and the globes were disinfected in 10% betadine solution (Purdue Pharma, New York, NY). The eyes were cut into halves using surgical scissors to remove the vitreous humor, lens, ciliary body, and iris. Under a dissecting microscope (Laxco MZS32; Fisher Scientific, Pittsburgh, PA), the iris root was carefully scraped away using a surgical blade to expose the groove where the TM and AAP are located. The tissue in the groove was removed by blunt dissection using a 1.5-mm curette. The hemotoxylin and eosin (H&E) staining histology slides showed our collection of TM region containing AAP tissue (Fig. 1). Tissues were pooled (n = 6) in the medium containing high-glucose DMEM complemented with 5% fetal bovine serum (Atlanta Biologicals), 5% newborn calf serum (Gibco), 5-mM l-glutamine (Gibco), 10-µg/mL endothelial cell growth factor, 90-µg/mL heparin, 2.5-µg/mL amphotericin B (Sigma-Aldrich, St. Louis, MO), 100-U/mL penicillin, 100-µg/mL streptomycin, and 50-µg/mL gentamicin (Gibco). The pooled tissue was digested by 1-mg/mL collagenase I (Sigma-Aldrich) in complete medium at 37°C for 1 hour and then centrifuged at 300g for 5 minutes to pellet the cells. The supernatant was aspirated and the pellet was washed with complete culture medium through another 300g centrifugation for 5 minutes. The cell pellet was resuspended and filtered through a 40-µm cell strainer (Corning, Inc., Corning, NY), followed by seeding into a 2% gelatin-coated T25 flask. The isolated cells were allowed to reach 90% to 100% confluence, with medium changes every 2 days (up to 10 days).

Figure 1.

H&E stained sections of the anterior segment from bovine eyes before and after removal of the ciliary body and iris. (A) A sample before dissection of the trabecular meshwork (TM) and angular aqueous plexus (AAP) region. (B) A sample after removal of the trabecular meshwork and aqueous plexus tissue. Asterisk shows location of aqueous plexus lumen.

Selection of AAP Cells by Puromycin Treatment

When the isolated outflow cells reached confluence, the culture medium was replaced with complete medium containing 4-µg/mL puromycin for 2 days, according to an established protocol used for porcine outflow cells. The medium was then aspirated and cells were washed with phosphate-buffered saline (PBS) twice to remove dead cells. The medium was changed to complete culture medium for cell repopulation.

Immunofluorescence Staining of Cells

The cells were seeded onto 2% gelatin-coated coverslips in six-well plates. After reaching confluence, cells were fixed with 4% formaldehyde for 15 minutes and washed with PBS three times. The cells were then blocked in 5% bovine serum albumin (BSA) (Sigma-Aldrich) for 1 hour at room temperature and permeabilized with 0.2% Triton X-100 (Sigma-Aldrich) for 5 minutes. Cells were incubated with 5% BSA (negative control), antibodies against Von Willebrand factor (VWF) (Abcam6994, 1:400; Abcam, Cambridge, UK), or VE-cadherin (Abcam232880, 1:200) overnight at 4°C. Cells were washed with PBS three times and incubated with Alexa Fluor 488 Goat anti-Rabbit Secondary Antibody (Thermo Fisher Scientific) at room temperature for 30 minutes before mounting with ProLong Diamond Antifade Mountant and 4′,6-diamidino-2-phenylindole (Thermo Fisher Scientific). Five images were taken from randomly selected sections of cells grown on a coverslip using an immunofluorescence microscope (HBO 100; Carl Zeiss Meditec, Oberkochen, Germany) to calculate the purity of culture by dividing the VWF-positive cells of nuclei counts as previously described.

Transforming Growth Factor Beta-2 Treatment with Bovine AAP Cells and Human SC Cells

AAP and SC cells were cultured in six-well plates with duplicates from each batch or each strain. After reaching 80% confluence, three batches of primary bovine AAP cells or three strains of primary human SC cells were treated with or without recombinant human transforming growth factor beta-2 (TGFβ2) protein (Abcam) at 5 ng/mL and 10 ng/mL in fetal bovine serum-free culture medium for 24 or 48 hours. Total RNA was then isolated using Invitrogen TRIzol (Thermo Fisher Scientific) according to the manufacturer's recommended protocol for further gene expression profiling. For consistent expression profiling, we examined the gene expression response of TGFβ2 treatment in SC cells using Bio-Rad ddPCR assays as previously described.,– All of the ddPCR assays are listed in Table 2.

Expression Profiling in Bovine AAP Cells Using Real-Time PCR

The mRNA sequences for bovine genes were obtained from the cow genome sequence data bosTau8 on the University of California, Santa Cruz, genome website (https://genome.ucsc.edu/cgi-bin/hgGateway). Because there are no available predesigned and in silico validated ddPCR assays for bovine genes from Bio-Rad, we used Primer3 (http://primer3.ut.ee/) to design specific primers for these targeted genes (Table 3). The PCR amplicons were designed to span intron–exon boundaries to eliminate potential DNA contamination. Real-time PCR was performed using the Bio-Rad SYBR Green Supermix and an Applied Biosystems StepOne Real-Time PCR System (Thermo Fisher Scientific). GAPDH was used as an internal reference gene after comparison with other housekeeping genes, including HPRT1, RPLP0, and ACTB.

Table 3.

Primers Designed for Real-Time PCR to Examine Gene Expression in Bovine AAP Endothelial Cells

Gene Symbol	Gene Description	Primers (F)	Primers (R)
CDH2	N-cadherin	CGAGCCAGCAGATTTTAAGG	GATGGGAGGGATAACCCAGT
CDH6	K-cadherin	CCACTGTTCCCGAAATGTCT	CGTGATGTTCACCGTGGTAG
CDH11	OB-cadherin	AGACCAAGCCACATTCCAAC	ATTCACGTCACACCCACAGA
SMAD2	SMAD family member 2	ATGGTCGTCTTCAGGTGTCC	GCAGTTCCGTTAGGATCTCG
CAV1	Caveolin 1	AGCCCAACAACAAGGCTATG	GATGCCATCGAAACTGTGTG
CAV2	Caveolin 2	ATCTGCAGCCACGCTCTATT	CTGCGTCCTATGCTCGTACA
TGFBR1	Transforming growth factor beta receptor 1	CTCAGCTCTGGTTGGTGTCA	CACTCTGTGGTTTGGAGCAA
GAS7	Growth arrest-specific 7	GGCTGGCAAAGCTACTTGTC	TGGAATCCCAGAAGAACTGC
CYP1B1	Cytochrome P450, family 1, subfamily B, member 1	CACGGTCACAGACATCTTCG	GTGCCTACCCACCACTTGAT
ABCA1	ATP binding cassette subfamily A member 1	TCGCTTACTTGCAGGATGTG	TGCTGATGAACCAGCTGAAC
FMOD	Fibromodulin	CCTGGCCTCAAATACCTTCA	CACCTGCAGCTTGGAGAAGT
BMP4	Bone morphogenetic protein 4	AGTCTGGGGAGGAGGAAGAG	TACGATGAAAGCCCTGATCC
OCLN	Occludin	ATGGGAGTCAATCCAACTGC	CGTTCCTTGTCCCACAGAAT
TJP2	Tight junction protein 2	GCAGTCTGGGTCTCTGAAGG	GCTCATCCAGCTCATTGTCA
CLDN11	Claudin 11	CTGGTGGACATCCTCATCCT	GCGTACAGGGAGTAGCCAAA
GAPDH a	Glyceraldehyde-3-phosphate dehydrogenase	GGGTCATCATCTCTGCACCT	GGTCATAAGTCCCTCCACGA
HPRT1 a	Hypoxanthine phosphoribosyltransferase 1	GCCGACCTGTTGGATTACAT	ACACTTCGAGGGGTCCTTTT

These two pairs of primers are reference genes used in expression profiling of bovine AAP cells.

Statistical Analysis

Results from the technical duplicates were averaged prior to statistical analysis. Data were analyzed using the Student's t-test with Bonferroni–Dunn correction performed in Prism 8.02 (GraphPad, San Diego, CA) with statistical significance set at P ≤ 0.05.

Results

Expression of Glaucoma-Related Genes in Stretched SC Cells

To identify glaucoma-related genes that are responsive to mechanical strain, the genes that were found to be differentially expressed in glaucoma SC cells were profiled in stretched SC cells in comparison with non-stretched SC cells (n = 3). The ddPCR results showed that nine glaucoma-related genes were significantly induced with mechanical strain (Table 4). The identified glaucoma-associated genes ABCA1, CAV2, CYP1B1, and GAS7 were induced by stretch, suggesting their potential role in the biomechanical function of SC cells. The extracellular matrix (ECM) genes DCN,, EZR, and FMOD showed significant alterations after stretch, corresponding to the ECM turnover in stretched cells.

Table 4.

Differentially Expressed Genes in Mechanically Stretched Primary Human SC Endothelial Cells

Gene	Description	Fold Change (Stretch)	P	TGFβ Relation
ABCA1	ATP binding cassette subfamily A member 1	1.65	0.02	ERK1/2, JNK
CAV2	Caveolin 2	1.25	0.044	JNK
CLDN23	Claudin 23	1.43	0.029	Indirect
CYP1B1	Cytochrome P450, family 1, subfamily B, member 1	1.44	0.05	JNK
DCN	Decorin	1.74	0.001	Direct
EZR	Ezrin	1.44	0.013	ERK
FMOD	Fibromodulin	1.57	0.048	Direct
GAS7	Growth arrest-specific 7	1.81	0.02	Indirect
TGFBR3	Transforming growth factor beta receptor 3	1.33	0.019	Direct

To determine the connections and potential regulators of these mechanoresponsive glaucoma-related genes, we performed pathway analysis and upstream regulator analysis using IPA software. Both analyses identified a key factor, TGFβ, which was associated with almost all genes of interest. Additionally, several connectors were revealed with the merged network generation of these mechanoresponsive genes, and TGFβ was found prominently at one of the nodes (Fig. 2). ABCA1 and CYP1B1 were related through the non-canonical pathways by c-Jun N-terminal kinase (JNK) or extracellular signal-regulated kinases 1 and 2 (ERK1/2), whereas CAV2, TGFBR3, and DCN were directly related to TGFβ regulation (Table 4). In addition, fibromodulin (FMOD) is a known modulator of TGFβ. Because the association of TGFβ as an upstream regulator was highly significant (P = 2.33 × 10–6) and all differentially expressed genes were engaged in the TGFβ pathway, we decided to further study the role of TGFβ on these mechanoresponsive glaucoma-related genes in bovine AAP cells first, followed by validation in human SC cells.

Figure 2.

Merged network of differentially expressed genes according to annotated information in the IPA database. The genes of interest are magnified and bolded. These genes are connected, directly (solid line) or indirectly (dotted line), to TGFβ pathways in the network shown here. Arrows point toward the object of regulation.

Puromycin Selection of AAP Cells

Primary cells cultured from bovine outflow tissues had a mixture of cell types with a variety of morphologies, including overlapping growth. After puromycin treatment, approximately two-thirds of the cells died, and the remaining cells repopulated to confluence in approximate 10 days. The confluent puromycin-selected cells formed a cobblestone-like monolayer with polygonal morphology and contact inhibition, which are characteristic features of endothelial cells that distinguish AAP cells from trabecular meshwork cells (Fig. 3). The immunofluorescent staining of intact bovine anterior chamber sections demonstrated specific expression of endothelial marker proteins in AAP cells, such as VWF, VE-cadherin, and tight junction protein 2 (TJP2) (Fig. 4). All of the puromycin-selected cells expressed the endothelial marker proteins VWF and VE-cadherin (Fig. 5), suggesting a successful selection and pure AAP culture.

Figure 3.

Phase-contrast microscopy of cultured bovine ocular cells from outflow tissues. (A) Prior to puromycin treatment, the different types of cells grew overlapped in the flask. (B) After exposure to puromycin, the remaining cells repopulated and displayed relatively uniform morphology.

Figure 4.

Expression of three endothelial marker proteins in stained sections of the TM region containing AAP visualized by immunofluorescence microscopy. The immunofluorescence images show the expression of vWF, VE-cadherin, and tight junction protein 2 (TJP2) by AAP cells. The endothelial marker proteins are shown in green, and nuclei are shown in blue. Asterisk shows location of aqueous plexus lumen. Scale bar: 50 µm.

Figure 5.

Expression of two endothelial marker proteins in puromycin-treated cells. The cells expressed typical endothelial markers vWF and VE-cadherin. All images are shown with the same magnification (20×). Scale bar: 50 µm.

TGFβ2 Treatment on AAP and SC Cells

Due to the variation between human and bovine genomes, bovine cells do not express several glaucoma-related genes found in humans, such as TGFBR3 and CLDN23. Therefore, we focused our investigation on three groups of functional genes related to TGFβ2 treatment, including TGFβ signaling pathway genes, glaucoma-related genes identified in stretched human SC cells, and cell adhesion genes related to the permeability of AAP cells (Table 5). We treated three batches of AAP cells and three strains of primary human SC cells with different concentrations of TGFβ2 at two time points to monitor changes in expression.

Table 5.

Genes Examined in the SC and AAP Cells Under TGFβ2 Treatment

Gene	Description	Functional Category
TGFBR1	Transforming growth factor beta receptor 1	TGFβ binding
SMAD2	SMAD family member 2	TGFβ binding
BMP4	Bone morphogenetic protein 4	TGFβ binding
CYP1B1	Cytochrome P450, family 1, subfamily B, member 1	Oxidoreductase activity
DCN	Decorin	Collagen binding
EZR	Ezrin	Actin filament binding
GAS7	Growth arrest-specific 7	Actin filament binding
CDH2	Cadherin 2	Cell–cell adhesion
TJP1	Tight junction protein 1	Cell–cell adhesion

The TGFβ SMAD signaling pathway was activated and BMP4 was downregulated (Fig. 6). We also found that four of the mechanoresponsive glaucoma-related genes responded to TGFβ2 treatment; for example, CYP1B1 and DCN were inhibited but EZR was induced in both AAP and SC cells. Although GAS7 showed different alterations between the two cell types, it responded significantly to the treatment in both. The effect was dependent on time and concentration, especially in human SC cells (Fig. 7). Because cell–cell adhesion between endothelial cells is one of the crucial characteristics to maintain integrity and function of SC endothelium, we examined the differential expression of these genes after TGFβ2 treatment. The mRNA expression of TJP2 or TJP1 had no significant increase after treatment; however, the cell–cell adhesion gene CDH2 (N-cadherin) was significantly induced (Fig. 8).

Figure 6.

Differential expression of TGFβ signaling pathway genes following TGFβ2 treatment in primary bovine AAP cells (n = 3) and human SC cells (n = 3). The expression level of the control group was set as 1.0-fold, and each treatment group was compared to corresponding control group with the same observation time. *P < 0.05; error bars, standard deviation.

Figure 7.

Differential expression of glaucoma-related genes following TGFβ2 treatment in primary bovine AAP cells (n = 3) and human SC cells (n = 3). *P < 0.05; error bars, standard deviation.

Figure 8.

Differential expression of cell adhesion genes following TGFβ2 treatment of primary bovine AAP cells (n = 3) and human SC cells (n = 3). *P < 0.05; error bars, standard deviation.

Discussion

We successfully isolated, characterized, and cultured endothelial cells from bovine AAP. The integrated analysis of glaucoma genetics and mechanoresponsive genes of human SC cells led to investigation of the TGFβ2 effect on our new cell model for human SC. We observed that bovine AAP and human SC cells responded similarly to TGFβ2 treatment, validating the usage of bovine AAP cells to study human SC cell biology.

Previously, we found differentially expressed genes in SC cells isolated from glaucomatous donor eyes, but the function of these genes in SC cells remains unclear. Because biomechanical strain is a trigger for pore formation in cultured human SC cells, we examined the differentially expressed genes in stretched SC cells. Interestingly, the glaucoma-related genes were induced in normal SC cells after mechanical stretch, whereas they were mostly downregulated in glaucomatous SC cells. These differences indicate the potential dysfunction of the mechanoresponsive pathways in glaucomatous SC cells, leading to fewer pore openings and a significant resistance that increases IOP.

Our pathway analysis of mechanoresponsive genes revealed TGFβ to be a common upstream regulator. Significantly, many previous studies have reported an increased level of TGFβ2 in aqueous humor of glaucomatous eyes. Moreover, perfusing TGFβ2 into human eyes leads to the accumulation of fibrillary ECM under the inner wall of SC and increased outflow resistance. Although the TGFβ2 effects on TM cells have been studied extensively,– this is the first study, to our knowledge, to report the effect of TGFβ2 on SC and AAP cells.

TGFβ2 can activate a large number of signaling pathways, which may be related to fibrosis and tissue stiffening as observed in glaucomatous eyes.– Based on the results from previous studies using TM cells, we examined activation of the canonical signaling pathway through the TGFβ receptor and BMP ligands. Thus, TGFBR1 expression was activated and BMP4 expression was suppressed. The activation of SMAD2 decreased over long-term treatment, indicating an early response to TGFβ2 treatment. We then examined the expression of glaucoma-related genes that were also mechanoresponsive. Interestingly, TGFβ2 inhibited the mechanoresponsive genes in SC cells, coincident with the dysfunction of these genes in glaucomatous SC cells. Finally, it is known that TGFβ promotes cell adhesion and tight junction assembly, which are integral for pore formation in the SC inner wall.,, We found that N-cadherin (CDH2) was significantly induced, but not tight junction protein (TJP1). The small effect on tight junction expression may be due to the subconfluence (80%) of cells at the beginning of TGFβ2 treatment.

The limited source of SC cells has interfered with progress in the study of SC cell biology. We were thus motivated to develop a “workhorse” in vitro cellular model for human SC cells. Bovine eyes are commonly used in the study of conventional outflow biology., For example, glucocorticoid treatment of bovine eyes induces ECM accumulation in the TM region containing AAP and causes ocular hypertension, similar to that seen in human eyes. Additionally, bovine TM cells have been a reliable and translatable model to human TM cells., However, the isolation of bovine AAP cells has been impeded by the tortuous AAP loops and small number of cells in each eye. Here, we demonstrate that the puromycin selection technique is a convenient method for purifying AAP cells from a mixed culture of bovine outflow cells. Our selected cells were validated by histological location, cobblestone-like morphology, contact inhibition, and standard endothelial markers. The TGFβ signaling pathway activation and glaucoma-related genes responded similarly to TGFβ2 treatment in human SC cells, supporting the usage of AAP cells as an alternative cellular model of SC cells.

The bovine cellular model also had limitations. First, due to the species variation, bovine cells express different types of proteins in comparison to humans; for example, bovine cells express TJP2/ZO-2 rather than TJP1/ZO-1, which is expressed in human cells. Second, the bovine donors are less than 1 to 2 years old, equivalent to teenage humans, which are younger than most human donors. The age difference likely contributes to the response diversity between these two models. The different responses of GAS7 between human and bovine cells may be attributed to either species or age variation. Third, with fewer variations in genetic background, the AAP cellular model generates a relatively more uniform response to treatment than human SC cells. DCN expression was suppressed in all strains of AAP cells, whereas three strains of human SC cells had distinct expressions of DCN with 24 hours of treatment. Therefore, the AAP cell appears to be a good model for initial studies, which can be later validated in human SC cells.

In summary, we identified glaucoma-related genes in human SC cells that robustly responded to a relevant mechanical stimulus. Significantly, these genes also respond to TGFβ2 treatment in SC cells, matching a pattern of gene expression previously observed in glaucomatous SC cells and supporting a vital role for TGFβ2 in glaucoma development. We observed a very similar pattern of gene expression changes in our novel and fully characterized bovine AAP cell model after TGFβ2 treatment. As in the TM, our data implicate TGFβ2 as a key player in glaucomatous changes in SC and support the utility of our bovine AAP cellular model in studying SC biology.