Literature DB >> 32817695

Genomic mapping identifies two genetic variants in the MC1R gene for coat colour variation in Chinese Tan sheep.

Gebremedhin Gebreselassie1,2, Benmeng Liang1, Haile Berihulay1, Rabul Islam1, Adam Abied1, Lin Jiang1, Zhengwei Zhao3, Yuehui Ma1.   

Abstract

Coat colour is one of the most important economic traits of sheep and is mainly used for breed identification and characterization. This trait is determined by the biochemical function, availability and distribution of phaeomelanin and eumelanin pigments. In our study, we conducted a genome-wide association study to identify candidate genes and genetic variants associated with coat colour in 75 Chinese Tan sheep using the ovine 600K SNP BeadChip. Accordingly, we identified two significant SNPs (rs409651063 at 14.232 Mb and rs408511664 at 14.228 Mb) associated with coat colour in the MC1R gene on chromosome 14 with -log10(P) = 2.47E-14 and 1.00E-13, respectively. The consequence of rs409651063 was a missense variant (g.14231948 G>A) that caused an amino acid change (Asp105Asn); however, the second SNP (rs408511664) was a synonymous substitution and is an upstream variant (g.14228343G>A). Moreover, our PCR analysis revealed that the genotype of white sheep was exclusively homozygous (GG), whereas the genotypes of black-head sheep were mainly heterozygous (GA). Interestingly, allele-specific expression analysis (using the missense variant for the skin cDNA samples from black-head sheep) revealed that only the G allele was expressed in the skin covered with white hair, while both the G and A alleles were expressed in the skin covered with black hair. This finding indicated that the missense mutation that we identified is probably responsible for white coat colour in Tan sheep. Furthermore, qPCR analysis of MC1R mRNA level in the skin samples was significantly higher in black-head than white sheep and very significantly higher in GA than GG individuals. Taken together, these results help to elucidate the genetic mechanism underlying coat colour variation in Chinese indigenous sheep.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 32817695      PMCID: PMC7444486          DOI: 10.1371/journal.pone.0235426

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Animal coat colour is one of the most important economic traits, particularly for animal breeds that are kept for skin and wool production. Coat colour is a highly useful trait that affects the behaviour of animals and is an essential trait for survival (to cope with the environment and biological factors) in different environmental conditions [1-3]. Moreover, animal coat colour has played a crucial role in breed identification, characterization [4] and other applications, such as fibre production in goat, rabbit and sheep breeds [5]. In fact domesticated species are also characterized by a huge allelic variability of coat-colour-associated genes which leads to negative pleiotropic effects linked with coat-colour variants [6]. Animal coat colour variation is mainly regulated by genetic and environmental factors [6]. Classical genetics assumes that the presence of eumelanin or phaeomelanin is genetically controlled by the extension and agouti locus [7]. In mammals, coat colour variation is determined by the biochemical function, distribution and availability of phaeomelanin and eumelanin pigments [8]. Phaeomelanin produces a red and yellow colour, whereas eumelanin produces black and brown phenotypes [8]. The relative amount of eumelanin and phaeomelanin colours in melanocytes is regulated by the interactions of agouti signalling protein (ASIP) and melanocortin 1 receptor (MC1R) genes [9, 10]. In addition to MC1R and ASIP, there are also other genes involved in coat colour variation such as melanocyte inducing transcription factor (MITF), tyrosinase related protein-1 (TYRP1) and v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homologue (KIT) [6, 11–15]. ASIP is a small paracrine signalling molecule that interacts with the extension locus encoded by the agouti locus [16]. ASIP has an antagonist function with MC1R in the pigmentation process. ASIP blocks the α-MSH receptor interaction, which causes pigment-type switching from eumelanin to phaeomelanin pigment [17, 18]. Thus, ASIP inhibits MC1R signalling and eumelanogenesis, and the antagonist function of ASIP promotes white and red colour against the black and brown phenotype [19-21]. The effect of ASIP on coat colour is determined by dominant or recessive agouti alleles. The dominant agouti alleles are responsible for phaeomelanin phenotypes and the recessive alleles for black coat colour [22]. Molecular variants have been reported in the ASIP gene associated with the coat colour phenotype in different sheep breeds, such as Finns sheep [23], Massese sheep [24], Soay sheep [25] and Australia merino sheep [4]. In contrast, the MC1R gene, also known as the α-melanocyte stimulating hormone receptor (α-MSHR), a seven-transmembrane G-protein coupled receptor, is encoded by an extension (E) locus [7]. The MC1R gene is reported as a potential candidate gene that plays a significant role in melanogenesis and wool pigmentation and is responsible for black coat colour in mammals [8, 26, 27]. For instance, several functional and non-functional molecular variants have been reported in the MC1R gene associated with coat colour phenotype in different sheep breeds such as Zandi, Baluchi and Zel sheep [28], Brazilian Crioula sheep [29], Manchega and Rasa Aragonesa sheep [30], Chinese sheep [15], Brazilian Creole sheep [8], Massese sheep [24], Xalda sheep [31], Norwegian Dala sheep [32]. Chinese indigenous sheep breeds are classified in 42 based on their geographical distribution and morphological characteristics. These sheep breeds are again categorized in three groups: Mongolian fat-tailed, Kazakh fat-rumped and Tibetan thin-tailed sheep (Fig 1A, 1B & 1C) [33]. Chinese Tan sheep are unique and typical sheep breeds that are employed for both fur and meat production and are categorized under the Mongolian fat-tailed sheep group. Tan sheep are widely distributed in northwestern China and famous for lamb pelt and lustrous white curly fleece production. These sheep are also renowned breeds for long-term adaptation to dry, cold and windy environments [34]. The coat colour of Chinese Tan sheep is solid white, and white with black and brown colours around the head, neck and face (Fig 1D). This coat colour variation among the Chinese Tan sheep was the main focus of our study. A genome-wide association study (GWAS) is a powerful and preferred approach to detect causal variants and define narrower genomic regions than Quantitative trait loci (QTLs). It is a hypothesis-free method to determine the associations between genetic regions and phenotypic traits in livestock and humans [35-37]. In sheep, GWAS was applied in Soay sheep for the first time to investigate horn types [35] and was subsequently applied to Corriedale sheep to examine the inheritance of rickets [36]. There are also GWAS reports for other traits in the Chinese sheep breed such as coat colour [13].
Fig 1

The typical image of the three categories of indigenous Chinese sheep breeds and Chinese Tan sheep.

(A) Mongolian-fat tailed sheep group, (B) Kazakh-fat rumped sheep group, (C) Tibetan-thin-tailed sheep group and (D) shows solid white, white with black head and brown face phenotype of Tan sheep gathered in Ningxia conservation farm, Ningxia province, China.

The typical image of the three categories of indigenous Chinese sheep breeds and Chinese Tan sheep.

(A) Mongolian-fat tailed sheep group, (B) Kazakh-fat rumped sheep group, (C) Tibetan-thin-tailed sheep group and (D) shows solid white, white with black head and brown face phenotype of Tan sheep gathered in Ningxia conservation farm, Ningxia province, China.

Materials and methods

Ethics approval

All the procedures involved in handling and collecting the samples from sheep were approved by the ethics committees of the Ministry of Agriculture of the People’s Republic of China (IASCAAS-AE-03).

Animals and samples

For GWAS, a total of 10 ml of blood from the jugular vein into a tube and phenotype data were collected from 75 Chinese Tan sheep from the Ningxia sheep conservation farm, Ningxia province, China. Among the sampled sheep, 29 were coded as cases (black head/face coat colour), whereas 46 were coded as controls (white coat colour sheep) (Fig 2). For gene expression analysis, tissue samples (n = 14) were collected from the skin of solid white sheep and black-head sheep. Similarly, for allele-specific expression (ASE) analysis, tissue samples (n = 14) were collected from the skin under the black hair and under the white hair part of the black-head sheep (from the same sheep). The tissues were collected via skin punch biopsy under anaesthesia and placed in liquid nitrogen. Moreover, blood samples (n = 10) and tissue samples (n = 14) were collected from white and black-head Tan sheep to validate the gene.
Fig 2

The coat colour phenotype of Chinese Tan sheep.

(A) Shows white with black coat colour phenotype, whereas (B) referred to solid white coat colour phenotype.

The coat colour phenotype of Chinese Tan sheep.

(A) Shows white with black coat colour phenotype, whereas (B) referred to solid white coat colour phenotype.

DNA and RNA extraction

Genomic DNA was extracted from 3-ml blood samples using Promega Wizard Genomic Purification according to the manufacturer’s protocol Kits, whereas RNA was extracted from skin tissue samples using the RNAprep Pure Kit (For Tissue). After DNA extraction, genotyping was performed using Illumina’s ovine 600K SNP HD BeadChip for GWAS work. For SNP identification, we performed polymerase chain reaction (PCR) using the reagent Phanta Max Super-Fidelity DNA Polymerase (Cat: P505-d1, Vazyme). Complementary DNA (cDNA) was also prepared from the extracted RNA samples using a PrimeScriptTM RT reagent kit for quantitative polymerase chain reaction (qPCR) and nested PCR.

Genome wide association study (GWAS)

A case–control model was applied to manipulate the genotype data (S1 File and S2 File) and phenotype data (S3 File). Both genotype data quality control and phenotype-genotype association data generation were performed using PLINK version 1.9 software [38]. Manhattan plots and QQ plots were generated using the qqman package in R v.3.3.2. Genomic regions and candidate genes were identified on the livestock genome browser (UCSC) using the sheep assembly Aug. 2012 (ISGC Oar_v3.1/oviAri3). Finally, gene and SNP annotation was performed using Ensemble genome browser 95 and NCBI.

Primer designing

Primers for qPCR, PCR and nested PCR were designed by Primer3Plus using the MC1R mRNA sequence (GenBank accession no. NM_001282528.1) and GAPDH mRNA sequences (GenBank accession no. NM_001190390.1). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a housekeeping gene for gene expression analysis. The primers were synthesized by Beijing Tianyihuiyuan Biotechnology Co. Ltd., Beijing-China (Table 1).
Table 1

Primer information for qPCR, nested PCR and PCR applications.

Primers namePrimer sequenceProduct sizeApplicationsLocus/SNPs
MC1R-F MC1R-RCTCTCCATCACCTACTACAACCCAGCATGTGGACATAGAGGAC102 bpFor qPCR14:14231948 (rs409651063)
GAPDH-F GAPDH-RGTCCGTTGTGGATCTGACCTGGAGACAACCTGGTCCTCAG130 bp
MC1R-F1 MC1R-R1GCTGGTGAGTCTTGTGGAGAGCCAAAGCCCTGATGAATGG562 bpFor Nested PCR & PCR14:14231948 (rs409651063)
MC1R-F2 MC1R-R2GTGAGCGTCAGCAACGTGACATAGAGGACGGCCATCAG366 bp
MC1R-F3 MC1R-R3CCACCTGCTCTGCTCTTCTAGGAGGGTGCTCAGTAGACAA466 bpFor PCR14:14228343 (rs408511664)

Abbreviations: F, forward primer; R, reverse primer.

Abbreviations: F, forward primer; R, reverse primer.

Polymerase chain reaction (PCR)

PCR was performed in a total volume of 26 μL containing 2xPhanta Max Buffer (12.5 μL), dNTP Mix (0.5 μL), Phanta Max Super-Fidelity DNA Polymerase (0.5 μL), ddH2O (8.5 μL), forward primer (1 μL), reverse primer (1 μL) and 2 μL of DNA. The PCR analysis was performed on an Applied Biosystems® Gene Amp® PCR System 9700 and programmed as follows: at 95°C initial denaturation for 5 min, 35 amplification cycles of 30 s denaturing at 95°C, 30 s annealing at 54°C and extension at 72°C for 2 min. The final extension was run at 72°C for 5 min. Agarose gel electrophoresis was carried out to determine whether the PCR products properly amplified the target region using 1.5% agarose, 50 ml 1X TAE buffer and 5 μL God view. The gel was checked using a molecular imager (Gel Doc XR, BIO-RAD). Care was taken to avoid DNA damage due to extended exposure to UV light.

cDNA preparation

The Complementary DNA (cDNA) was synthesized from 1 μg of DNase-treated RNA using a primeScriptTM RT reagent kit. First, we prepared a total volume of 10 μL of DNA elimination reaction containing 5× gDNA Eraser Buffer (2 μL), gDNA Eraser (1 μL), RNA (1 μL) and RNase Free ddH2O (6 μL). Next, 10 μL of master mix was composed of 5X PrimeScript Buffer 2 (4 μL), PrimerScript RT Enzyme Mix I (1 μL), RT primer Mix (1 μL) and RNase Free ddH2O (4 μL). Then, the DNA elimination reaction and master mix were mixed to prepare 20 μL of reverse transcription reaction. Finally, the cDNA solution was heated on a Veriti 96-well thermal cycler at 37°C for 15 min and at 85°C for 5 s. This solution was diluted with ddH2O and stored at 4°C for PCR, nested PCR and qPCR use. qPCR was performed in a total volume of 20 μL containing 10 μL of TB Green Premix Ex Taq, 0.4 μL of forward primer, 0.4 μL of reverse primer, 0.4 μL of ROX Reference Dye II, 2 μL of diluted cDNA and 6.8 μL of ddH2O. The cycling parameters were 95°C for 30 s followed by 40 cycles (95°C for 5 s, 60°C for 34 s and 95°C for 15 s) and a cycle (60°C for 1 min and 95°C for 15 s). Nested PCR was also prepared using two sets of primers (562 bp and 366 bp) (Table 1). The first PCR was prepared using the first set of primers in a total volume of 20 μL composed of 1 μL of forward primer, 1 μL of reverse primer, 10 μL of Master mix, 6 μL of ddH2O and 2 μL of cDNA solution. The cycling parameters were 95°C for 5 min, 34 cycles (95°C for 30 s, 60°C for 30 s and 72°C for 1 min) and 72°C for 2 min and held at 4°C. The second reaction was performed using the second set of primers and 1 μL of PCR product from the first PCR (instead of cDNA template). All other reaction components and cycling parameters remained the same as those of the first reaction. Agarose gel electrophoresis was carried out using 1.5% agarose, 50 ml 1X TAE buffer and 5 μL God view to amplify PCR products.

DNA genotyping and gene expression analysis

The gene (MC1R) and the genetic variants (rs409651063 and rs408511664) identified to be associated with the coat colour phenotype were confirmed using PCR approaches. For this, PCR products (from DNA and cDNA) were sequenced by Beijing Liuhe BGI Technology Co., Ltd. The DNA and cDNA sequence results were assembled, aligned and edited using MEGA 7.0.14 (7160202-x86_64) to identify the genetic variants and for allele-specific expression analysis. SNP positions were cross-checked and verified by Chromas version 2.6.4 software. Moreover, qPCR data were analysed using GraphPad Prism v6.04 to determine whether the MC1R gene is differentially expressed in white and black-head Chinese Tan sheep.

Results and discussion

Results

GWAS: after quality control was performed using missing genotype data (0.1), Hardy-Weinberg equilibrium (1e-5) and minor allele frequency (0.05), a total of 366,991 SNPs remained for the genome-wide association study. Then, we perform the GWAS using phenotype data and found a candidate genomic region spanning 14.228Mb-14.232Mb on chromosome 14. The genomic location (SNPs) was then ranked using their p-value (smallest to largest) (Table 2). The Manhattan plot result indicated the significant SNPs as top signals for the black-head phenotype at chromosome 14 (Fig 3A). Moreover, the quantile-quantile plot (QQ plot) was also examined to determine the validity of the P-value of the significant SNPs. The corresponding QQ plot showed a reasonable distribution of the SNPs on GWAS. Most of the SNPs followed the normal curve distribution; however, only a few significant SNPs deviated from the normal curve for the black-head coat colour phenotype (Fig 3B).
Table 2

GWAS results: genetic variants and their location, P-value, amino acid change and consequences.

SNPsChr:bpAllelesP-valueConsequence TypeAAGene
rs40851166414:14228343G/A2.47E-14upstream gene variantMC1R
rs40965106314:14231948G/A1.00E-13missense variantD/N
rs16090998714:14227752C/T6.62E-10upstream variantMC1R
rs40941779614:14213367G/A3.74E-09intron variantMC1R
rs41217611314:14216978C/T2.96E-07intron variantMC1R

Abbreviations: SNP, single nucleotide polymorphism; Chr, chromosome; BP, base pair position; AA, amino acid change.

Fig 3

GWAS results plotted using Manhattan and quantile-quantile plots.

(A) Manhattan plot for coat colour analysis. The horizontal red line denotes genome-wide significance (1e-12). The y-axis shows the -log10 (p) value, and the x-axis shows the chromosome number. (B) QQ plot: the -log10 (P-value) shows the normality of the observed (y-axis) and expected (x-axis) values. The red line shows a normal curve, -and blue indicates colour variation among individuals. The two blue dots on the top denote significant SNPs for the coat colour phenotype.

GWAS results plotted using Manhattan and quantile-quantile plots.

(A) Manhattan plot for coat colour analysis. The horizontal red line denotes genome-wide significance (1e-12). The y-axis shows the -log10 (p) value, and the x-axis shows the chromosome number. (B) QQ plot: the -log10 (P-value) shows the normality of the observed (y-axis) and expected (x-axis) values. The red line shows a normal curve, -and blue indicates colour variation among individuals. The two blue dots on the top denote significant SNPs for the coat colour phenotype. Abbreviations: SNP, single nucleotide polymorphism; Chr, chromosome; BP, base pair position; AA, amino acid change. We were also identified two significant SNPs (rs409651063 at 14.232 Mb position and rs408511664 at 14.228 Mb position) on chromosome 14, with −log10(P) = 2.47E-14 and 1.00E-13, respectively. These SNPs were identified on coding (CDS) and upstream regions of the MC1R gene. The consequence of the variant rs409651063 was a missense variant (g.14231948 G>A) causing an amino acid change (Asp105Asn); however, the second SNP (rs408511664) was an upstream variant (g.14228343G>A) (Table 2). The SIFT prediction value for the rs409651063 variant was smaller than 0.05 (SIFT score = 0.01). The effect of this genetic variant on MC1R protein function is deleterious. This finding suggested that MC1R signalling may be disrupted by the mutation.

Population genetic structure analyses

Population structure was performed to characterize the genetic relationship between the animals with two types of coat colour phenotypes (white Tan sheep and black-head Tan sheep) using principal component analysis (PCA). Accordingly, we observed a closer clustering pattern between the phenotypes implied that the animals are closely related (Fig 4).
Fig 4

Principal component analyses of white and black-head Tan sheep.

Validation of the GWAS results

After sequencing the DNA by Sanger sequencing, DNA genotyping revealed that all the individuals from the white phenotype were homozygous (GG), whereas all individuals from the black-head phenotype were heterozygous (GA) (DNA genotype, Table 3). Moreover, we performed allele-specific expression (ASE) analysis for the missense variant (rs409651063) to investigate the effects of the mutation in the skin samples covered with either white hair or black hair. The combined results of the DNA genotype and cDNA genotype of the missense variant (rs409651063) revealed that only allele G was expressed in the skin covered with white hair, while both G and A alleles were expressed in the skin covered with black hair (Table 3). This preference of the mutant G allele in the skin covered with white hair indicated that the resulting mutant MC1R protein may lead to dysfunction of black pigmentation in white skin.
Table 3

DNA genotyping and allele-specific expression (ASE) analysis for two candidate loci: chr14:14228343 (rs408511664) and chr14:14231948 (rs409651063).

blood samplecoat colour phenotypeDNA genotypeSkin samplehair colour of skincDNA genotype (14231948)
1422834314231948
B1black headGAGAB1-1blackGA
B1-2whiteGG
B2black headGAGAB2-1blackGA
B2-2whiteGA
B3black headGAGAB3-1blackGA
B3-2whiteGG
B4black headGAGAB4-1blackGA
B4-2whiteGA
W1whiteGGGGW1whiteGG
W2whiteGGGGW2whiteGG
W3whiteGGGGW3whiteGG
W4whiteGGGGW4whiteGG
W5whiteGGGGW5whiteGG
W6whiteGGGGW6whiteGG

Abbreviations: B1, black head sheep sample 1; B1-1, black colour skin from sample 1; B1-2, white colour skin from sample 1; B2, black head sheep sample 2; B2-1, black colour skin from sample 2; B2-2, white colour skin from sample 2, the same way of coding to other samples also.

Abbreviations: B1, black head sheep sample 1; B1-1, black colour skin from sample 1; B1-2, white colour skin from sample 1; B2, black head sheep sample 2; B2-1, black colour skin from sample 2; B2-2, white colour skin from sample 2, the same way of coding to other samples also. Furthermore, we performed qPCR for the missense variant (rs409651063) to evaluate the expression level of the MC1R gene in white and black-head phenotypes. Accordingly, MC1R mRNA was differentially expressed in the white and black-head phenotypes in Tan sheep. The expression level was significantly higher in sheep with black-head coat colour carrying the A allele than in white sheep (Fig 5A). The MC1R mRNA expression level in the skin samples was also significantly higher in the individuals carrying GA alleles than in the individuals carrying GG alleles (Fig 5B). The gene expression cycle threshold (Ct) value of MC1R and GADPH (reference) genes including replicates of each sample is available in the supplementary file (S1 Table).
Fig 5

Gene and allele expression level for white and black coat colours phenotype of Chinese Tan sheep.

(A) Comparison of gene expression (MC1R) in black-head and white colour sheep. (B) Expression level comparison between the GG genotype (white coat colour sheep) and GA genotype (black-head coat colour sheep) in the MC1R gene for the rs409651063 variant. The sign * is denoted for P < 0.05 and ** is for P <0.01.

Gene and allele expression level for white and black coat colours phenotype of Chinese Tan sheep.

(A) Comparison of gene expression (MC1R) in black-head and white colour sheep. (B) Expression level comparison between the GG genotype (white coat colour sheep) and GA genotype (black-head coat colour sheep) in the MC1R gene for the rs409651063 variant. The sign * is denoted for P < 0.05 and ** is for P <0.01.

Discussion

Chinese Tan sheep (widely distributed in northwestern China) are unique and typical sheep breed that are reared for both fur and meat production. These sheep are renowned for long-term adaptation to dry, cold and windy environments. The coat colour of this breed is characterized by sold white and white colours with black and brown colours around the head, neck and face [33]. Thus, it would be important to identify the genomic regions and genetic variants associated with coat colour traits in Tan sheep. In the present GWAS study, we identified a candidate gene (MC1R) and two significant genetic variants (rs409651063 and rs408511664) associated with coat colour in Tan sheep. This gene and the molecular variants were detected in the genomic region spanning 14.231 Mb-14.228 Mb on chromosome 14 (Table 2 and Fig 3A and 3B). According to Kijas et al. [30], a GWAS (SNP50 BeadChip) identified two SNPs (s26449 and s46705) closest to the MC1R gene on chromosome 14 in solid black and white Manchega and Rasa Aragonesa sheep associated with the coat colour phenotype. The variants were located 14.127 Mb upstream and 14.203 Mb downstream of the MC1R gene. However, the SNP density applied and the phenotype of sampled animals were not similar to those in our study. In a previous PCR study, three synonymous and two nonsynonymous variants of the MC1R gene were reported in completely black Chinese sheep (Minxian Black-fur breed). These variants of the MC1R gene were found to be associated with the black coat colour phenotype in the Minxian black-fur breed, although no complete association was reported in the black-face coat colour phenotype of Chinese sheep breeds (Tan, Tibetan, Duoland and Mongolian sheep) [15]. Moreover, Yang et al.[15] reported three haplotypes in the MC1R gene related to the black coat colour phenotype in Minxian black-fur sheep. In fact, in the present study, we identified a missense variant (g.14231948 G>A) causing p.Asp105Asn amino acid change and an upstream variant (g.14228343 G>A) (Table 2) in Chinese Tan sheep. This finding indicated that pigmentation variation in Chinese Tan sheep might be due to these genetic variants occurring on the CDS and upstream region of the MC1R gene. Fontanesi et al. [39] also reported missense and nonsense mutations in the MC1R gene in goat breeds. Moreover, several molecular studies, including GWAS, have been conducted to investigate the genetic variation in coat colour phenotype in sheep breeds. In such studies, the MC1R gene is labelled to be responsible for black colour phenotypes in sheep [5, 30, 40]. Muniz et al. [40] reported the seven most significant SNPs on chromosome 14 close to the MC1R gene in Morada Nova sheep in his GWAS study to investigate genome regions responsible for the coat colour phenotype. Furthermore, several SNPs have been observed in the MC1R gene in different animal species associated with the coat colour phenotype. For instance, in a recent study, two silent mutations in the 5' end of the coding region of the MC1R gene were detected in Iranian sheep breeds with synonymous effects on amino acid sequences [28]. However, generally, the MC1R gene is not the only genetic factor that determines the coat colour phenotype; there are also genes, such as ASIP, that are responsible for shaping the coat colour of sheep and other animal species [4, 5, 20, 23–25, 31]. We took one step further to validate the two variants identified in our GWAS analysis. We confirmed the association of deleterious substitution (rs409651063) and the upstream variant (rs408511664) with coat colour phenotype in an extra population using Sanger sequencing (DNA genotype, Table 3). Moreover, in our allele-specific expression analysis of the missense variant, we found that the mutant G allele was likely to be expressed in the skin of white hair from black head sheep, whereas the black part tended to express the reference A allele (cDNA genotype, Table 3). These results suggested that the missense mutation probably disrupted the black pigmentation receptor of MC1R and thus prevented normal pigmentation of the hair. The upstream variant (rs408511664) was also found to be associated with coat colour phenotype which might have regulatory effects of this mutation. Furthermore, the expression level of MC1R mRNA was significantly higher in sheep with black-head coat colour carrying the A allele than in white sheep (Fig 5A). Similarly, the MC1R mRNA expression was significantly higher in the individuals carrying GA alleles than in the individuals carrying GG alleles (Fig 5B). This finding showed that the MC1R gene has a great role in black-colour pigmentation process. The novel discovery of the two variants and allelic expression imbalance of the MC1R mutant and reference alleles helped to elucidate the mechanism of MC1R transcription and the genetic mechanism underlying coat colour in sheep. In conclusion, we identified a genomic region, a candidate gene and genetic variants associated with the coat colour phenotype in Chinese Tan sheep using GWAS and the Ovine 600K SNP BeadChip. The genetic variants in MC1R may affect the coat colour phenotype of Chinese Tan sheep; however, other genes might have their own role in the pigmentation-making process. Moreover, the MC1R gene expression level was significantly higher in black-head Tan sheep than in white sheep and significantly higher in GA alleles than in GG allele individuals. Thus, MC1R may have a significant role in regulating melanin synthesis and the development of black skin in Chinese Tan sheep. Furthermore, allele G was expressed in the skin covered with white hair, whereas both G and A alleles were expressed in the skin covered with black hair. Further studies are needed to explore other candidate genes, such as ASIP, and to determine their biological effect on coat colour formation in Tan sheep.

This is the S1 map data file used for GWAS in this study.

(MAP) Click here for additional data file.

This is the S2 ped data file used for GWAS in this study.

(PED) Click here for additional data file.

This is the S3 phenotype data file used for GWAS in this study.

(TXT) Click here for additional data file.

This is the S1 gene expression data file used for gene expression analysis.

(DOCX) Click here for additional data file.
  32 in total

1.  Molecular characterization of the mouse agouti locus.

Authors:  S J Bultman; E J Michaud; R P Woychik
Journal:  Cell       Date:  1992-12-24       Impact factor: 41.582

2.  Genomewide association for a dominant pigmentation gene in sheep.

Authors:  J W Kijas; M Serrano; R McCulloch; Y Li; J Salces Ortiz; J H Calvo; M D Pérez-Guzmán
Journal:  J Anim Breed Genet       Date:  2013-08-26       Impact factor: 2.380

3.  Differences in the expression of the ASIP gene are involved in the recessive black coat colour pattern in sheep: evidence from the rare Xalda sheep breed.

Authors:  L J Royo; I Alvarez; J J Arranz; I Fernández; A Rodríguez; L Pérez-Pardal; F Goyache
Journal:  Anim Genet       Date:  2008-03-31       Impact factor: 3.169

4.  Structural and molecular evolutionary analysis of Agouti and Agouti-related proteins.

Authors:  Pilgrim J Jackson; Nick R Douglas; Biaoxin Chai; Jonathan Binkley; Arend Sidow; Gregory S Barsh; Glenn L Millhauser
Journal:  Chem Biol       Date:  2006-12

5.  Identification of the e allele at the Extension locus (MC1R) in Brazilian Creole sheep and its role in wool color variation.

Authors:  D Hepp; G L Gonçalves; G R P Moreira; T R O Freitas; C T D C Martins; T A Weimer; D T Passos
Journal:  Genet Mol Res       Date:  2012-08-29

6.  Geographic distribution of environmental factors influencing human skin coloration.

Authors:  George Chaplin
Journal:  Am J Phys Anthropol       Date:  2004-11       Impact factor: 2.868

Review 7.  The color loci of mice--a genetic century.

Authors:  Dorothy C Bennett; M Lynn Lamoreux
Journal:  Pigment Cell Res       Date:  2003-08

8.  A gene duplication affecting expression of the ovine ASIP gene is responsible for white and black sheep.

Authors:  Belinda J Norris; Vicki A Whan
Journal:  Genome Res       Date:  2008-05-20       Impact factor: 9.043

9.  Epistatic Interaction of the Melanocortin 1 Receptor and Agouti Signaling Protein Genes Modulates Wool Color in the Brazilian Creole Sheep.

Authors:  Diego Hepp; Gislene Lopes Gonçalves; Gilson Rudinei Pires Moreira; Thales Renato Ochotorena de Freitas
Journal:  J Hered       Date:  2016-06-09       Impact factor: 2.645

10.  Sequence characterization of the MC1R gene in yak (Poephagus grunniens) breeds with different coat colors.

Authors:  Shi-Yi Chen; Yi Huang; Qing Zhu; Luca Fontanesi; Yong-Gang Yao; Yi-Ping Liu
Journal:  J Biomed Biotechnol       Date:  2009-06-29
View more
  2 in total

1.  Whole genome sequencing of Luxi Black Head sheep for screening selection signatures associated with important traits.

Authors:  Zhaohua Liu; Xiuwen Tan; Jianying Wang; Qing Jin; Xianfeng Meng; Zhongfeng Cai; Xukui Cui; Ke Wang
Journal:  Anim Biosci       Date:  2022-04-30

Review 2.  Genetics of the phenotypic evolution in sheep: a molecular look at diversity-driving genes.

Authors:  Peter Kalds; Shiwei Zhou; Yawei Gao; Bei Cai; Shuhong Huang; Yulin Chen; Xiaolong Wang
Journal:  Genet Sel Evol       Date:  2022-09-09       Impact factor: 5.100

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.