Literature DB >> 32757993

A case of congenital Rett variant in a Chinese patient caused by a FOXG1 mutation.

Yan Niu1, Lirong Cao2, Peng Zhao1, Chunguan Cai3.   

Abstract

Rett syndrome (RTT) is a severe progressive neurodevelopmental disease characterized by psychomotor regression. The FOXG1 gene is one of the pathogenic genes associated with the congenital Rett variant, which is less studied. Only a few Chinese patients with FOXG1 mutation have been reported. In this study, we describe a Chinese female patient with congenital Rett variant who presented with psycho-motor retardation, developmental regression, microcephaly, seizure, stereotypic hand movement and hypotonia. Targeted high-throughput sequencing was conducted, and a heterozygous FOXG1 mutation [NM_005249.4: c.506dupG (P.G169Gfs* 286)] was identified. It was a frameshift mutation resulting in alteration of the reading frames downstream of the mutation. SIMILAR CASES PUBLISHED: 10. CONFLICT OF INTEREST: None.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 32757993      PMCID: PMC7410221          DOI: 10.5144/0256-4947.2020.347

Source DB:  PubMed          Journal:  Ann Saudi Med        ISSN: 0256-4947            Impact factor:   1.526


INTRODUCTION

Rett syndrome (RTT) is a serious neurodevelopmental disorder predominantly in females with an incidence about 1 in 10 000 live births.[1] The MECP2 gene is the major pathogenic gene of RTT, which accounts for 95-97% of typical RTT cases and 50-70% of atypical RTT cases.[2] Mutations in the CDKL5 gene are correlated with the early-onset seizure variant of RTT. Additionally, the FOXG1 gene is associated with the congenital Rett variant, which is less studied. In 2008, Ariani et al[3] first recognized that the FOXG1 gene was correlated with the congenital Rett variant. The incidence is reported to account for 1.5-15% depending on different inclusion criteria.[2] There are more than 50 mutations reported in the literature.[4] The mutation types include missense mutation, deletion and duplication mutation as well as copy number variation involving the FOXG1 gene. Mutations of the FOXG1 gene associated with RTT are rarely found in Asians.[2] The mutation rate in China is also lower, as (0.7% in Chinese patients).[5] To our knowledge, only two reports with ten patients appear in the literature.[5,6] In this study, we present a Chinese patient with a congenital Rett variant caused by a mutation of FOXG1. Informed consent was obtained from all participants.

CASE

An 11-month-old female patient was admitted to our hospital due to psychomotor retardation after birth. She was a full-term spontaneous delivery after an uneventful pregnancy. Birthweight was 2900 g. The patient was the first child of healthy no-consanguineous parents. There was no family history of psychomotor retardation or relevant genetic diseases. She was unable to roll over, crawl and sit. Her head control was unsteady. She displayed repetitive thrusting of the tongue, stereotypical movement of the hands and sucking fingers. She did not respond to others. She ate little, and only slowly gained weight. Sleep disturbance was also observed with shortened sleep duration and she was easily woken. There was no history of seizure. On physical examination, her head circumference was 40.5 cm with closed anterior fontanel. Facial signs consisted of synophridia, slightly round nose, high palatomaxillary arch and micromandible. Additionally, she also had hypomyotonia of the upper limb, dystonia of the lower limb and hyperreflexia of the knee. Ocular investigation showed horizontal nystagmus, and the eye could not gaze. Gesell development scale evaluation showed the developmental quotient was seriously delayed with a score of 27 in adaptability, 19 in gross motor, 24 in fine motor, 22 in language, 10 in person-society. International scoring system score was 23. Routine chromosome analysis showed 46, XX karyo-type. On nerve electrophysiological examination, somatosensory evoked potential revealed abnormality of cortical segment in extremity. Visual evoked potential displayed an almost normal right latent period with decreased amplitude. Electroencephalogram (EEG) revealed middle amplitude sharp waves in the bilateral occipital region (). Cerebral magnetic resonance imaging (MRI) displayed dysplasia of the corpus callosum, and the frontal and parietal lobes ().
Figure 1.

EEG showing middle amplitude sharp waves in the bilateral occipital region. The 5~7 Hz theta rhythm was dominant, and bilateral cerebral hemispheres were roughly symmetrical.

Figure 2.

Cerebral MRI a) Sagittal MRI of the brain revealed wide extracerebral space and enlarged frontal gyrus; b) Cerebral coronal MRI displayed hypoplasia of the corpus callosum.

EEG showing middle amplitude sharp waves in the bilateral occipital region. The 5~7 Hz theta rhythm was dominant, and bilateral cerebral hemispheres were roughly symmetrical. Cerebral MRI a) Sagittal MRI of the brain revealed wide extracerebral space and enlarged frontal gyrus; b) Cerebral coronal MRI displayed hypoplasia of the corpus callosum. During a follow-up period of 18 months, she suffered tonic clonic seizures at the age of 16 months. The EEG result was the same as before. At the age of 29 months, she could only take a small amount of liquid diet with severe salivation. The development was delayed with the height of 90 cm (-2SD) and weight of 1250 g (-1SD). She was able to crawl a short distance, but she did not sit alone. The bilateral ankle joint became contracted with limitation of dorsiflexion. Eye contact, attention and purposeful hand use were improved but at the age of 40 months, she presented with regression in the cognitive ability, language, motor and sociality. She could recognize a family member before, but at 40 months she could not distinguish a family member from a stranger. She could say mother and father before, but could not speak any words. With respect to sociality, she could express emotion and play simple games with others as before, but could not respond to external stimuli. In motor skills, she even lost the ability to grasp things to her mouth.

Gene mutation analysis

Genomic DNA extraction

This study was approved by the medical ethics committee. Informed consent was obtained from the guardians of the patient. Blood samples were collected from the peripheral venous blood of the patient and her parents. Subsequently, genomic DNA was extracted from blood samples using DNA Extraction Kit (Tiangen Biotech Co., Ltd., Beijing, China) according to the manufacturer's instructions. The quality and quantity of DNA were quantified by Thermo Fisher Multiskan FC (Thermo Labsystems, Multiskan FC, USA). The purity and concentration were measured by calculating the absorbance at 260 nm and 280 nm. Pure DNA has an A260/A280 ratio of 1.7-1.9.

Targeted high-throughput sequencing

The high-throughput sequencing was conducted by the Illumina HiSeq 2500 platform (Illumina, United States). Briefly, the library was first constructed after sheared, end-repaired, adaptors ligated, size selected, PCR amplified and normalized with special kits or devices. The library was prepared using the NimbleGen SeqCap EZ Choice Kit (Roche, Switzerland). Referred to the relevant literature and the OMIM database (), approximately 4000 genes related to RTT and psychomotor retardation were involved, such as CDKL5, FOXG1, CNTNAP2, FOLR1, FOXG1 and so on.

Candidate mutation confirmation by Sanger sequencing

The candidate variant was confirmed by Sanger sequencing among the patient and her parents. The specific primers were designed using Primer3 (). The primers were as follows: F: TACATGACTTGCCAGCGCCCGAGCC; R: CCCACATTGC ACCTCGCTGA CACTCC. The reaction condition was as below: pre-denaturation at 95’ for 5 minutes and 30 cycles of denaturation at 95’ for 30 s, annealing at 65’ for 30s and extension at 72’ for 10s. The amplification products were sequenced by ABI 3730 DNA Sequencer (Applied Biosystems, CA, USA). The Sanger sequencing data were analyzed by DNASTAR software.

Chromosomal microarray analysis

The DNA sample was detected by Affymetrix CytoScan HD Array (Affymetrix, USA). Data analysis was performed using the software of Affymetrix® Chromosome Analysis Suite 2.0.

RESULTS

A heterozygous mutation of FOXG1 gene [NM_005249.4: c.506dupG (P.G169Gfs*286)] was detected in the patient, which has been reported previously.[4] It was a de novo mutation, which was not inherited from her parents (). It resulted in the frameshift at 169 position of the protein, and caused an alteration of the reading frames downstream of the mutation. The detection of other genes was negative. The chromosomal microarray analysis showed no copy number variants with clinical significance.
Figure 3.

Sequencing diagram of the region verified by Sanger sequencing. a. A FOXG1 mutation [NM_005249.4: c.506dupG (P.G169Gfs* 286)] was detected in the patient. b. Her mother did not show an unusual genotype at the locus; c. Her father had a normal genetic sequence at the locus.

Sequencing diagram of the region verified by Sanger sequencing. a. A FOXG1 mutation [NM_005249.4: c.506dupG (P.G169Gfs* 286)] was detected in the patient. b. Her mother did not show an unusual genotype at the locus; c. Her father had a normal genetic sequence at the locus. A literature search was performed on the Pubmed () from the time when the library was built to February 2018. The search terms were RTT, Rett syndrome and FOXG1 mutation. Studies were considered eligible if complete clinical data were contained including age of onset, clinical features and imaging data. Twenty relevant reports were retrieved from the databases, but only 10 were selected due to incomplete or obscure clinical data (). Among these, there are 18 patients with congenital Rett variant caused by FOXG1 mutation. There are 18 variants of FOXG1 including 8 frameshift, 5 nonsense and 5 missense mutations. Except for two cases,[5,7] no family history was reported.
Table 1.

The clinical features of patients with congenital Rett variant caused by FOXG1 mutation.

ReferenceZhang et al[5]Harada et al[8]Byun et al[2]Das et al[9]Ellaway et al[10]Takahashi et al[11]Mencarelli et al[7]Philippe et al[12]Bahi-Buisso et al[13]Le Guen T et a[14]This case
Cases31111242211
Age of onset0-3 monthsCCC-CC4-6 months2-3 monthsCC
MicrocephalyYYYYYYYYYYY
Height or weight abnormality--YY-121YYY
HypotoniaYY-YYYY1YYY
Scoliosis----N111Y-N
WalkingNNYNNNN1NNN
Limited hand functionYYYYYY2YYYY
Stereotypes of upper limbYYYYYY3YYYY
Motor retardationYYYYYYYYYYY
Dysgnosia-Y--Y-----Y
SpeechYYYYYYYYYYY
Attention disorderYYYYYYYYYYY
EpilepsyYYYYYY211-Y
EEG abnormalitYY-YY-Y-11YY
Hypoplastic corpus callosum, frontal and temporalYYYYNY211YY
Delayed myelinationYYY-Y---YYN
Sleep disturbance2YY-YY21YYY
Mood abnormality-YY--Y-1-YN
Dysphagia, feeding difficulties2--YYY11YYY
Mutation of FOXG1c.858duC; c.454dupG; c.972 dupT;c.569T>Ac.209A>Cc.788_792delACGTGc.256dupCc.256dupC;c.689G>Ac.681C>G; c.643T>C;c.551_552insC; c.624C>Gc.924G>A; c.1200C>Gc.1248C>G; c.460_461dupGc.256_257dupCc.506dupG
Geographical distributionChinaJapanKorenIndianAustrali-aJapanItalyFranceFranceFranceChina

C: congenital, hyphen no information.

The clinical features of patients with congenital Rett variant caused by FOXG1 mutation. C: congenital, hyphen no information.

DISCUSSION

RTT is a serious neurodevelopmental disorder involving defects in motor, cognitive and social ability. The FOXG1 gene is one of the pathogenic genes of congenital Rett variant. In 2008, Ariani et al[3] first recognized that the FOXG1 gene was correlated with the congenital Rett variant. The mutation rate of FOXG1 is lower. The reported incidence is as low as 1.5% or as high as 15% depending on the inclusion criteria.[2] In China, the main pathogenic gene of RTT is the MECP2 gene. The mutation of FOXG1 is rarely reported.[5,6] The mutation rate is 0.7% in Chinese patients.[5] In 2017, Zhang Q et al[5] described the first report of FOXG1 mutations in Chinese patients, including c.858dupC (p.K287Qfs*168), c.454dupG (p.E154Gfs*301), c.972dupT (p.L325Ffs*130), c.694A>T (p.N232Y). Subsequently, Zhang Q et al[6] reported 471 patients associated with Rett and Rett-like syndrome. Only four patients carried the variants of FOXG1 including c.858dupC (Lys287Glnfs*168), c.893C>A (Thr298Asn), c.775C>T (Pro259Ser), c.694A>T (Asn232Tyr). In this study, another mutation of NM_005249.4: c.506dupG (p.G169Gfs*286) was identified in a Chinese patient, which was a novel variant in Chinese patients. FOXG1 gene is located in 14q12, which encodes the FOXG1 protein. The protein is a multidomain protein comprising three domains, including the forkhead DNA-binding domain (amino acids 181-275), the Gro-binding domain (amino acids 307-317), KDM5B binding domain (amino acids 383-406). In this study, the mutation [NM_005249.4: c.506dupG (P.G169Gfs*286)] is located at the 169 position of the protein. It may cause an abnormal truncated protein lacking the forkhead DNA-binding domain, which makes it non-functional. In this study, the patient presented with psychomotor retardation, microcephaly, seizure, stereotypic hand movement, hypotonia and developmental regression, which was consistent with the diagnostic criteria of congenital Rett variant.[1] Compared with other types of RTT, the congenital Rett variant caused by the FOXG1 mutation is characterized by congenital or early onset, acquired microcephaly, serious language defect, attention and social deficit, seizure, feeding difficulty, developmental delay, psychomotor regression and stereotypic hand movement.[15] Among the 19 cases (18 from the literature and one of our own), onset is after birth in most patients. The regression period is not identified in the majority probably due to the severe developmental delay in the early onset.[8] All patients present with shared characteristics of congenital or acquired microcephaly, movement retardation, language and attention disorder.[2,5,7-14] Several clinical features are also manifested in some patients: hypotonia, sleep disturbance, stereotypical upper limb, hand function disorder and mood abnormality. Microcephaly may be related to the role of FOXG1 in the development of telencephalon.[14] The seizure types are unspecific and include generalized tonic-clonic seizures, drop attacks, myoclonic seizures, atonic seizures and generalized tonic seizures. The symptoms of seizure are relatively slight compared with CDKL-5 related seizure and are easily controlled with less than three antiepileptic drugs.[2] Eleven patients including our case presented with dysphagia or feeding difficulty.[5,7,9-14] The muscles involved in swallowing mostly are voluntary motor muscles. They are prone to be complicated with dysmyotonia, which may be the cause of dysphagia or feeding difficulty. Malnutrition is common. Ten patients in this study had height and weight abnormalities. Several older cases were even treated by long-term nasal feeding or by a fistula in the digestive tract to improve nutrition.[11,13] It is suggested that dysphagia is the predominant cause of physical development disorder. Thus, therapy for dysphagia is the main part of clinical care. In addition, only a few reports described symptoms of scoliosis, strephenopodia and joint contracture in older patients, which may be correlated with the shorter long-term follow up.[7,11,13] Thus, we think it is necessary to prevent bone malformation in the early stage of the disease. On imaging, cerebral MRI usually reveals delayed myelination or hypomyelination, atrophy of frontal and temporal lobes with gyral simplification as well as a hypoplastic corpus callosum.[2,5,7-8,10-13] Hypoplastic hip pocampus has also been reported.[8] The management of congenital Rett variant caused by FOXG1 is still challenging. There is no effective therapy method at present. Early comprehensive rehabilitation treatment is advised. The nervous system symptoms such as epilepsy and dystonia, can be treated with medicine. As for the treatment of patients with dysphagia or feeding difficulty, the proper feeding method should aim to improve the physical state of nutrition to prevent early skeletal deformity during the process of clinical treatment.
  15 in total

1.  Novel mutation in forkhead box G1 (FOXG1) gene in an Indian patient with Rett syndrome.

Authors:  Dhanjit Kumar Das; Vaishali Jadhav; Vikas C Ghattargi; Vrajesh Udani
Journal:  Gene       Date:  2014-01-09       Impact factor: 3.688

Review 2.  A FOXG1 mutation in a boy with congenital variant of Rett syndrome.

Authors:  Tangui Le Guen; Nadia Bahi-Buisson; Juliette Nectoux; Nathalie Boddaert; Yann Fichou; Bertrand Diebold; Isabelle Desguerre; Florence Raqbi; Valérie Cormier Daire; Jamel Chelly; Thierry Bienvenu
Journal:  Neurogenetics       Date:  2010-08-24       Impact factor: 2.660

Review 3.  Thin genu of the corpus callosum points to mutation in FOXG1 in a child with acquired microcephaly, trigonocephaly, and intellectual developmental disorder: a case report and review of literature.

Authors:  Caroline De Bruyn; Tim Vanderhasselt; Ibrahim Tanyalçin; Kathelijn Keymolen; Katrijn L Van Rompaey; Linda De Meirleir; Anna C Jansen
Journal:  Eur J Paediatr Neurol       Date:  2013-12-06       Impact factor: 3.140

Review 4.  Epilepsy in Rett syndrome, and CDKL5- and FOXG1-gene-related encephalopathies.

Authors:  Renzo Guerrini; Elena Parrini
Journal:  Epilepsia       Date:  2012-09-21       Impact factor: 5.864

5.  14q12 microdeletions excluding FOXG1 give rise to a congenital variant Rett syndrome-like phenotype.

Authors:  Carolyn J Ellaway; Gladys Ho; Elisa Bettella; Alisa Knapman; Felicity Collins; Anna Hackett; Fiona McKenzie; Artur Darmanian; Gregory B Peters; Kerry Fagan; John Christodoulou
Journal:  Eur J Hum Genet       Date:  2012-09-12       Impact factor: 4.246

6.  FOXG1 is responsible for the congenital variant of Rett syndrome.

Authors:  Francesca Ariani; Giuseppe Hayek; Dalila Rondinella; Rosangela Artuso; Maria Antonietta Mencarelli; Ariele Spanhol-Rosseto; Marzia Pollazzon; Sabrina Buoni; Ottavia Spiga; Sara Ricciardi; Ilaria Meloni; Ilaria Longo; Francesca Mari; Vania Broccoli; Michele Zappella; Alessandra Renieri
Journal:  Am J Hum Genet       Date:  2008-06-19       Impact factor: 11.025

7.  Rett syndrome: revised diagnostic criteria and nomenclature.

Authors:  Jeffrey L Neul; Walter E Kaufmann; Daniel G Glaze; John Christodoulou; Angus J Clarke; Nadia Bahi-Buisson; Helen Leonard; Mark E S Bailey; N Carolyn Schanen; Michele Zappella; Alessandra Renieri; Peter Huppke; Alan K Percy
Journal:  Ann Neurol       Date:  2010-12       Impact factor: 10.422

8.  FOXG1 Mutation is a Low-Incidence Genetic Cause in Atypical Rett Syndrome.

Authors:  Christine K Byun; Jin Sook Lee; Byung Chan Lim; Ki Joong Kim; Yong Seung Hwang; Jong-Hee Chae
Journal:  Child Neurol Open       Date:  2015-02-10

9.  Correction: Genomic mosaicism in the pathogenesis and inheritance of a Rett syndrome cohort.

Authors:  Qingping Zhang; Xiaoxu Yang; Jiaping Wang; Jiarui Li; Qixi Wu; Yongxin Wen; Ying Zhao; Xiaoying Zhang; He Yao; Xiru Wu; Shujie Yu; Liping Wei; Xinhua Bao
Journal:  Genet Med       Date:  2019-09       Impact factor: 8.822

10.  Novel FOXG1 mutations in Chinese patients with Rett syndrome or Rett-like mental retardation.

Authors:  Qingping Zhang; Jiaping Wang; Jiarui Li; Xinhua Bao; Ying Zhao; Xiaoying Zhang; Liping Wei; Xiru Wu
Journal:  BMC Med Genet       Date:  2017-08-29       Impact factor: 2.103

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.