Literature DB >> 32735560

Unraveling the molecular pathobiology of vocal fold systemic dehydration using an in vivo rabbit model.

Naila Cannes do Nascimento1, Andrea P Dos Santos2, M Preeti Sivasankar1, Abigail Cox2.   

Abstract

Vocal folds are a viscoelastic multilayered structure responsible for voice production. Vocal fold epithelial damage may weaken the protection of deeper layers of lamina propria and thyroarytenoid muscle and impair voice production. Systemic dehydration can adversely affect vocal function by creating suboptimal biomechanical conditions for vocal fold vibration. However, the molecular pathobiology of systemically dehydrated vocal folds is poorly understood. We used an in vivo rabbit model to investigate the complete gene expression profile of systemically dehydrated vocal folds. The RNA-Seq based transcriptome revealed 203 differentially expressed (DE) vocal fold genes due to systemic dehydration. Interestingly, function enrichment analysis showed downregulation of genes involved in cell adhesion, cell junction, inflammation, and upregulation of genes involved in cell proliferation. RT-qPCR validation was performed for a subset of DE genes and confirmed the downregulation of DSG1, CDH3, NECTIN1, SDC1, S100A9, SPINK5, ECM1, IL1A, and IL36A genes. In addition, the upregulation of the transcription factor NR4A3 gene involved in epithelial cell proliferation was validated. Taken together, these results suggest an alteration of the vocal fold epithelial barrier independent of inflammation, which could indicate a disruption and remodeling of the epithelial barrier integrity. This transcriptome provides a first global picture of the molecular changes in vocal fold tissue in response to systemic dehydration. The alterations observed at the transcriptional level help to understand the pathobiology of dehydration in voice function and highlight the benefits of hydration in voice therapy.

Entities:  

Mesh:

Year:  2020        PMID: 32735560      PMCID: PMC7394397          DOI: 10.1371/journal.pone.0236348

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Vocal folds are a viscoelastic multilayered structure located in the larynx composed of a stratified squamous epithelium and lamina propria overlying the thyroarytenoid muscle [1, 2]. The epithelium is the outermost layer of the vocal fold and, together with the mucus, is the first barrier to protect the vocal folds from insults [3, 4]. It serves as an essential defense mechanism, and its association with voice health has become more understood over the past two decades [5-8]. The epithelial physical barrier is sustained by cell junctions, comprising tight junctions, adherens junctions, desmosomes, hemidesmosomes, and gap junctions. Cell junctions maintain tissue integrity by holding adjacent cells together and by anchoring the basal cell layer to the extracellular matrix; in addition, they regulate the paracellular transport of water and solutes [9, 10]. The maintenance of the epithelial barrier depends on the cell junction formation, distribution, and stability. Common, everyday insults, including irritants such as pollutants and laryngopharyngeal reflux (LPR), phonotrauma, and surgical procedures may cause epithelial barrier dysfunction, weakened vocal fold defense, and impaired voice production [6, 7, 11–16]. Maintaining hydration levels remains a core recommendation by voice specialists to sustain optimal vocal fold health and to prevent voice disorders such as vocal fatigue [17-22]. Systemic dehydration is characterized by reduced fluid within the body and can have many causes as simple as decreased water consumption and increased physical activity to more severe body fluid losses as a consequence of vomiting and diarrhea [23-27]. Experimentally, systemic dehydration is commonly induced by water withholding, with or without food access, or use of diuretics, or a combination of both [28-33]. Furosemide is a diuretic with a relatively fast onset of action that has been used to induce dehydration in numerous studies with animal and human subjects [25, 30, 34–38]. Regarding hydration and vocal folds, studies completed ex vivo and using animal and human subjects have shown that surface (i.e., fluid coating the vocal fold surface) and systemic hydration status have impacts on vocal fold biomechanics and physiology [12, 21, 30, 32, 39]. Although these studies provide some evidence on the benefits of hydration on vocal health, the impact of dehydration on laryngeal biology is still not fully elucidated [40]. Thus, unraveling the molecular mechanisms of dehydration is highly desired to support and possibly improve and personalize the standard clinical recommendation of increased hydration of the vocal folds [21, 22]. There is a paucity of molecular studies on vocal fold biology using in vivo models, with a number of studies analyzing the expression of specific genes or proteins based on their predicted functions rather than looking at the whole expression profile [41-44]. Despite the increase of publications on vocal folds transcriptome (microarray or RNA sequencing-based) and proteome analysis, most of the published studies are focused on investigating the expression profiles of challenged vocal fold fibroblasts alone [45-50] or normal mucosa [51]. A comprehensive investigation of the pathobiology of vocal fold tissue in response to insults has yet to be explored. The first step to unveil the underlying mechanisms of vocal fold response to a given challenge is to apply a high-throughput approach to identify global molecular signatures instead of investigating the effect of single genes or proteins. Second, the analysis of the entire tissue would help to understand the role of each vocal fold layer in the presence of such challenge. And last but not least, the use of an in vivo model would reflect the response of the tissue interacting with the system as a whole. These three steps combined would provide a physiologically realistic picture of the impact of a targeted condition in the vocal fold biology. RNA sequencing (RNA-Seq) is a high-throughput technique based on deep-sequencing technology widely used to analyze gene expression nowadays [52]. In contrast to the hybridization-based microarray technique, RNA-Seq determines the sequence of each cDNA in a given sample. Moreover, RNA-Seq does not have the limitations of high background noise and lower dynamic range of detection due to background and saturation of signals seen on microarrays [52-54]. We hypothesized that systemic dehydration causes transcriptional changes in genes related to structure and biomechanical properties, responsible for optimal vocal fold function, in the different tissue layers of the vocal folds. Thus, our study aimed to apply the RNA-Seq approach to evaluate the effects of systemic dehydration in vocal fold tissue at the transcriptional level. To obtain physiologically realistic and translatable results, we used an in vivo animal model. Rabbit vocal fold has been used as a translational model for phonation and wound healing studies [55-59]. Therefore, we used rabbits treated with furosemide to stimulate body fluid loss as an in vivo model of acute systemic dehydration. The complete transcriptome of vocal fold tissue from dehydrated rabbits was compared to vocal folds from control animals treated with saline. We present herein the differentially expressed gene profile of systemically dehydrated vocal folds, which is marked by the downregulation of cell adhesion components. This transcriptome dataset is a new resource to explore the vocal fold’s molecular mechanisms in response to systemic dehydration and to understand the clinical recommendation of hydration therapy at a deeper level.

Materials and methods

Animals and study design

This study followed all recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The animal protocol was approved by the Purdue Animal Care and Use Committee under the number 1606001428. Fourteen 6-month-old male New Zealand White rabbits, acquired from Covance Inc. (New Jersey, USA), were subjects in this study. Rabbits were kept in individual perforated solid-bottom cages, with enrichment toys, in optimal temperature (15–20°C) and humidity-controlled (~40%) room with a 12h light/12h dark schedule at Purdue University animal facility during the study. Individual housing is recommended for male rabbits, which should be separated from other males at sexual maturity (12 to 14 weeks) to avoid aggressive behavior, but maintaining visual and olfactory contact with other rabbits (https://www.nc3rs.org.uk/3rs-resources/housing-and-husbandry/rabbits) [60]. Socialization training, consisting of food enrichment (hay) and human interaction (petting) was part of the acclimatization protocol to reduce stress for the rabbits and facilitate animal handling at the time of the study [61]. Animals were fed Teklad Global Rabbit Diet 2031 (Envigo, Madison, WI, USA) and hay and received water ad libitum until the day of the experiment. After one week of acclimation, animals were randomly divided into control (N = 6) and dehydrated (N = 8) groups. To reduce variability in the baseline hydration levels, all animals were pre-hydrated with 0.1 M sucrose solution for 48h prior to the experiment. Sucrose water is preferred over regular drinking water in rabbits [62]. The average body weight of all rabbits on the day of the experiment was 3.44 Kg (range of 3.04 to 3.89 Kg). To induce systemic dehydration of 5% body weight fluid loss (accepted range of 4.5–5.5%), rabbits received an IP injection of 5.0 mg/Kg of furosemide (50 mg/mL) (Salix Pharmaceuticals, Inc., Bridgewater Township, NJ, USA) and food and water were withheld. Control rabbits received IP injection of saline, to prevent animal handling from being a confounding variable and an unwanted source of variation between groups, and had access to food and water ad libitum. The volume of injectates was on average 0.34 mL/rabbit per IP injection. Dehydrated rabbits were weighed hourly after the furosemide injection. Rabbits received a second injection if body weight loss was less than 4% after 4 hours based on a pilot study where we observed that animals decreased or ceased urination frequency after 4 hours from first furosemide administration. Euthanasia was completed when dehydrated rabbits achieved 4.5–5.5% body weight loss (after ~3 to 6 h); control rabbits were euthanized immediately after dehydrated rabbits.

Blood collection and analyses

Whole blood samples were collected into heparinized tubes prior to IP injection and before euthanasia to evaluate systemic dehydration markers such as hematocrit (HCT), total plasma proteins (TPP; g/dL), plus eleven blood analytes incorporated in the i-STAT Chem8+ cartridge (Abaxis by Zoetis Inc., Parsippany-Troy Hills, NJ, USA). The blood analytes evaluated included creatinine (mg/dL), blood urea nitrogen (BUN; mg/dL), glucose (mg/dL), sodium (mmol/L), chloride (mmol/L), potassium (mmol/L), total CO2 (mmol/L), ionized calcium (iCa; mmol/L), anion gap (mmol/L), HCT (%), and hemoglobin (g/dL). Packed cell volume (PCV) was also measured using heparinized microhematocrit capillary tubes (Thermo Fisher Scientific, Waltham, MA, USA) centrifuged at 15,000 × g for 2 minutes and immediately verified using a microhematocrit reader card. TPP was assessed on the plasma using a Reichert′s VET 360 refractometer (Ametek Reichert Technologies, Depew, NY, USA). The blood analyte values were recorded pre and post-dehydration. Percentage change of the blood parameters was calculated as final value (post-dehydration)–initial (baseline)/ initial*100, and compared between groups to verify systemic dehydration.

Vocal fold collection and RNA extraction

The larynges and proximal trachea of each rabbit were excised immediately following euthanasia (1.0 mL IV dose of Beuthanasia-D Special, Schering Plough Animal Health Corp. Union, NJ, USA) and placed in a Petri dish on ice. Forceps held each larynx at the level of the trachea. A sagittal cut through the cricoid cartilage along the posterior surface of the larynx exposed the vocal fold mucosa. The edges of the opened larynx were pinned onto a wax surface and placed under a dissection microscope. Arytenoid cartilages identified the transverse level of the glottis where the vocal folds reside in the larynx. The soft tissue of the vocal fold (mucosa and thyroarytenoid muscle) was excised bilaterally and in its full depth until reaching the thyroid cartilage on the anterior surface using microdissection scissors. Two sections of approximately 3 mm length X 2 mm depth were immediately placed into sterile tubes containing RNAlater® Stabilization Solution (Invitrogen™ by Thermo Fisher Scientific) and stored at -80°C until RNA extraction. The entire microdissection procedure was accomplished in about 5 minutes per larynx. Total RNA was extracted using RNeasy Fibrous Tissue Mini Kit, including on-column DNAse I digestion step (QIAGEN, Hilden, Germany), following manufacturer’s instructions. The concentration and quality of RNA were assessed by spectrophotometry (NanoDrop™, Thermo Fisher Scientific) and Agilent 2100 Bioanalyzer with an Agilent RNA 6000 Nano Kit (Agilent Technologies, Inc., Santa Clara, CA, USA).

RNA sequencing and differential gene expression analysis

Ten vocal fold samples (4 control and 6 dehydrated) were used for RNA sequencing (RNA-Seq). All RNA samples had an RNA Integrity Number (RIN) of 7.3 or higher (Agilent 2100 Bioanalyzer). Library construction (RNA polyA) and RNA-Seq were performed by the Purdue Genomics Core Facility using Illumina NovaSeq (Illumina Inc., San Diego, CA, USA). Briefly, the Universal Plus mRNA-Seq with NuQuant library preparation kit (NuGEN Technologies, Inc., Tecan Group Ltd., Männedorf, Switzerland) was used to construct the libraries (200 ng of RNA/library) as directed by the kit manual, except that the RNA fragmentation was performed for 4 minutes, instead of 8 minutes to favor the generation of somewhat larger cDNA fragments. RNA-Seq was generated on an Illumina NovaSeq™ 6000 Sequencing System (Illumina) using a S4 flow cell and 300 cycles paired-end (2x150) chemistry. The Bioinformatics Core Facility at Purdue University performed the differential gene expression analysis. Sequence quality assessment and trimming was done using FastQC (v 0.11.7) (https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) and FASTX-Toolkit (v 0.0.14) (http://hannonlab.cshl.edu/fastx_toolkit/), respectively. Bases with a Phred33 score of less than 30 were removed, and the resulting reads with at least 50 bases of length were retained. The quality trimmed reads were mapped against the reference genome of Oryctolagus cuniculus breed Thorbecke inbred, OryCun2.0/ENSSEMBL 95 (GenBank assembly accession: GCA_000003625.1) using STAR (v 2.5.4b) [63]. STAR mapping (bam) files were used for the analysis of differential gene expression by the Cuffdiff from Cufflinks (v 2.2.1) suite of programs [64]. Cuffdiff uses bam files to calculate Fragments per kilobase of exon per million fragments mapped (FPKM) values, from which differential gene expression between the pairwise comparisons (dehydrated versus control vocal folds) can be established. Gene annotation was retrieved from BioMart databases using biomartr package in ‘R’ (v 3.5.1; http://www.r-project.org/).

Gene functional annotation and protein interaction network

Functional annotation of the differential expressed (DE) genes identified in the dehydrated group (with p≤0.05) was determined using the bioinformatics tool DAVID (v6.8) [65, 66] based on Gene Ontology (GO) and the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enriched terms (https://www.genome.jp/kegg/pathway.html). GO terms were obtained from GO FAT enrichment annotation, which filters out very broad GO terms based on measured specificity of each term. STRING (Search Tool for the Retrieval of Interacting Genes/Proteins) v.11.0 database was used to determine protein-protein interactions using the DE genes as input in order to visualize the relationship between these gene products based on different evidence levels including text-mining (co-mentioned in PubMed), experiments, curated databases, co-expression, neighborhood, gene fusion, and co-occurrence (https://string-db.org/). The interaction score (0 to 1) given by STRING represents an approximate confidence of the association between two proteins being true based on all the available evidence levels, and not the specificity or strength of an interaction [67].

RNA-Seq validation by RT-qPCR

Primer pairs for qPCR were designed using Primer-BLAST tool [68] and selected for at least one primer of each pair to span an exon-exon junction to avoid amplification of residual genomic DNA (Table 1). A two-step reverse transcriptase quantitative PCR (RT-qPCR) was performed with SuperScript™ IV VILO™ Master Mix (Invitrogen™) for cDNA synthesis using 500 ng of total RNA per sample in a final reaction of 20 μL, following the manufacturer’s protocol. Then, cDNA reactions were 10-fold diluted with RNAse/DNA-free water and added as 10% of the final qPCR volume (2.5 μL in 25 μL). The qPCR was run in triplicate per sample in a 96-well PCR plate using Power SYBR® Green PCR Master Mix (Applied Biosystems™ by Thermo Fisher Scientific), with a final concentration of 100 nM of each primer per reaction. The thermal cycling parameters for AmpliTaq Gold® DNA Polymerase were: 95 °C for 10 min; 40 cycles of 95 °C for 15 sec, and 60 °C for 1 min; and melt curve stage of 95 °C for 15 sec, 60 °C for 1 min, 95 °C for 1 sec. Reactions were carried out in a QuantStudio™ 3 Real-Time PCR System (Applied Biosystems™). A No-RT control containing RNA but no reverse transcriptase enzyme, and negative control with water instead of template were run in triplicate for each pair of primers on the qPCR plates. The relative expression level of each target gene was calculated with the 2−ΔΔCT method [69] using hypoxanthine phosphoribosyl-transferase 1 (HPRT1) as normalizer. All qPCR reactions had a single peak on the melt curve, verifying the amplification of a unique PCR product.
Table 1

Quantitative PCR primers for RNA-Seq validation.

Gene symbolGene nameForward (5' - 3')Reverse (5' - 3')Amplicon length (base pairs)
HPRT1*hypoxanthine phosphoribosyl-transferase 1GATGGTCAAGGTCGCAAGCCTCCAACAAAGTCTGGCCTGT73
DSG1desmoglein 1TCCTGCTGGCATCGGATTACATAGTGGCCAAACCAGTGGG195
CDH3cadherin 3TGACAACCAAGAGGGGCTTGATCCTCTACGTGGACCACCA131
CLDN7claudin 7TACGACTCTGTGCTCGCCCTCAGCAAGACCTGCCACGATGAA199
NECTIN1 (PVRL1)nectin cell adhesion molecule 1AGTACCACTGGACCACGCTGAGGAGACGGGGTGTAGGGAA191
CAMSAP3calmodulin regulated spectrin associated protein family member 3GCCCGAGTACACAGGTCCTCCGTGTACAGGGCTCGGAACT211
PLEKHA7pleckstrin homology domain containing A7CAATGAGGAGGCGGCTACGAGGCTCCACCCACCAGAGTTT111
ECM1extracellular matrix protein 1GGCAGCCATCCCCGAACAAGGGAGCTGGCTCTTCTTCTGT214
SDC1syndecan 1GGGAGCCGGACTTCACTTTCGCTGCCTTCGTCCTTCTTCT236
GJB2Gap junction protein beta 2TTGGGGTGCGTGAGTGATGTCTGCGCTTGCCACCAGTAAC78
S100A9S100 calcium binding protein A9CCTCAAGAAGGAGGCGAGGGAGCTGCTTGTCCTGGTTCGT78
SPINK5serine peptidase inhibitor, Kazal type 5TGTGGAGATGATGGCCAGACGATTTGTCAGATGCAGGCAGGC154
NR4A3 (NOR1)nuclear receptor subfamily 4 group A member 3TTCTGACGGCCTCCATTGACAGCAGTGTTCGACCTGATGG149
IL1Ainterleukin 1 alphaATCTGGGCGATGCAGTGAAACCTGGGTGTCTCAGGCATTT158
IL36Ainterleukin 36 alphaCAGGTGTGGGTCGTTCAGGAGCTAACAGTGGCTGGAACCAT75

*HPRT1 was used as the endogenous control to calculate the relative expression levels of each tested gene.

*HPRT1 was used as the endogenous control to calculate the relative expression levels of each tested gene.

Statistical analysis for hematologic and RT-qPCR data

Statistical analysis was performed using one-tailed Welch’s t-test for the RT-qPCR data and Mann-Whitney nonparametric test for hematologic analytes to compare control versus dehydrated group. Grubbs’ test was used to identify and remove outliers of each RT-qPCR pairwise analysis. All tests were executed with GraphPad Prism (version 6.0e for Mac). Differences between groups were considered statistically significant when p-value ≤ 0.05.

Results

In vivo systemic dehydration model

Rabbits reached an average of 4.8% dehydration, based on body weight fluid loss, within 3 to 6 hours after 1 or 2 injections of furosemide. We aimed for a 5% body weight dehydration to translate our findings to a level of mild-moderate dehydration reported in the literature [24, 33, 70]. Control rabbits had a range of body weight loss of 0.2–1.8% (mean = 0.9%) caused by regular urination and bowel movement, and possibly by reduced food and water consumption due to handling stress (Fig 1A; p = 0.0003). The % changes in PCV, hemoglobin, and TPP were significantly different between control and dehydrated rabbits, with post-dehydration values consistently higher on the dehydrated group (Fig 1B). PCV values obtained by centrifugation and HCT obtained from the iSTAT were similar and had the same p-value on Mann-Whitney comparison analyses (p = 0.0003). In addition, blood creatinine and BUN % changes were significantly higher in the dehydrated rabbits compared to controls (Fig 1C). Sodium and chloride % changes in the blood were also significantly different between groups; however, post-dehydration levels in the dehydrated group were lower (Fig 1D), consistent with the furosemide mechanism of action that inhibits Na+ and Cl− reabsorption [37]. The remaining blood analytes (glucose, potassium, total CO2, iCa, and anion gap) tested by iSTAT blood analyzer did not change between groups. A summary of the Mann-Whitney results of all blood analytes is shown in S1 Table.
Fig 1

Systemic dehydration markers.

Systemic dehydration was verified by body weight loss and blood markers. (A) Body weight loss in the control and dehydrated groups. (B) Percent changes in packed cell volume (PCV), hemoglobin, and total plasma proteins (TPP) in the control and dehydrated groups. (C) Percent changes in blood creatinine and blood urea nitrogen (BUN) levels in control and dehydrated groups. (D) Percent changes in blood sodium and chloride levels in control and dehydrated groups. Bars show mean ± SEM. ***p-value ≤ 0.001; **p-value ≤ 0.01; *p-value ≤ 0.05.

Systemic dehydration markers.

Systemic dehydration was verified by body weight loss and blood markers. (A) Body weight loss in the control and dehydrated groups. (B) Percent changes in packed cell volume (PCV), hemoglobin, and total plasma proteins (TPP) in the control and dehydrated groups. (C) Percent changes in blood creatinine and blood urea nitrogen (BUN) levels in control and dehydrated groups. (D) Percent changes in blood sodium and chloride levels in control and dehydrated groups. Bars show mean ± SEM. ***p-value ≤ 0.001; **p-value ≤ 0.01; *p-value ≤ 0.05.

Dehydrated vocal folds transcriptome

RNA-Seq data files were submitted to Gene Expression Omnibus (GEO, NCBI, https://www.ncbi.nlm.nih.gov/geo/) data repository under the accession number GSE132765. The average of total reads pair generated was 90,680,466 per sample, with more than 99% of read pairs passing quality control for all ten samples. A summary of the quality and mapping statistics of the reads of each vocal fold sample is provided in S2 Table. A total of 23,669 genes were identified in both transcriptomes of control and systemic dehydrated rabbits, including genes expressed in muscle, lamina propria, and epithelium. Among these, 203 protein-coding genes were identified as differentially expressed (DE) in the vocal folds of dehydrated rabbits using the Cuffdiff method with p ≤ 0.05. Based on fold change, 152 DE genes were found downregulated in contrast to 51 upregulated. Only 12 out of these 203 DE genes have unknown products (S3 Table). DAVID functional annotation analysis recognized 185 out of 203 gene IDs; the remaining 18 were unmapped on the DAVID database. Functional classification of these genes based on GO terms FAT annotation and KEGG pathway enrichment analysis revealed 161 biological terms, divided into biological process (BP; 121 terms), cellular component (CC; 20 terms), molecular function (MF; 18 terms), and KEGG pathway (2 terms), with at least two DE genes per enriched term, and certain genes listed under multiple terms (Fig 2A and S4 Table). A number of the DE genes identified herein are related to epithelial processes, which directed the focus of the study to the vocal fold epithelium layer.
Fig 2

Functional classification of differentially expressed genes (DEG) in dehydrated vocal folds by GO terms and KEGG pathway enrichment analysis.

(A) Number of enriched functional terms and total annotated DEG (in parenthesis) in each main category of biological process (BP), cellular component (CC), molecular function (MF), and KEGG pathway using DAVID analysis. (B) Enriched terms selected for further validation of DEG. Bars represent the total number of DEG per functional term. (C) DEG tested by RT-qPCR in each selected functional term. *S100A8 represents S100A9, which was tested by qPCR but not mapped by DAVID analysis; both share the same functions. The complete list of 161 enriched terms by functional category with associated DE genes is provided in S4 Table.

Functional classification of differentially expressed genes (DEG) in dehydrated vocal folds by GO terms and KEGG pathway enrichment analysis.

(A) Number of enriched functional terms and total annotated DEG (in parenthesis) in each main category of biological process (BP), cellular component (CC), molecular function (MF), and KEGG pathway using DAVID analysis. (B) Enriched terms selected for further validation of DEG. Bars represent the total number of DEG per functional term. (C) DEG tested by RT-qPCR in each selected functional term. *S100A8 represents S100A9, which was tested by qPCR but not mapped by DAVID analysis; both share the same functions. The complete list of 161 enriched terms by functional category with associated DE genes is provided in S4 Table.

RT-qPCR validation

Fourteen genes were selected for qPCR validation based on RNA-Seq fold change ≥ ±1.9 and biological enrichment functions including cell adhesion (GO:0007155), epithelial cell differentiation (GO:0030855), inflammatory response (GO:0006954), epithelial cell proliferation (GO:0050673), zonula adherens maintenance (GO:0045218), cell junction (GO:0030054), cell adhesion molecules (CAMs) (ocu04514), among others (Fig 2B). The DE genes tested comprise 13 downregulated genes in the dehydrated vocal fold group: eight cell junction-related genes, including desmoglein 1 (DSG1), cadherin 3 (CDH3), claudin 7 (CLDN7), nectin cell adhesion molecule 1 (NECTIN1), syndecan 1 (SDC1), calmodulin regulated spectrin associated protein family member 3 (CAMSAP3), pleckstrin homology domain containing A7 (PLEKHA7), and gap junction protein beta 2 (GJB2); two genes members of epidermal differentiation complex, S100 calcium-binding protein A9 (S100A9) and serine peptidase inhibitor, Kazal type 5 (SPINK5); two pro-inflammatory cytokines, interleukin 1 alpha (IL1A) and 36 alpha (IL36A), and the extracellular matrix protein 1 (ECM1) gene. In addition, the transcription factor nuclear receptor subfamily 4 group A member 3 (NR4A3) gene was chosen due to its association with the biological process of epithelial cell proliferation and its fold change of +23, indicating upregulation in the dehydrated group. The enriched functional terms and associated DE genes selected for RT-qPCR validation are shown in Fig 2C. Differential expression of 10 out of 14 genes tested was validated by qPCR: DSG1, CDH3, NECTIN1, SDC1, S100A9, SPINK5, ECM1, IL1A, IL36A, and NR4A3 (Fig 3). The remaining four genes identified as downregulated in the dehydrated group by RNA-Seq analysis were not statistically different from the control group by qPCR despite showing a trend of downregulation (S1 Fig). The qPCR data analysis is summarized in Table 2.
Fig 3

RT-qPCR quantification of relative expression levels of selected differentially expressed genes in dehydrated vocal folds.

The differential expression of 10 genes in dehydrated vocal folds identified by RNA-Seq was validated by RT-qPCR. (A) Cell junction-related genes: desmoglein 1 (DSG1), cadherin 3 (CDH3), nectin cell adhesion molecule 1 (NECTIN1), and syndecan 1 (SDC1). (B) Epidermal differentiation-related genes: S100 calcium-binding protein A9 (S100A9) and serine peptidase inhibitor, Kazal type 5 (SPINK5). (C) Extracellular matrix protein 1 (ECM1) gene. (D) Pro-inflammatory cytokine genes: interleukin 1 alpha (IL1A) and 36 alpha (IL36A). (E) Transcription factor nuclear receptor subfamily 4 group A member 3 (NR4A3) gene. The gene expression levels of the control group were set to 1, and relative expression levels were calculated relative to the HPRT1 gene using the method 2-ΔΔCt. Bars show mean ± SEM. *p-value ≤ 0.05. The detailed results of the qPCR analysis are listed in Table 2.

Table 2

Summary of qPCR results of selected differentially expressed genes in vocal folds of systemic dehydrated rabbits compared to controls.

Gene symbolRNA-Seq fold changeqPCR fold changeqPCR p-value*
DSG1-1.99-2.370.0485
CDH3-2.32-2.860.0224
CLDN7-1.95-1.600.0704; ns
NECTIN1-2.23-1.890.0394
CAMSAP3-1.97-1.660.0754; ns
PLEKHA7-1.99-2.230.0541; ns
ECM1-2.16-2.350.0191
SDC1-2.19-1.970.0374
GJB2-2.83-1.800.0854; ns
S100A9-6.63-4.140.0398
SPINK5-2.75-2.390.0357
NR4A3 (NOR1)+23.76+7.920.0136
IL1A-3.65-12.720.0368
IL36A-2.92-2.370.0381

Negative and positive values of fold change indicate downregulation and upregulation of gene expression, respectively.

*Exact p-value of One-tailed Welch′s t-test. ns: non-significant p-value.

RT-qPCR quantification of relative expression levels of selected differentially expressed genes in dehydrated vocal folds.

The differential expression of 10 genes in dehydrated vocal folds identified by RNA-Seq was validated by RT-qPCR. (A) Cell junction-related genes: desmoglein 1 (DSG1), cadherin 3 (CDH3), nectin cell adhesion molecule 1 (NECTIN1), and syndecan 1 (SDC1). (B) Epidermal differentiation-related genes: S100 calcium-binding protein A9 (S100A9) and serine peptidase inhibitor, Kazal type 5 (SPINK5). (C) Extracellular matrix protein 1 (ECM1) gene. (D) Pro-inflammatory cytokine genes: interleukin 1 alpha (IL1A) and 36 alpha (IL36A). (E) Transcription factor nuclear receptor subfamily 4 group A member 3 (NR4A3) gene. The gene expression levels of the control group were set to 1, and relative expression levels were calculated relative to the HPRT1 gene using the method 2-ΔΔCt. Bars show mean ± SEM. *p-value ≤ 0.05. The detailed results of the qPCR analysis are listed in Table 2. Negative and positive values of fold change indicate downregulation and upregulation of gene expression, respectively. *Exact p-value of One-tailed Welch′s t-test. ns: non-significant p-value.

Predicted protein interactions for the differentially expressed genes

STRING database was used to predict interactions between proteins encoded by the DE genes identified in the dehydrated group. Within the 203 DE genes identified, 117 showed predicted protein-protein interactions. Applying MCL clustering with a default inflation parameter of three [71], interactions were divided into 39 clusters with at least two proteins in each cluster, with direct associations (solid lines), indirect or inter-cluster associations (dashed lines). Twelve out of 14 proteins encoded by the DE genes tested by qPCR showed associations with each other or other proteins in the network (Fig 4). The products of NECTIN1 and NR4A3 did not show associations with other proteins in the network based on the evidence levels available on the STRING database.
Fig 4

STRING protein-protein interaction clusters for the differentially expressed (DE) genes identified in the vocal folds of systemically dehydrated rabbits.

A total of 117 differentially expressed (DE) genes had predicted protein-protein interactions. Each node represents a protein encoded by a DE gene. Network settings were: meaning of network clusters based on confidence (how many association evidences between proteins); minimum interaction score of 0.4 (medium confidence). Nodes with no predicted interactions were omitted from the network.

STRING protein-protein interaction clusters for the differentially expressed (DE) genes identified in the vocal folds of systemically dehydrated rabbits.

A total of 117 differentially expressed (DE) genes had predicted protein-protein interactions. Each node represents a protein encoded by a DE gene. Network settings were: meaning of network clusters based on confidence (how many association evidences between proteins); minimum interaction score of 0.4 (medium confidence). Nodes with no predicted interactions were omitted from the network.

Discussion

Increasing systemic and superficial hydration are common clinical recommendations in the field of voice therapy to sustain healthy vocal folds and to prevent voice disorders [20, 22, 72, 73]. The beneficial effects of hydration and adverse consequences of dehydration on vocal fold physiology are fairly documented, particularly on phonatory threshold pressure, a measure of voice function [17, 18, 21, 30, 40, 73]. However, the pathobiology of systemic dehydration in this tissue is poorly understood. In our study, an in vivo systemic dehydration model using rabbits was developed to analyze the transcriptome of vocal folds in response to systemic dehydration. The rabbits received furosemide IP injection to induce systemic dehydration; furosemide alone or a combination with water withholding to study different effects of dehydration in rabbits are reported in the literature [29, 34]. Systemic dehydration was verified by body weight loss (4.8% average) and significant changes in the level of blood analytes compared to the control group. The higher values of PCV, hemoglobin, TPP, creatinine, and BUN post-dehydration are consistent with increased concentration of these analytes in the blood due to water loss in the urine stimulated by furosemide [74]. As expected, the post-dehydration levels of sodium and chloride in the blood of dehydrated rabbits decreased compared to baseline levels reflecting the mechanism of action of furosemide. As other loop diuretics, furosemide acts on the loop of Henle in the renal tubules inhibiting sodium and chloride reabsorption by binding to one of the Cl−binding sites of the Na+-K+-2Cl− cotransporter [37, 75]. In contrast, control rabbits, which received saline as a sham-injection, lost an average of 0.9% body weight and did not show changes in the levels of blood analytes pre and post-injection. These results together validate our model of acute systemic dehydration. We used this in vivo rabbit model to investigate the transcriptional changes in vocal folds due to systemic dehydration. The RNA-Seq based transcriptome of dehydrated vocal folds revealed 152 downregulated and 51 upregulated genes. The functional classification of these DE genes was further explored to better understand the molecular impact of dehydration. Enrichment analysis using GO and KEGG annotations revealed 161 functional terms. We then focused on biological functions previously related to changes observed in vocal folds in response to other insults. These functions include cell adhesion, cell junction, epithelial cell proliferation, and inflammatory response, and are discussed below. Our results suggest a perturbation in the vocal fold epithelium after an induced mild level of systemic dehydration [33] evidenced by the downregulation of 15 genes related to cell adhesion as well as 16 genes associated with cell junction in the transcriptome of the dehydrated group. Eight of these genes are involved in both cell adhesion and junction functions, and four were validated by qPCR, including DSG1, CDH3, NECTIN1, and SDC1. DSG1 gene encodes the desmosomal cadherin desmoglein 1, an intercellular adhesion molecule localized primarily within the suprabasal epithelial layers. Desmoglein 1 is involved in maintaining epithelial homeostasis by regulating cell adhesion and supporting epithelial cell differentiation [76]. Cadherins and nectins, such as cadherin 3 (CDH3) and nectin 1 (NECTIN1), are components of epithelial adherens junctions, which are dynamic structures that undergo low and large-scale remodeling by substitution of adhesion molecules or disruption and reformation of intercellular junctions [77]. Whether the downregulation of CDH3 and NECTIN1 genes in dehydrated vocal folds represent a remodeling without disrupting the intercellular adhesions or a junctional rearrangement impacting the epithelial integrity needs further investigation. Adherens junction and tight junction molecules are essential for the maintenance of the laryngeal epithelium structure, contributing to the protection and functional activity of this tissue [78]. Moreover, desmosomes are crucial for the integrity of tissues that undergo constant mechanical stress as do vocal folds [79, 80]. Interestingly, the literature reports alterations in the laryngeal epithelial barrier due to phonotrauma and LPR. A study with rabbits showed downregulation of gene expression of the tight junction occludin and the adherens junction β-catenin in the vocal folds after 30 minutes exposure to raised intensity phonation [57]. Besides, induced excessive phonation caused epithelium hyperplasia and surface epithelial cells shedding in feline vocal folds [81], while surface damage, including the destruction and loss of epithelial microvilli and desquamation, and marked tearing of desmosomes and hemidesmosomes were observed in canine vocal folds [82]. LPR was associated with reduced expression of E-cadherin and carbonic anhydrase isoenzyme III in the laryngeal epithelium of specimens from human patients, and exposure to acid solution and pepsin caused mucosal damage in an in vitro model of porcine larynx [5, 6]. These studies on phonotrauma and LPR, except for the human patients with LPR, share the acute character of our systemic dehydration model. Our results suggest that systemic dehydration, like phonotrauma and LPR, may be detrimental to the vocal fold epithelial barrier, which affects the structure of the tissue and, consequently, its normal function. Furthermore, systemic dehydration may prime or exacerbate the epithelial changes occurring during phonotrauma and LPR. The RNA-Seq analysis also showed downregulation of 11 keratin genes. Keratins are markers of basal and suprabasal layers of the vocal fold epithelium [83, 84]. Epithelial cell layers undergo nearly constant turnover characterized by the continuous renewal of the basal and suprabasal cell layers [1, 85]. The reduced expression of keratin genes in the vocal folds observed in our animal model suggests that systemic dehydration alters this refined tissue equilibrium, likely impacting its normal structure and stability. In addition, the downregulation of ECM1 (extracellular matrix protein 1) indicates that dehydration also interferes with the maintenance of the extracellular matrix. Interestingly, our group showed decreased hyaluronan amounts in the lamina propria of vocal folds of rats systemically dehydrated by water withholding [32]. Although the method of inducing systemic dehydration was different in that study, it shows the effect of this challenge in an extracellular matrix component that plays a key role in hydration homeostasis and viscoelastic properties of the vocal folds. It is important to note that the DE genes reported herein reflect the expression profile of all cell types in the laryngeal tissue analyzed. However, the most significant impact of dehydration on the epithelium is evidenced by differential expression of 20 genes related to cell adhesion and cell junctions, and 11 keratins. The upregulation of the NR4A3 gene was validated by qPCR. According to the GO function database, the protein encoded by this gene is involved in cell proliferation. NR4A3 and NR4A1 are homologous orphan nuclear receptors that regulate the expression of shared target genes. These transcription factors are involved in maintaining cellular homeostasis by regulating cell proliferation, differentiation, and apoptosis [86, 87]. The only study showing a regulatory role of an orphan nuclear receptor in vocal folds implicates NR4A1 as an endogenous inhibitor of fibrosis in rat vocal folds and human vocal fold fibroblasts [88]. In our model, the upregulation of NR4A3 is likely associated with the activation of epithelial cell proliferation in an acute response scenario where fibrosis is not involved. Additional studies are warranted to understand the role of NR4A3 in the vocal fold epithelium as it relates to systemic dehydration. We also observed the downregulation of genes that encode for members of the epidermal differentiation complex, including S100A6, S100A8, S100A9, S100A11, S100A14, in addition to SPINK15 in the transcriptome of dehydrated vocal folds. Downregulation of S100A9 and SPINK5 were validated by qPCR. These genes contribute to the epithelial barrier maintenance by regulating epithelial growth and differentiation. In low concentrations, S100A8 and S100A9 might cause either tissue proliferation and repair, while in high concentrations, these proteins may have deleterious effects on inflamed tissue [89]. Moreover, S100A8 and S100A9 proteins act as nonchemokine chemoattractants of inflammatory cells [89, 90]. SPINK5 has been suggested to be an inhibitor of desquamation [91]; consequently, its downregulation could lead to increase cell turnover and cause epithelial barrier dysfunction [92]. Richer and collaborators (2009) showed a decreased expression of S100A7, S100A8, S100A9, and SPINK5 genes in the airway mucosal epithelium of people with chronic rhinosinusitis, which they associated with a defective epithelial barrier in this condition [92]. Although this was observed in a chronic condition, it illustrates the association of the downregulation of these genes with epithelial barrier impairment. Finally, the blockage of S100A8 and S100A9 or downstream signaling was related to decreased pro-inflammatory cytokine secretion in several models [89]. In this context, the downregulation of these S100 genes in our model could contribute in part to the downregulation of inflammatory-related genes, including the pro-inflammatory cytokines IL1A and IL36A. One may speculate that the reduced inflammatory response in vocal folds in response to systemic dehydration could help prevent tissue damage. Another hypothesis is that systemic dehydration could decrease the likelihood of vocal folds responding appropriately to an insult that requires inflammation such as wound healing or infection. Such hypotheses need to be further evaluated. Our STRING protein network analysis showed that more than 100 of the proteins encoded by the DE genes identified by RNA-Seq interact with each other. Among these, DE genes discussed above including DSG1, CDH3, SDC1, S100A9, SPINK5, ECM1, IL1A and IL36A, are shown to interact with each other in the same cluster (same color code nodes in Fig 4) or indirectly with other clusters, suggesting a coordinated response of vocal fold to systemic dehydration. Interestingly, desmoglein 1 is one of the nodes with the highest number of interactions (11 total) with other products, suggesting that this cluster formed by DSG1, plakophilin 1 (PKP1), and SPINK5 may play a central role in response to systemic dehydration. The importance of DSG1 for epithelial integrity is demonstrated by its role in several cutaneous diseases of different origins [76]. PKP1 interacts with desmosomal proteins and regulates desmosomal turnover and signaling [93], and the interaction between DSG1 and SPINK5 is evidenced by increased DSG1 degradation in mice deficient in SPINK5 as a model of Netherton syndrome, a skin disorder [94]. This cluster interacts with two clusters of keratins, including KRT1, KRT10, KRT14, among others, which also show numerous interactions with other proteins in the network. The largest keratin cluster (red nodes) contains transglutaminase 3 (TGM3), which is expressed in squamous epithelia and involved in keratinocyte differentiation [95], and another downregulated gene in our model. Other products interacting with DSG1-PKP1-SPINK5 cluster are corneodesmosin (CDSN) and envoplakin (EVPL), both encoded by genes found downregulated in the systemic dehydrated vocal folds. CDSN and EVLP are both desmosomal components localized to epidermis and other cornified squamous epithelia. The loss of expression of both genes is associated with epidermal barrier defect leading to skin desquamation in human and murine model [96, 97]. Together, these interactions predicted between the DE genes along with their functional classification support the adverse impact of systemic dehydration, even at a low level of 5%, on the vocal fold epithelial structure. Thus, maintaining optimal systemic hydration may have a role in preserving the vocal fold tissue architecture and, consequently, its normal function. How these transcriptional changes reflect in the proteome of vocal folds is our next focus of investigation.

Conclusions

To our knowledge, this is the first study to analyze the global gene expression profile of vocal folds using an in vivo model of systemic dehydration. In our model, systemic dehydration altered the transcriptome of vocal folds by downregulating the gene expression of cell junction-related molecules, regulators of epithelial proliferation and differentiation, and keratins. These results suggest that systemic dehydration affects the epithelial homeostasis, and possibly causes dysregulation of the epithelial cell barrier. It is noteworthy that all the changes observed in our model were identified at a low level of systemic dehydration, highlighting the benefit of maintaining an optimal hydration status. Our transcriptome dataset provides a resource for the investigation of new hypotheses applying different approaches to continue elucidating the pathobiological effects of dehydration in vocal folds. Additional studies addressing the impact of systemic dehydration associated with other conditions detrimental to vocal function and health (e.g., phonotrauma and LPR) are warranted and may impact voice therapy practices in the future.

RT-qPCR quantification of relative expression levels of selected genes in dehydrated vocal folds.

Genes: claudin 7 (CLDN7), calmodulin regulated spectrin associated protein family member 3 (CAMSAP3), pleckstrin homology domain containing A7 (PLEKHA7), and gap junction protein beta 2 (GJB2). The gene expression levels of the control group were set to 1, and relative expression levels were calculated relative to the HPRT1 gene using the method 2-ΔΔCt. Bars show mean ± SEM. ns: non-significant. (TIFF) Click here for additional data file.

Summary of pairwise analysis of hematologic analytes as markers of systemic dehydration.

(PDF) Click here for additional data file.

Statistics of quality and mapping of the reads generated by RNA-Seq of vocal fold samples.

Columns description: Sample ID: sample names in the study; Total Read Pairs: number of total read pairs; Quality Control Read Pairs: number of read pairs after quality control, and % of reads that passed quality control; Total Mapped Read Pairs: number of reads mapped to the genome, and % of reads mapped to the genome; Uniquely Mapped Read Pairs: number of reads uniquely mapped to the genome, and % of reads uniquely mapped to the genome; Read pairs went into genes: number of reads in genic regions, and % of reads mapped to the genes. (PDF) Click here for additional data file.

Differential expression analysis between control and dehydrated vocal fold samples using Cuffdiff (Cufflinks tool).

Only differentially expressed genes (q-value ≤ 0.05) are shown in the table. Columns description: Ensembl gene ID: describes the Ensembl gene identity; Sample_1: control; Sample_2: dehydrated; Value_1: FPKM of the gene in the control group; Value_2: FPKM of the gene in the dehydrated group; log2fold_change: describes log to base 2 value of fold change (Value_2/Value_1); q-value: The FDR-adjusted p-value of the test statistic; Gene symbol: official gene symbol; Description: annotation from Biomart. Note: All the log2 fold change values describe the fold change in the dehydrated group compared to control. Therefore, negative values represent downregulation, and positive values represent the upregulation of a given gene in the dehydrated group. (PDF) Click here for additional data file.

Functional categories of differentially expressed (DE) genes in dehydrated vocal folds by GO_TERM FAT and KEGG pathway enrichment analysis.

Columns description: Category: original database/resource of annotated terms (GOTERM_BP_FAT: biological process, GOTERM_CC_FAT: cellular component, GOTERM_MF_FAT: molecular function, KEGG_PATHWAY: KEGG pathway database); Term: enriched terms associated with gene list; Count: number of DE genes involved in the term; %: percentage of involved DE genes/total DEG genes mapped on DAVID analysis, e.g., 28*100/185 = 15.13%; p-value: modified Fisher exact p-value, the smaller, the more enriched; DE genes list: Ensembl gene IDs of genes involved in the term; List total: number of genes in the gene list mapped to any term in this ontology; Pop hits: number of genes with this term on the background list (genes in the genome); Pop total: number of genes on the background list mapped to any term in this ontology; Fold enrichment: defined as the ratio of the two proportions (% DEG involved in a term/% of background genes involved in the same term); FDR: False Discovery Rate. (PDF) Click here for additional data file. 3 Jun 2020 PONE-D-20-11397 Unraveling the molecular pathobiology of vocal fold systemic dehydration using an in vivo rabbit model PLOS ONE Dear Dr. Cannes do Nascimento, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by Jul 17 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols We look forward to receiving your revised manuscript. Kind regards, Marie Jetté Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. In your Methods, please provide scientific justification for the individual housing of the rabbit. 3. We note that you are reporting an analysis of a microarray, next-generation sequencing, or deep sequencing data set. PLOS requires that authors comply with field-specific standards for preparation, recording, and deposition of data in repositories appropriate to their field. Please upload these data to a stable, public repository (such as ArrayExpress, Gene Expression Omnibus (GEO), DNA Data Bank of Japan (DDBJ), NCBI GenBank, NCBI Sequence Read Archive, or EMBL Nucleotide Sequence Database (ENA)). In your revised cover letter, please provide the relevant accession numbers that may be used to access these data. For a full list of recommended repositories, see http://journals.plos.org/plosone/s/data-availability#loc-omics or http://journals.plos.org/plosone/s/data-availability#loc-sequencing [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Partly ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The main claims of this manuscript are that rapidly induced mild dehydration of rabbits induce molecular changes in vocal fold epithelium, and these changes are consistent with decreased homeostasis. Thus, the study seeks to elucidate a mechanism by which hydration can impact vocal fold integrity and, consequently, function. This work is significant in that it takes an incremental step towards identifying the molecular mechanism underlying well-established deleterious impacts of dehydration on vocal health (e.g. as stated on line 72). While vocal fold health depends on integrity of the epithelium, and underlying layers, the rationale to focus on epithelial cells vs. fibroblasts in lamina propria is well-justified (line 80). The need for the present study, and the hypothesis, are well-established with reference to existing literature, and potential research applications (e.g. availability of a transcriptome dataset) are strong. The clinical significance of this work is overstated in the 454-5. The manuscript is well-organized and written with clarity. The manuscript could be strengthened by considering the following: 1. Dehydration can likely impact mucus composition and biomechanics. If dehydration alters composition of mucus overlying the vocal folds, then could the observed molecular changes have resulted from changes in vocal fold surface, not systemic, hydration? This should be addressed given that systemic, not surface, hydration is the focus of the study (e.g. as noted in title). In a related minor point: mucus is arguably the first barrier to protect the vocal folds, not epithelium (line 49) 2. It is often acknowledged that the relationship between systematic hydration and vocal fold hydration is unclear, despite the clinical and research observations that dehydrating conditions have negative impacts on vocal function. With respect to the methodology used in the study, what support is there for the assumption that rabbit vocal fold hydration levels were impacted by rapid reduction in weight loss (e.g. histology)? Similarly, is there biomechanical/ physiological evidence to suggest that vocal fold systemic hydration can decrease in 3-6 hours? 3. Consider justifying sample size. 4. Consider providing a rationale for inducing mild dehydration (as indicated by a 5% loss of body weight) with specific respect to vocal fold biology, the focus of this study. The two references do not justify mild dehydration with respect to vocal folds (22,66). Reviewer #2: This is a very interesting paper on the effects of systemic dehydration on the genetic profile of the vocal folds. This information is potentially useful to better understand the effects of systemic dehydration on voice production. The findings that cell adhesion genes are downregulated and cell reproduction upregilated are new and interesting, with a very thorough discussion. The paper adds valuable comments and balanced observations and conclusions in a well written discussion section. erhaps more information about the animals would be useful, such as their weight and morphometric measures if they are available. Rabbits are variable and thre may be confounding anatomical factors. It could also be useful to add specific examples of how the information could be useful in voice therapy. Reviewer #3: This is an interesting study and a much-needed contribution to the field. The RNA-seq dataset could become an important resource to other researchers in epithelial biology and vocal fold biology. Overall the manuscript is very well-written and figures are clear. I have the following suggestions and concerns. Major concerns -As written, the experiment did not test the role of each vocal fold layer as described in the introduction, lines 84-85. This phrasing led me to expect separate results for epithelium, lamina propria, and maybe muscle. However, results are not parsed by tissue layer: only epithelium is extensively discussed, lamina propria is mentioned briefly in the discussion, and muscle is not mentioned. -Please describe laryngeal and vocal fold dissection, specifically which tissue layers and extent of the length of the vocal folds were harvested for analysis. Without knowing details of the dissection it’s difficult to interpret whether DE genes were primarily involved in epithelial processes, or if predominance of epithelial processes in functional terms and genes selected for further analysis was an authorial decision. -Line 404-405: If all that is known about NR4A3 in vocal folds is in fibroblasts, some more information about other upregulated epithelial cell proliferation markers post dehydration would better support claims regarding a new role for a family of transcription factors. -Could furosemide itself have side effects on vocal folds? Please discuss feasibility of acute and/or chronic dehydration due to water withholding alone in the rabbit model. Minor concerns Abstract -Slightly long. The first few sentences could be cut or edited down. Introduction -Line 63: Unclear phrasing; add “increased” before “physical activity.” -Lines 94-95: This is a very broad hypothesis. I understand that RNA-seq is a hypothesis-generating methodology, but were there hypotheses for specific changes in different tissue layers? Methods -Please explain rationale for saline injection in control animals. To control for stress of handling and IP injections? Could the saline have changed hydration? For related reasons, please describe volumes of furosemide and saline injectates. Results -Line 224-225: It’s not clear that urine and stool were the only mechanisms of weight loss in the control group. Handling stress mentioned above could have decreased water and food consumption. -Figure 1A: Please disclose exact p-value in caption or body text. -How many animals received more than one injection of furosemide? Were there any differences in blood analytes, or would differences be expected? -Figure 4 is minimally described. Some interpretation in this section regarding genes of interest in the other experiments would be helpful. Discussion -Line 353: Citation for the characterization of 5% acute dehydration as “mild”? -Are there any other extant RNA-seq data on other mucosal tissues after dehydration? Please discuss. -Paragraph from lines 353-381: Phonotrauma, LPR, and dehydration exist at varying levels of chronicity. Are all of the studies discussed comparable to the acute challenge in the present experiment? Conclusions -The conclusion (and introduction) mentions the ability to personalize hydration recommendations for vocal fold health, but these results do not yet support that. Hypotheses have been generated re: interactions of systemic dehydration and phonotrauma, LPR, wound healing, and infection, but clinical applicability is still limited. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: Yes: Luc Mongeau Reviewer #3: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 16 Jun 2020 Dear Dr. Jetté, We thank the Editor and reviewers for the favorable comments on the submitted manuscript. We greatly appreciate the comprehensive and insightful questions of the editor and reviewers and the opportunity to improve the quality of our original submission. Please find the reviewers’ comments/questions and our responses below. The line numbers correspond to the ‘Revised Manuscript with Track Changes’. PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf Response: All files were verified to meet PLOS ONE style requirements. 2. In your Methods, please provide scientific justification for the individual housing of the rabbit. Response: We added a justification and reference for individual housing of male rabbits, and social interaction with humans as part of an enrichment protocol (lines 129-134). “Individual housing is recommended for male rabbits, which should be separated from other males at sexual maturity (12 to 14 weeks) to avoid aggressive behavior, but maintaining visual and olfactory contact with other rabbits (https://www.nc3rs.org.uk/3rs-resources/housing-and-husbandry/rabbits) (Refinements in rabbit husbandry. Lab Anim. 27: 301-329.)”. Socialization training, consisting of food enrichment (hay) and human interaction (petting) was part of the acclimatization protocol to reduce stress for the rabbits and facilitate animal handling at the time of the study.” 3. We note that you are reporting an analysis of a microarray, next-generation sequencing, or deep sequencing data set. PLOS requires that authors comply with field-specific standards for preparation, recording, and deposition of data in repositories appropriate to their field. Please upload these data to a stable, public repository (such as ArrayExpress, Gene Expression Omnibus (GEO), DNA Data Bank of Japan (DDBJ), NCBI GenBank, NCBI Sequence Read Archive, or EMBL Nucleotide Sequence Database (ENA)). In your revised cover letter, please provide the relevant accession numbers that may be used to access these data. For a full list of recommended repositories, see http://journals.plos.org/plosone/s/data-availability#locomics or http://journals.plos.org/plosone/s/data-availability#loc-sequencing [Note: HTML markup is below. Please do not edit.] Response: RNA-Seq data were deposited in the Gene Expression Omnibus (GEO) repository under the accession number GSE132765. To review GEO accession GSE132765: Go to https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE132765 Enter token arotaeqqdzwxruj into the box. Review Comments to the Author Reviewer #1: The main claims of this manuscript are that rapidly induced mild dehydration of rabbits induce molecular changes in vocal fold epithelium, and these changes are consistent with decreased homeostasis. Thus, the study seeks to elucidate a mechanism by which hydration can impact vocal fold integrity and, consequently, function. This work is significant in that it takes an incremental step towards identifying the molecular mechanism underlying well-established deleterious impacts of dehydration on vocal health (e.g., as stated on line 72). While vocal fold health depends on integrity of the epithelium, and underlying layers, the rationale to focus on epithelial cells vs. fibroblasts in lamina propria is well-justified (line 80). The need for the present study, and the hypothesis, are well-established with reference to existing literature, and potential research applications (e.g. availability of a transcriptome dataset) are strong. The clinical significance of this work is overstated in the 454-5. The manuscript is well-organized and written with clarity. The manuscript could be strengthened by considering the following: 1. Dehydration can likely impact mucus composition and biomechanics. If dehydration alters composition of mucus overlying the vocal folds, then could the observed molecular changes have resulted from changes in vocal fold surface, not systemic, hydration? This should be addressed given that systemic, not surface, hydration is the focus of the study (e.g. as noted in title). In a related minor point: mucus is arguably the first barrier to protect the vocal folds, not epithelium (line 49) Response: Thank you very much for your comments and questions. To prevent/minimize surface dehydration from interfering with results, all rabbits in both control and systemically dehydrated groups were accommodated in the same controlled environment with optimal ambient temperature (15-20°C) and relative air humidity (~40%) recommended for rabbits (Guide for the Care and Use of Laboratory Animals. 8th edition. Washington (DC): National Academies Press (US); 2011). In this study, we did not analyze the mucus content on the surface of the vocal folds, but we did not find strong evidence on mucin changes based on gene expression. However, we cannot completely rule out that surface dehydration played a role in our findings. Our next study will focus on the proteomic analysis of the vocal folds using the same systemic dehydration rabbit model. Our group is currently investigating the effects of surface dehydration alone in the vocal folds using rabbit as a model. These two studies will allow us to have a better understanding of how these distinct types of dehydration intertwine at the molecular level. The authors agree that mucus, together with the epithelia, is the first barrier of protection of the vocal folds. We changed the text and added a reference in order to provide complete information to the readers (lines 60-61). 2. It is often acknowledged that the relationship between systematic hydration and vocal fold hydration is unclear, despite the clinical and research observations that dehydrating conditions have negative impacts on vocal function. With respect to the methodology used in the study, what support is there for the assumption that rabbit vocal fold hydration levels were impacted by rapid reduction in weight loss (e.g. histology)? Similarly, is there biomechanical/ physiological evidence to suggest that vocal fold systemic hydration can decrease in 3-6 hours? Response: The literature reports systemic dehydration as low as 1% having a negative impact on vocal function. Based on these reports, the authors were mostly intrigued by how these negative clinical impacts would reflect in the vocal folds gene expression in response to a mild-moderate level of systemic dehydration. We believe that the difference in gene expression (203 genes) between the dehydrated and control groups support the hypothesis that the systemic dehydration, verified by body weight loss and hematologic changes, impacted the vocal folds in our model. In a previous study by our group, >6% body weight loss systemic dehydration by water withholding lead to vocal folds dehydration in an in vivo rat model (In Vivo Magnetic Resonance Imaging of the Rat Vocal Folds After Systemic Dehydration and Rehydration. J Speech Lang Hear Res. doi: 10.1044/2019_JSLHR-19-00062.). We understand the limitations of comparing both studies since they use different animal models and systemic dehydration methods. Still, these are relevant observations to address the questions raised by this reviewer. We did not apply histologic examination in this study. We do not expect to see histological changes in the rabbit vocal fold tissue at this relatively low dehydration level (5%) and short exposure (3-6h) based on previous laboratory observation of pilot studies. No evidence of inflammation or damage to the laryngeal mucosa was observed grossly nor by examination under the dissecting microscope by a certified veterinary pathologist. For this study, we did not evaluate biomechanical/ physiological features of the dehydrated vocal folds. Instead, we wanted to investigate how the changes in voice function observed in the literature could be explained at the molecular level. We believe that our results are a first step to give direction to further explore the effects of systemic dehydration on vocal fold biology. 3. Consider justifying sample size. Response: The sample size was determined upon consultation with Purdue Bioinformatics Core in order to have the minimum ideal sample size required for the RNA-Seq statistical analysis. Our goal was also to limit the group sizes to the minimum needed to obtain statistical significance complying with the concept of reduction in animal research (“Three R’s - Replacement, Reduction, and Refinement.”). 4. Consider providing a rationale for inducing mild dehydration (as indicated by a 5% loss of body weight) with specific respect to vocal fold biology, the focus of this study. The two references do not justify mild dehydration with respect to vocal folds (22,66). Response: The 5% systemic dehydration (based on body weight loss) was chosen as an altered hydration state physiologically translatable to the level of fluid loss associated with increased physical activities that humans may experience (Dehydration: physiology, assessment, and performance effects. Compr Physiol. doi:10.1002/cphy.c130017). As systemic dehydration can potentially have effects in various body functions, such as skin health, neurological function, gastrointestinal and renal functions (Narrative Review of Hydration and Selected Health Outcomes in the General Population. Nutrients. doi:10.3390/nu11010070), our central question was whether a 5% systemic dehydration would impact the vocal fold tissue at the molecular level in our animal model. A reference for levels of systemic dehydration related to vocal fold tissue was added: Oleson S, Cox A, Liu Z, Sivasankar MP, Lu KH. In Vivo Magnetic Resonance Imaging of the Rat Vocal Folds After Systemic Dehydration and Rehydration. J Speech Lang Hear Res. 2020;63(1):135‐142. doi:10.1044/2019_JSLHR-19-00062 (line 260). As recommended by the reviewer, we have tempered the language of the clinical significance statement of the study in the Abstract (lines 41-43) and Conclusions (lines 518-520). Reviewer #2: This is a very interesting paper on the effects of systemic dehydration on the genetic profile of the vocal folds. This information is potentially useful to better understand the effects of systemic dehydration on voice production. The findings that cell adhesion genes are downregulated and cell reproduction upregulated are new and interesting, with a very thorough discussion. The paper adds valuable comments and balanced observations and conclusions in a well written discussion section. Perhaps more information about the animals would be useful, such as their weight and morphometric measures if they are available. Rabbits are variable and there may be confounding anatomical factors. It could also be useful to add specific examples of how the information could be useful in voice therapy. Response: Thank you very much for your comments and recommendations. In order to minimize the difference between rabbits, they were matched by breed, sex and age. We added the information about the body weight (average and range) of all rabbits in the Materials and methods section (lines 139-140). We have tempered the language of the clinical significance in the Conclusions to clarify that although our findings represent evidence to support the inclusion of hydration therapy as a clinical practice to maintain vocal health, it is still early to recommend specific therapies based on our results alone (lines 518-520). Reviewer #3: This is an interesting study and a much-needed contribution to the field. The RNA-seq dataset could become an important resource to other researchers in epithelial biology and vocal fold biology. Overall the manuscript is very well-written and figures are clear. I have the following suggestions and concerns. Major concerns -As written, the experiment did not test the role of each vocal fold layer as described in the introduction, lines 84-85. This phrasing led me to expect separate results for epithelium, lamina propria, and maybe muscle. However, results are not parsed by tissue layer: only epithelium is extensively discussed, lamina propria is mentioned briefly in the discussion, and muscle is not mentioned. Response: Thank you for the opportunity to clarify this concern. The initial transcriptome analysis resulted in a total of 23,669 genes that were mapped to the rabbit’s genome, and includes genes expressed in muscle, lamina propria, and epithelia. The vast majority of these genes showed no difference in expression between control and systemically dehydrated groups, except for the 203 genes reported in the study. Interestingly, a subset of these differentially expressed genes was represented by epithelial related genes, which directed our focus to the epithelia. We added this information to the Results section to justify our focus on the epithelial processes (lines 290-292, and 302-303). -Please describe laryngeal and vocal fold dissection, specifically which tissue layers and extent of the length of the vocal folds were harvested for analysis. Without knowing details of the dissection it’s difficult to interpret whether DE genes were primarily involved in epithelial processes, or if predominance of epithelial processes in functional terms and genes selected for further analysis was an authorial decision. Response: Thank you for highlighting the lack of clarity on the dissection procedure. We added a paragraph explaining the dissection of the larynx and collection of the vocal fold tissue in the Materials and methods (lines 169-181). We collected the full extension of the vocal fold tissue with all layers (epithelia, LP, and muscle) represented in the excised section. -Line 404-405: If all that is known about NR4A3 in vocal folds is in fibroblasts, some more information about other upregulated epithelial cell proliferation markers post dehydration would better support claims regarding a new role for a family of transcription factors. Response: Thank you for highlighting this. We modified the body text to clarify that more investigation is needed to understand the role of NR4A3 in the vocal fold epithelium as it relates to systemic dehydration (lines 454-455). Based on our findings, only one more gene involved in epithelial cell proliferation was upregulated in the RNA-Seq analysis. -Could furosemide itself have side effects on vocal folds? Please discuss feasibility of acute and/or chronic dehydration due to water withholding alone in the rabbit model. Response: The effects of furosemide are characterized in tissues such as kidney, adrenal glands, liver, lungs, and spleen (Pharmacokinetic, biliary excretion, and metabolic studies of 14C-furosemide in the rat. Xenobiotica. doi:10.3109/00498259109039512). In addition, anti-inflammatory effects have been reported in human mononuclear cells (Immunosuppressive and cytotoxic effects of furosemide on human peripheral blood mononuclear cells. Ann Allergy Asthma Immunol. doi:10.1016/S1081-1206(10)62870-0), and lungs when the respiratory route of administration is used (Furosemide: progress in understanding its diuretic, anti-inflammatory, and bronchodilating mechanism of action, and use in the treatment of respiratory tract diseases. Am J Ther. doi:10.1097/00045391-200207000-00009). To the best of our knowledge there is no literature linking furosemide effects directly to vocal folds; however, a possible effect cannot be completely ruled out. Nevertheless, our study shows that the two genes encoding the Na+2Cl-K+ cotransporter (SLC12A1 and SLC12A2), which is the receptor for furosemide, are present in the vocal folds of both euhydrated and dehydrated groups with no differential expression. In addition, other sodium channels and genes reported to be possibly affected by furosemide such as IL6, IL8, TNFα, prostaglandins, leukotrienes, are also present in both transcriptomes with no differential expression. Collectively, these findings support that there is no evidence for a direct or indirect effect of furosemide alone in the vocal folds in our rabbit model. It is feasible to perform experiments based on water withholding, and animal models using this method are well established, especially for the study of longer periods of dehydration (references listed below). However, based on our experience, the time needed for the rabbit to achieve the desired 5% dehydration with water withholding would be at least 24h, which would not represent an acute situation simulating an increased physical activity for example. Similar results are seen in the rat model; one of our studies in rats showed that the time range to achieve mild systemic dehydration after water withholding was 18–24h, for moderate dehydration was 36–48h, and for marked dehydration was 66–72h (In Vivo Magnetic Resonance Imaging of the Rat Vocal Folds After Systemic Dehydration and Rehydration. J Speech Lang Hear Res. doi:10.1044/2019_JSLHR-19-00062). Thus, the decision to use furosemide was to guarantee we were inducing an acute state of dehydration. In addition, the decreased experimental time contributes to the animals’ welfare. Interestingly, our group observed a similar pattern of gene expression changes in the vocal fold in a rat model of systemic dehydration by water restriction (Restricted Water Intake Adversely Affects Rat Vocal Fold Biology, accepted on May 27/2020, The Laryngoscope). In that study, the gene expression and protein levels of desmoglein 1, and the gene expression of IL1A were also downregulated in the dehydrated group, which supports the effect of systemic dehydration on the expression of these genes despite the dehydration protocol used. Water withholding studies references: - Lee MH, Choi HY, Sung YA, Lee JK. High signal intensity of the posterior pituitary gland on T1-weighted MR images. Correlation with plasma vasopressin concentration to water deprivation. Acta Radiol. 2001;42(2):129‐134. doi:10.1034/j.1600-0455.2001.042002129.x - Islam S, Abély M, Alam NH, Dossou F, Chowdhury AK, Desjeux JF. Water and electrolyte salvage in an animal model of dehydration and malnutrition. J Pediatr Gastroenterol Nutr. 2004;38(1):27‐33. doi:10.1097/00005176-200401000-00009 - Kishore BK, Krane CM, Miller RL, et al. P2Y2 receptor mRNA and protein expression is altered in inner medullas of hydrated and dehydrated rats: relevance to AVP-independent regulation of IMCD function. Am J Physiol Renal Physiol. 2005;288(6):F1164‐F1172. - Cox A, Cannes do Nascimento N, Pires Dos Santos A, Sivasankar MP. Dehydration and Estrous Staging in the Rat Larynx: an in vivo Prospective Investigation [published online ahead of print, 2019 Jul 13]. J Voice. 2019;S0892-1997(19)30236-X. doi:10.1016/j.jvoice.2019.06.009 - Oleson S, Cox A, Liu Z, Sivasankar MP, Lu KH. In Vivo Magnetic Resonance Imaging of the Rat Vocal Folds After Systemic Dehydration and Rehydration. J Speech Lang Hear Res. 2020;63(1):135‐142. Published 2020 Jan 10. doi:10.1044/2019_JSLHR-19-00062 Minor concerns Abstract -Slightly long. The first few sentences could be cut or edited down. Response: We edited down the first sentences (six to three lines) of the abstract to make it more concise (lines 25-27). Introduction -Line 63: Unclear phrasing; add “increased” before “physical activity.” Response: Corrected (line 74). -Lines 94-95: This is a very broad hypothesis. I understand that RNA-seq is a hypothesis-generating methodology, but were there hypotheses for specific changes in different tissue layers? Response: We hypothesized that changes in gene expression would occur in different vocal fold tissue layers based on physiological and biomechanical changes in vocal folds due to systemic dehydration and other challenges reported in the literature. Some candidate gene categories that we expected to see changes included but were not limited to: components of extracellular matrix involved in lubrication and viscoelasticity of the vocal fold such as hyaluronan and collagen; epithelial related genes such as components of cell junctions (cadherin and claudins), ion transporters, mucins and aquaporins; and muscle related genes such as myosin heavy chain genes, which are a major determinant of skeletal muscle physiology. We modified the text in the Introduction to make the hypothesis less broad, but without restricting to specific genes (lines 105-107). Methods -Please explain rationale for saline injection in control animals. To control for stress of handling and IP injections? Could the saline have changed hydration? For related reasons, please describe volumes of furosemide and saline injectates. Response: The saline injection in control rabbits was applied to prevent animal handling and IP injections from being a confounding variable and an unwanted source of variation between groups (https://www.nc3rs.org.uk/handling-and-restraint). Saline was chosen as a physiological solution, and also for being in the composition of Salix solution (commercial furosemide brand) used to stimulate systemic dehydration in this study. The concentration of the commercial furosemide solution is 50 mg/mL, to achieve a 5% dehydration the volume of furosemide was calculated based on the body weight of each rabbit; an average volume of 0.34 mL was IP injected in each rabbit. The same calculation was used for saline. Based on this small volume of injectates and the results of our study (no significant differences in body weight and hematologic values in controls), we do not think that saline changed the hydration status of control rabbits. The rationale for saline injection and volume of injectates was added to the body text (lines 142-146). Results -Line 224-225: It’s not clear that urine and stool were the only mechanisms of weight loss in the control group. Handling stress mentioned above could have decreased water and food consumption. Response: We agree with the reviewer that handling stress could have affected the overall behavior of the control rabbits regarding food and water intake. We added this information in the text (lines 261-263). We would like to point out that the experiments were performed during the day and rabbits are nocturnal animals, having higher activity during nighttime (Biology of the rabbit. J Am Assoc Lab Anim Sci. 2006;45(1):8‐24.). Moreover, no hematological changes (PCV, TPP, BUN, creatinine, etc.) were observed in the control rabbits when comparing pre-IP saline injection and pre-euthanasia values, indicating that systemic dehydration was not induced in this group despite the slight body weight loss observed. -Figure 1A: Please disclose exact p-value in caption or body text. Response: Exact p-value (p= 0.0003) of comparison between groups in Fig 1A (body weight loss) was added to the body text (line 263). -How many animals received more than one injection of furosemide? Were there any differences in blood analytes, or would differences be expected? Response: In the control group, three rabbits received 1 saline injection and three received 2. In the dehydrated group, five rabbits received 1 furosemide injection and three received 2. The number of injections was matched between control and dehydrated rabbits assigned to the experiment in the same day (with 2-4 rabbits/experiment/day). We would expect sodium and chloride blood levels to be lower in rabbits that received two injections of furosemide due to the mechanism of action of this diuretic, which inhibits Na+ and Cl- reabsorption. However, no differences were observed, possibly because rabbits were euthanized when they reached ~5% dehydration regardless of receiving 1 or 2 injections. No differences were observed within the control group either. We attribute the faster or slower diuretic response to furosemide to individual metabolism of each rabbit. -Figure 4 is minimally described. Some interpretation in this section regarding genes of interest in the other experiments would be helpful. Response: We focused the discussion on the clusters with a higher number of predicted protein interactions, and with a putative role in the epithelial structure maintenance. We expanded the discussion to include more of these proteins (lines 483-486, and 495-502). We hope this network can be used to explore other mechanisms involved in the response of vocal folds to systemic dehydration. Discussion -Line 353: Citation for the characterization of 5% acute dehydration as “mild”? Response: Citation for 5% dehydration as mild was added: Oleson S et al. In Vivo Magnetic Resonance Imaging of the Rat Vocal Folds After Systemic Dehydration and Rehydration. J Speech Lang Hear Res. 2020;63(1):135‐142. (line 399). -Are there any other extant RNA-seq data on other mucosal tissues after dehydration? Please discuss. Response: To the best of our knowledge, studies on RNA-Seq transcriptome of mucosal tissue exposed to dehydration are not available in the literature. Other tissues have been explored regarding their transcriptional changes due to dehydration, such as kidney, brain (subfornical organ, and supraoptic nucleus of the hypothalamus), and testes. Transcriptome studies on airway and intestinal mucosa in conditions where dehydration of the tissue surface is associated with defects in mucus clearance, which is characteristic of mucoobstructive pulmonary diseases (e.g., cystic fibrosis, primary ciliary dyskinesia, and the chronic bronchitic form of chronic obstructive pulmonary disease) are reported in the literature, but those are not comparable to our study. -Paragraph from lines 353-381: Phonotrauma, LPR, and dehydration exist at varying levels of chronicity. Are all of the studies discussed comparable to the acute challenge in the present experiment? Response: The studies regarding phonotrauma discussed in the present study reflect data collected at various time points using different animal models subjected to 30 minutes (rabbits), 2-4 hours (dogs), or 25 minutes during 2-15 weeks (cats) of increased phonation. These studies are comparable to our acute systemic dehydration study. The LPR study with human subjects presents data from vocal fold biopsies of patients previously diagnosed with LPR and, therefore, would be considered chronic when compared to our study. We clarified this in the text (lines 423-425). Conclusions -The conclusion (and introduction) mentions the ability to personalize hydration recommendations for vocal fold health, but these results do not yet support that. Hypotheses have been generated re: interactions of systemic dehydration and phonotrauma, LPR, wound healing, and infection, but clinical applicability is still limited. Response: Thank you for your comment. We acknowledge the limitations of our results regarding the clinical applicability in voice therapy. We recognize that the transcriptome data is just a start to improve the understanding of how hydration impacts the vocal fold biology, and additional studies addressing the impact of systemic dehydration associated with other conditions such as phonotrauma, LPR, wound healing, etc. are warranted. Therefore, we modified this conclusion statement in the Abstract (lines 41-43) and Conclusions (lines 518-520). Submitted filename: Response to Reviewers.docx Click here for additional data file. 7 Jul 2020 Unraveling the molecular pathobiology of vocal fold systemic dehydration using an in vivo rabbit model PONE-D-20-11397R1 Dear Dr. Cannes do Nascimento, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Marie Jetté Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed Reviewer #2: All comments have been addressed Reviewer #3: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: This revised manuscript, describing original research, was strengthened by the authors' thorough responses to concerns. Methods are well-described, and justified in the reviewer responses. The revised conclusions are supported by data. I have no additional concerns. Reviewer #2: (No Response) Reviewer #3: This paper is substantially improved. Methodology is much more completely described, rationale is clearer, and conclusions are supported by findings. All of my concerns have been addressed. I question whether the very nice explanation in the authors’ response to reviewers regarding lack of evidence for effects of furosemide in vocal folds should be included in the paper somewhere. In my opinion, this would strengthen the paper because readers may have the same question as I did, but is not strictly necessary. ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No Reviewer #3: No 22 Jul 2020 PONE-D-20-11397R1 Unraveling the molecular pathobiology of vocal fold systemic dehydration using an in vivo rabbit model Dear Dr. Cannes do Nascimento: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Marie Jetté Academic Editor PLOS ONE
  97 in total

Review 1.  Everything we always wanted to know about furosemide but were afraid to ask.

Authors:  Xiaohua Huang; Evert Dorhout Mees; Pieter Vos; Shereen Hamza; Branko Braam
Journal:  Am J Physiol Renal Physiol       Date:  2016-02-24

2.  A meta-analysis of outcomes of hydration intervention on phonation threshold pressure.

Authors:  Ciara Leydon; Marcin Wroblewski; Naomi Eichorn; Mahalakshmi Sivasankar
Journal:  J Voice       Date:  2010-04-01       Impact factor: 2.009

Review 3.  Refinements in rabbit husbandry. Second report of the BVAAWF/FRAME/RSPCA/UFAW Joint Working Group on Refinement. British Veterinary Association Animal Welfare Foundation. Fund for the Replacement of Animals in Medical Experiments. Royal Society for the Prevention of Cruelty to Animals. Universities Federation for Animal Welfare.

Authors: 
Journal:  Lab Anim       Date:  1993-10       Impact factor: 2.471

4.  Simulated reflux decreases vocal fold epithelial barrier resistance.

Authors:  Elizabeth Erickson; Mahalakshmi Sivasankar
Journal:  Laryngoscope       Date:  2010-08       Impact factor: 3.325

5.  Characterisation of adherens and tight junctional molecules in normal animal larynx; determining a suitable model for studying molecular abnormalities in human laryngopharyngeal reflux.

Authors:  G A Gill; A Buda; M Moorghen; P W Dettmar; M Pignatelli
Journal:  J Clin Pathol       Date:  2005-12       Impact factor: 3.411

6.  Equine plasma and blood volumes decrease with dehydration but subsequently increase with exercise.

Authors:  J R Naylor; W M Bayly; H C Schott; P D Gollnick; D R Hodgson
Journal:  J Appl Physiol (1985)       Date:  1993-08

7.  Behavioral and neural gustatory responses in rabbit.

Authors:  R J Contreras; E Bird; D J Weisz
Journal:  Physiol Behav       Date:  1985-05

8.  Cross-sample validation provides enhanced proteome coverage in rat vocal fold mucosa.

Authors:  Nathan V Welham; Masaru Yamashita; Seong Hee Choi; Changying Ling
Journal:  PLoS One       Date:  2011-03-15       Impact factor: 3.240

9.  Comparative proteomics of paired vocal fold and oral mucosa fibroblasts.

Authors:  Michael Karbiener; Barbara Darnhofer; Marie-Therese Frisch; Beate Rinner; Ruth Birner-Gruenberger; Markus Gugatschka
Journal:  J Proteomics       Date:  2017-01-15       Impact factor: 4.044

10.  Desmoglein-1 regulates esophageal epithelial barrier function and immune responses in eosinophilic esophagitis.

Authors:  J D Sherrill; K Kc; D Wu; Z Djukic; J M Caldwell; E M Stucke; K A Kemme; M S Costello; M K Mingler; C Blanchard; M H Collins; J P Abonia; P E Putnam; E S Dellon; R C Orlando; S P Hogan; M E Rothenberg
Journal:  Mucosal Immunol       Date:  2013-11-13       Impact factor: 7.313

View more
  2 in total

1.  Furosemide-induced systemic dehydration alters the proteome of rabbit vocal folds.

Authors:  Naila Cannes do Nascimento; Andrea Pires Dos Santos; Rodrigo Mohallem; Uma K Aryal; Jun Xie; Abigail Cox; M Preeti Sivasankar
Journal:  J Proteomics       Date:  2021-11-23       Impact factor: 4.044

2.  Recurring exposure to low humidity induces transcriptional and protein level changes in the vocal folds of rabbits.

Authors:  Taylor W Bailey; Andrea Pires Dos Santos; Naila Cannes do Nascimento; Jun Xie; M Preeti Sivasankar; Abigail Cox
Journal:  Sci Rep       Date:  2021-12-17       Impact factor: 4.996

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.