The ability of enteropathogenic Escherichia coli (EPEC) to express virulence factor genes and develop attaching and effacing (AE) lesions is inhibited in acidic environmental conditions. This inhibition is due to the activation of transcription factor GadX, which upregulates expression of glutamic acid decarboxylase (Gad). Gad, in turn, produces γ-aminobutyric acid (GABA), which was recently shown to have a beneficial effect on the jejunal epithelium in vitro due to increased mucin-1 levels. In the present study, we sought to test whether forced GadX activation/overexpression abolishes virulence associated features of EPEC and provokes increased GABA production. EPEC strains were isolated from diarrheic pigs and submitted to activation of GadX by acidification as well as gadX overexpression via an inducible expression vector plasmid. GABA concentrations in the growth medium, ability for adhesion to porcine intestinal epithelial cells (IPEC-J2) and virulence gene expression were determined. Growth in acidified media led to increased GABA levels, upregulated gadA/B expression and downregulated mRNA synthesis of the bacterial adhesin intimin. EPEC strains transformed with the gadX gene produced 2.1-3.4-fold higher GABA levels than empty-vector controls and completely lost their ability to adhere to IPEC-J2 cells and to induce actin accumulation. We conclude that intensified gadX activation can abolish the ability of EPEC to adhere to the intestinal epithelium by reducing the expression of major virulence genes.
The ability of enteropathogenic Escherichia coli (EPEC) to express virulence factor genes and develop attaching and effacing (AE) lesions is inhibited in acidic environmental conditions. This inhibition is due to the activation of transcription factor GadX, which upregulates expression of glutamic acid decarboxylase (Gad). Gad, in turn, produces γ-aminobutyric acid (GABA), which was recently shown to have a beneficial effect on the jejunal epithelium in vitro due to increased mucin-1 levels. In the present study, we sought to test whether forced GadX activation/overexpression abolishes virulence associated features of EPEC and provokes increased GABA production. EPEC strains were isolated from diarrheic pigs and submitted to activation of GadX by acidification as well as gadX overexpression via an inducible expression vector plasmid. GABA concentrations in the growth medium, ability for adhesion to porcine intestinal epithelial cells (IPEC-J2) and virulence gene expression were determined. Growth in acidified media led to increased GABA levels, upregulated gadA/B expression and downregulated mRNA synthesis of the bacterial adhesin intimin. EPEC strains transformed with the gadX gene produced 2.1-3.4-fold higher GABA levels than empty-vector controls and completely lost their ability to adhere to IPEC-J2 cells and to induce actin accumulation. We conclude that intensified gadX activation can abolish the ability of EPEC to adhere to the intestinal epithelium by reducing the expression of major virulence genes.
Piglets around weaning are known to be exceedingly susceptible for gut infections, since they undergo environmental and psychological stress as well as nutritional changes. The postweaning diarrhea, starting around 3–10 days after the piglets are weaned, has been a focus of research due to the high economic losses it entails in pig production (Fairbrother et al., 2005, Hampson et al., 1993, Tsiloyiannis et al., 2001).These losses are not only caused by severe diarrhea and the resulting higher mortality but also by decreased growth performance and reduced weight gain. A characteristic pathomechanism of enteropathogenic Escherichia coli (EPEC) to cause diarrhea in humans and animals is the ability to provoke attaching and effacing lesions (AE lesions) (Bruant et al., 2009, DebRoy and Maddox, 2001, Girard et al., 2005, Kim et al., 2010, Nataro and Kaper, 1998). AE lesions are histopathological alterations in epithelial cells of the intestine. They are characterized by the effacement of microvilli through rearrangement of the epithelial cell cytoskeleton (Kaper, McDaniel, Jarvis, & Gomez-Duarte, 1997), leading to a pedestal-forming actin accumulation directly beneath the adherent bacteria (Kalman et al., 1999, Kaper et al., 1997, Kaper et al., 2004). The concurrent destruction of the enteric brush border results in enteric malfunction and diarrhea.Since infections with EPEC usually occur orally, EPEC, as well as many other bacteria, have evolved a system to cope with low pH conditions using the enzyme glutamic acid decarboxylase (Gad), which converts glutamic acid into γ-aminobutyric acid (GABA). The subsequent release of GABA via a GABA-glutamate antiporter represents the factual extrusion of protons and stabilizes the bacteria's inner pH milieu (Foster, 2004, Hersh et al., 1996, Richard and Foster, 2003). In a previous study, we have shown that luminalGABA has significant local effects in the small intestine, namely a selective upregulation of mucin 1 (MUC1) (Braun, Sponder, Pieper, Aschenbach, & Deiner, 2015). The MUC1 protein is the best characterized transmembrane mucin and is an important player of intestinal defense. This implies that GABA ingested with vegetable food or produced by bacteria can have a direct stimulating effect on a key component of the mucosal barrier function.In E. coli two functionally undistinguishable isoforms of Gad are known: GadA and GadB (De Biase et al., 1996, Smith et al., 1992). Gene expression of gadA and gadB is regulated by the transcription factor gadX, located downstream of gadA. In case of acidic environmental conditions, gadX expression is increased, thereby leading to an upregulation of GadA/B production (Tramonti, Visca, De Canio, Falconi, & De Biase, 2002). As the pH optimum of bacterial Gad activity is discussed to be between 3.8 and 5 (De Biase et al., 1999, Shukuya and Schwert, 1960), it can be speculated that the more acidic the environment (e.g. stomach, cecum), the more GABA is produced, thereby solidifying the mucosal barrier. However, growth circumstances have to be considered because the presence of the gadA/B gene transcripts did not necessarily correlate with Gad enzyme activity, especially when cells were grown under acidic conditions (Castanie-Cornet, Penfound, Smith, Elliott, & Foster, 1999).In addition to its upregulating effect on the Gad system, GadX has also been shown to downregulate the expression of genes of the locus of enterocyte effacement (LEE) (Shin et al., 2001). It is widely accepted that LEE is largely responsible for the pathogenicity of EPEC as it includes almost all virulence genes necessary for the formation of AE lesions (An et al., 2000, Elliott et al., 1998, McDaniel et al., 1995, McDaniel and Kaper, 1997, Shaw et al., 2005). LEE comprises EscU, a component of the type III secretion system (T3SS), a needle-forming multiprotein complex, which spans through the inner and outer bacterial membrane and facilitates the translocation of bacterial effector molecules directly from the bacterial into the host cell cytoplasm (Jarvis et al., 1995).Further gene loci on LEE encode for the translocated intimin receptor (Tir) and a Tir-specific chaperone (CesT). Upon its translocation into the host cell cytoplasm via the T3SS, Tir is inserted into the host cell membrane and serves as a receptor for the bacterial adhesin intimin (Kenny et al., 1997; Kenny, 2002). Intimin, an outer membrane protein, is known as a major virulence factor of EPEC as it is required for the intimate attachment of the bacterium to the host cell. Intimin is also encoded by a gene, eae, localized within the LEE. The eae gene is commonly used in diagnostic PCR procedures for the identification of EPEC (An et al., 2000, Gomez-Duarte and Kaper, 1995, Jerse et al., 1990).The LEE-encoded regulator (Ler) activates the expression of all virulence genes of LEE. Ler itself is positively regulated by the plasmid encoded regulator (PER) (Mellies, Elliott, Sperandio, Donnenberg, & Kaper, 1999). The per gene, in turn, is a region located on a 90 kb plasmid, which is inhibited by GadX (Shin et al., 2001). Hence, it can be speculated that the more acidic the environment, the more GadX is activated and the more PER is inhibited. This prevents EPEC from unnecessary expression of virulence factors in adverse environments, e.g. during their passage through the stomach.Acidic conditions were observed to influence Gad activity (Castanie-Cornet et al., 1999). However, in the laboratory setting, acidification may irritate the hosting cell layer. Therefore, we have used acidification only as an initial proof of concept and then switched to a gadX overexpression model at neutral pH values. Accordingly, we used different EPEC strains isolated from diarrheic pigs, introduced an inducible expression vector plasmid containing the gadX gene and subsequently examined GABA production, adhesion ability in vitro and virulence gene expression on the mRNA level.
Methods
Experimental design
Proof of concept: influence of acidification on GABA production, gadA/B and eae expression
One EPEC strain was grown at either pH 5.0 or pH 7.0. RNA was isolated, reversely transcribed and analyzed for the expression levels of gad A/B and eae. GABA concentrations in the medium were measured. The experiment was repeated on four consecutive days to a total of four replicates per sample.
Influence of gadX overexpression on GABA production
One EPEC strain was transformed with either an inducible gadX plasmid or an empty plasmid. Two, three and four hours after induction with isopropyl-β-D-thiogalactopyranosid (IPTG), GABA concentration was measured in the culture medium (pH 7.0). According to the results, two additional EPEC strains were transformed and GABA levels measured only after two hours of induction with IPTG. The experiment was repeated on three consecutive days to a total of three replicates per sample.
Influence of gadX overexpression on virulence gene expression
RNA of transformed porcine EPEC strains was isolated 2 h after induction of the plasmid and analyzed for gene expression changes of gadX and gadA/B as well as of the major virulence factors intimin, tir, cesT and escU. Duplicates of the experiment were repeated on four consecutive days to a total of eight replicates per sample.
Influence of gadX overexpression on adhesion ability
The ability to adhere and cause AE lesions was tested in vitro on intestinal porcine epithelial cells (IPEC-J2) using the fluorescent actin staining (FAS) test and a regular adhesion test with the three transformed porcine EPEC strains and their respective wild type strains (one replicate per strain).
pH measurements in the gastrointestinal tract
In order to evaluate the physiological pH levels in different segments of the gastrointestinal tract, digesta samples of six pigs were analyzed using a pH meter.
Method details
Bacterial strains, culture conditions and transformation
All EPEC used in the present study (Table 1) had been isolated from either diarrheic piglets or porkers, and had been checked for the presence of the intimin gene eae, their ability to cause actin accumulation in intestinal porcine epithelial (IPEC-J2) cells (FAS test) and their growth performance in M9 minimal medium. According to the presence or absence of the bfpA plasmid (Nataro & Kaper, 1998), strains belonged to the group of typical or atypical EPEC, the latter being more common in pigs (Bruant et al., 2009, Frohlicher et al., 2008). Strains P185/04-2, and 4181/05-2 were characterized as atypical EPEC lacking the bfpA plasmid but harboring several other virulence-associated genes (e.g. non LEE virulence genes as astA, irp2, fyuA). Strain P6414/05-1 was the only typical EPEC available.
Table 1
Main characteristics of the used EPEC strains (isolated from diarrheic pigs).
Strain designation
Serotype
eae type
bfpA plasmid
FAS intensitya
P185/04–2
O76:H7
g2/q
No
1
P6414/05–1
O40:H10
e1
Yes
2
4181/05–2
Ont: H-
k
No
2
FAS intensity was scored from 0 to 3 (0=0% of all cells positive, 1: <30% of all cells positive; 2: 30–60% of cells positive; 3: >60% of cells positive).
Main characteristics of the used EPEC strains (isolated from diarrheic pigs).FAS intensity was scored from 0 to 3 (0=0% of all cells positive, 1: <30% of all cells positive; 2: 30–60% of cells positive; 3: >60% of cells positive).The standard culture medium to grow or transform bacteria was LB medium supplemented with ampicillin (0.1 g/l) at pH 7.3 and 37 °C. Bacteria were transferred to M9 minimal salt medium for experiments because standard LB medium was found to contain GABA (M9 minimal salt medium: Na2HPO4 15.1 mmol/l, KH2PO5 6.6 mmol/l, NH4Cl 18.6 mmol/l, NaCl 8.6 mmol/l, MES glucose 22.0 mmol/l, glutamate 2.0 mmol/l, MgSO4 2 mmol/l, CaCl2 0.1 mmol/l, ampicillin 0.1 g/l; pH 7.0; 37 °C). For the proof of concept, the pH of M9 was adjusted to 5.0 or 7.0.The expression vector plasmid pQE-80 L (4751 bp; Ampr; Qiagen, Hilden, Germany) was used as it includes a cis-lacIq gene that overexpresses the Lac repressor, strongly suppressing protein expression from the Lac promoter unless induced with IPTG. The gadX encoding DNA (EcoGene Accession Number EG12243) was synthetically manufactured (Life Technologies, Darmstadt, Germany) with restriction sites for BamH1 and HindIII. T4 Ligase (Fermentas, St. Leon-Rot, Germany) was used to ligate the insert into the linearized plasmid resulting in the recombinant plasmid pQE-80L:gadX. Porcine EPEC were treated with 75 mM CaCl2 to produce chemically competent cells, transformation was accomplished by heat shock (Sambrook & Russell, 2006). The untreated plasmid pQE-80L was used to generate strain-specific empty plasmid transformants, accordingly.
GABA measurements
For GABA measurements, the OD600 of the respective overnight culture was determined and the volume necessary for a final culture volume of 10 ml with an OD600 of 0.1 was added to prewarmed M9 medium. IPTG was added. For each time point, 1 ml of the culture was taken, OD600 was determined for later normalization, samples were centrifuged for 15 min (at 14,000 rpm, 0 °C) and 200 µl of the supernatant were precipitated with 200 µl of 0.2 M perchloric acid. Analysis of GABA was performed by Knauer GmbH (Berlin, Germany) using ultra-high performance liquid chromatography with electrospray ionization-mass spectrometry detection (Cohen & Michaud, 1993).
Bacterial RNA isolation and cDNA synthesis
A volume equivalent to 1 ml with an OD600 of 0.2 was collected from the respective bacterial overnight culture two hours after induction with IPTG or acidification, respectively. After centrifugation for 15 min (14,000 rpm, 0 °C) the supernatant was discarded and the pellet was resuspended in lysozyme according to the manufacturer's instructions for Gram-negative bacteria of the peqGOLD Bacterial RNA Kit (Peqlab Biotechnologie GmbH, Erlangen, Germany). Notwithstanding the peqGOLD protocol, lysis of cell membranes was facilitated by incubating the pellet in liquid nitrogen for 15 min before resuspension; thereafter, it was proceeded with the peqGOLD protocol including DNAse treatment.RNA integrities and concentrations were examined by use of a lab-on-a-chip system (Prokaryote Total RNA Nano, Agilent Technologies, Waldbronn, Germany) showing RINs around 9.6. Only RNAs with RINs>7 were used for cDNA synthesis, assuming that lower quality could affect results. RNA yields ranged from 6 to 100 ng/µl.One hundred ng of RNA were transcribed to the reverse strand using the iScript cDNA synthesis kit (Bio-Rad Laboratories GmbH, Munich, Germany) in accordance with manufacturer's instructions. The reaction product was diluted 1:10 and stored at −20 °C until further processing.
Reverse transcription-quantitative PCR (RT-qPCR)
Primers were designed to detect the target genes gadX, gadA and gadB (genes encoding glutamic acid decarboxylases A and B, respectively), eae, tir, cesT and escU using Primer3 software (http://bioinfo.ut.ee/primer3-0.4.0/primer3, for primer sequences see Table 2). The primer set for detection of gadA and gadB was designed to detect a highly conserved region in both isoforms, hence, it is referred to as gadA/B. Specificity of established RT-qPCR assays was assured by electrophoresis of PCR products through 1.5% agarose gels and sequencing of amplicons (GATC Biotech, Konstanz, Germany). For normalization, reference genes cysG and gapdh (primer sequence published by Carey, Kostrzynska, & Thompson (2009) were used. According to geNorm (Biogazelle NV, Zwijnaarde, Belgium), neither reference gene rrsA showed a sufficiently stable expression level, nor previously tested genes hcaT and idnT (Zhou et al., 2011).
Table 2
Sequences (5´ to 3´) of primers used for RT-qPCR and resulting amplicon sizes.
Gene
Forward primer
Reverse primer
Amplicon Size [bp]
gadX
ATGACGCCCACAGAGTATCAG
GGTCAGTGCCGTAAAAATTCCC
101
gadA/B
TTACCAGGTTGCCGCTTATC
ACGCAGACGTTCAGAGAGGT
163
eae
ACCGTCATATCCGGCATTAG
ACCATGACGGTAATCGATCC
169
tir
TCAGGGGAGAAAACAATGAACG
GCCACTACCTTCACAAACAGAC
101
cesT
CGACAGATAACCCTAACTTCGC
CCATCGACTTAACGACGACTTC
186
escU
GGGCGATGTAACAAAAAGTGA
CCGCACCTAATATTTCACGA
176
cysG
TTTCTGGGAGAAATTGTTCG
TTGCAGTCCTTTCAGTGTCA
181
gapdh
TCCGTGCTGCTCAGAAACG
CACTTTCTTCGCACCAGCG
299
Sequences (5´ to 3´) of primers used for RT-qPCR and resulting amplicon sizes.Relative quantification of specific mRNA was conducted on a ViiA7 Cycler (Life Technologies, Darmstadt, Germany) according to the following protocol: 95 °C for 10 min, subsequent 40 cycles at 95 °C for 15 s and 1 min at 60 °C, followed by a melting curve analysis at 95 °C for 15 s, cooling down to 60 °C for 1 min and heating up slowly to 95 °C for 15 s while monitoring fluorescence.Every sample reaction was carried out in triplicates on a 384-well plate. Each 10 µl reaction contained 5 µl of cDNA, 4.64 µl of iQ™ SYBR® Green Supermix (Bio-Rad Laboratories GmbH, Munich, Germany) and 0.18 µl of forward and reverse primers (20 µmol/l). No template controls (NTC) and negative RT samples (reverse transcription omitted) were used for every target gene. Samples were excluded from evaluation if Cq difference between sample and respective NTC was <5 or if the negative control RT was positive.Resulting Cq values and dilution series-based gene specific amplification efficiencies (which were at least 96% for all primer pairs) were entered into the software qbasePLUS (Biogazelle NV, Zwijnaarde, Belgium) for normalization with the two reference genes and subsequent expression analysis. Results were exported as calibrated normalized relative quantity (CNRQ) values. For every gene of interest, the mean CNRQ value of each empty pQE-80L group (one group per strain) was calculated and used to set all values of the group to 1. CNRQ values of the pQE-80L::gadX groups were related to their respective empty pQE-80L expression level (proof of concept: results of experiments at pH 5.0 were related to those at pH 7.0).
In vitro adhesion test
IPEC-J2 cells were seeded at a concentration of 3×105 cells per well in 24-well culture plates and grown for two days in DMEM/Ham's F12 medium (Biochrom, Berlin, Germany, pH 7.3) with 5% fetal calf serum (PAA Laboratories GmbH, Cölbe, Germany). Penicillin/streptomycin solution (1%, PAA Laboratories GmbH, Cölbe, Germany) was added for the first day only. Immediately before the adhesion test, IPEC-cells were washed twice with HEPES buffer.Transformed bacteria were cultivated overnight in LB medium with pH 7.2 containing 50 µg/ml of carbenicillin (PAA Laboratories GmbH, Cölbe, Germany) at 37 °C, then diluted in LB medium 1:100 and induced with 0.2 mM IPTG for two hours. Wild type bacteria were treated accordingly but grown without carbenicillin. Then bacterial suspensions were diluted to a concentration of 1×108 cfu per ml DMEM/HAM's F12 (5% fetal calf serum, 1% mannose, 0.2 mM IPTG, w or w/o carbenicillin, respectively) and one ml bacterial suspension was given to each well of washed IPEC-J2 cells.After 3 h of incubation, IPEC-J2-cells were washed 6 times with PBS to eliminate non-adherent bacteria. For lysis of IPEC-J2 cells, 1 ml of Triton-x-100 (1%) was added. The whole content of each well was transferred to a tube and incubated on ice for 1 h. Quantification of the adherent bacteria was carried out by plating log5-dilution series on LB agar (w/ or w/o carbenicillin; 100 µl/plate) followed by overnight culture at 37 °C. Dilutions containing less than 300 CFUs/100 µl were used to calculate the number of adherent bacteria of each well.
Fluorescent-actin staining (FAS) test
Wild type and transformed porcine EPEC used in the in vitro adhesion tests were also examined for their ability to accumulate microfilaments in the apical cytoplasm of IPEC-J2 beneath attached bacteria in a FAS test according to Knutton et al. (1991). The degree of microfilament accumulation in the FAS test is representative of a bacterium's ability to cause attaching and effacing lesions.IPEC-J2 cells were grown to confluence on 12 mm-cover slips (Hecht-Assistant, Sontheim v.d. Rhön, Germany) and infected with 1×107 cfu of bacteria in 1 ml of DMEM/HAM's F12 per cover slip. After incubation with the bacterial suspension for 3 h, cells were washed 3 times with HEPES buffer and incubated for additional 3 h in fresh DMEM/HAM's F12. Subsequently, cells were washed three times with PBS-buffer and fixed with 2% paraformaldehyde and permeabilized with 0.005% digitonin (Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany). After 50 µl of a 5 µg/ml fluorescein isothiocyanate (FITC)-phalloidin solution (Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany) had been added to each well, plates were incubated in the dark for 30 min in a humidified chamber. Then, nuclei and bacterial cells were counterstained with 10 µg/ml of propidium iodide (Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany) for 2 min. Finally, cover slips were mounted on glass slides using Mowiol mounting medium (Clariant, Sulzbach am Taunus, Germany) and evaluated under a fluorescence microscope (DM RB, Leica, Wetzlar, Germany).In order to determine the physiological pH levels in the different segments of the gastrointestinal tract, digesta samples of stomach, duodenum, mid jejunum, ileum, cecum and mid colon of six healthy pigs were collected from the slaughterhouse. The samples were taken immediately after slaughter and pH levels were determined using a portable pH meter (pH-Meter 1140, Mettler Toledo, Gießen, Germany) calibrated at 37 °C with standard buffer (pH 4 and 7) before use. Pigs had been fed a standard fattening diet.
Statistics
Summarized data of multiple measurements are presented as arithmetic mean and standard error of means (SEM). For statistical analyses Sigma Plot 11.0 (Systat Software Inc., San José, CA, USA) was used. ANOVA or a Student´s t-test was performed and if normality test failed, the Wilcoxon-Mann-Whitney test was applied.
Results
Proof of concept: influence of acidification on GABA production, gadA/B and eae transcription
The EPEC wild type strain P185/04-2 produced GABA only at low pH conditions: at pH 5.0 an average GABA concentration of 81.2±10.3 µmol/l was found in the M9 minimum salt medium (Table 3), whereas at pH 7.0 no GABA was detected (detection limit 5 µmol/l). Hence, normalization to the respective OD600 values, as performed in all later GABA concentration measurements, was not feasible and conclusions regarding the rate of increase could not be drawn. However, the increased level of gadA/B mRNA was measurable, which was 7.2-fold higher at pH 5.0 compared to pH 7.0 (p<0.01). Growth in acidified medium reduced eae transcription by 54% showing a final eae mRNA level of 0.46±0.13 compared to the level at pH 7.0 (p=0.2).
Table 3
Normalized GABA concentrations in culture supernatants of EPEC.
Strain
Plasmid
Hours of IPTG induction
GABA* [µmol/l]
Mean OD600
Normalized GABA* [µmol/l /OD600]
Significance**
P185/04–2
Wild type, pH 7.0
–
<5.0
0.540
–
Wild type, pH 5.0
–
81.2±10.3
0.524
156.5±26.2
a
Empty pQE-80L
2
181.1±13.1
0.659
274.7±19.6
b
3
192.8±40.9
0.665
290.7±63.9
a, b
4
173.5±39.0
0.674
260.5±65.5
ab
pQE-80L:gadX
2
398.2±18.6
0.634
628.3±28.1
c
3
417.3±14.0
0.669
624.1±25.5
c
4
366.6±42.4
0.681
537.2±58.7
c
P6414/05–1
Empty pQE-80L
2
16.5±0.7
0.308
53.7±3.7
d
pQE-80L:gadX
2
53.2±5.4
0.363
146.8±13.8
a, e
4181/05–2
Empty pQE-80L
2
19.6±1.6
0.408
48.3±5.0
d
pQE-80L:gadX
2
67.7±5.5
0.413
164.4±13.9
a, e***
data are given as arithmetic means and standard error of the mean of three replicates (except for wild type P185/04-2 where four replicates where used).
supernatants that do not share the same letter, differ significantly (p<0.05).
if normality test failed, a Wilcoxon-Mann-Whitney test was performed instead of Student´s t-test.
Normalized GABA concentrations in culture supernatants of EPEC.data are given as arithmetic means and standard error of the mean of three replicates (except for wild type P185/04-2 where four replicates where used).supernatants that do not share the same letter, differ significantly (p<0.05).if normality test failed, a Wilcoxon-Mann-Whitney test was performed instead of Student´s t-test.
Influence of gadX overexpression on GABA production
Two, three and four hours after induction with IPTG, GABA concentrations were measured in the culture supernatant of EPEC strain P185/04-2 transformed with either pQE-80L:gadX or the empty vector pQE-80L. Values were normalized to the respective culture density (OD600 value). GABA concentrations in cultures of pQE-80L:gadX transformants were at least twofold higher than in cultures of empty vector transformants (Table 3). Concentrations determined after two, three and four hours of incubation did not differ from each other significantly. Therefore, GABA concentrations were determined only after two hours for EPEC strains P6414/05-1 and 4181/05-2. GABA concentrations were distinctly lower in these strains, but so were OD600 values, hence, after normalization these strains showed GABA differences between empty vector controls and gadX transformants comparable to those seen in P185/04-2 with up to 3.4-fold higher values in cultures of pQE-80L:gadX transformants.
Influence of gadX overexpression on virulence gene expression
Upon induction with IPTG, gadX mRNA levels rose significantly (200 to 1100-fold) in all gadX transformants compared to the respective empty plasmid transformants which were set to 1.0 (Fig. 1, p<0.01). In accordance with these results, transcription levels of gadA/B were also markedly higher 14–24-fold) in each gadX transformant (Fig. 2, p<0.05). To test whether these increased mRNA levels coincided with decreased expression of LEE-encoded virulence genes, transcription of eae, tir, cesT and escU were investigated. Interestingly, basal transcription levels of these virulence genes strongly depended on the EPEC strain tested (e.g. only low expression of eae in P185/04-2 and almost no tir expression in P6414/05-1; data not shown). However, gadX overexpression reduced eae, tir, escU and cesT transcription in all three strains. This was significant for eae in strains P185/04-2 and P6414/05-1 (Fig. 3A), for tir in strain P185/04-2 (Fig. 3B) and for escU in strain P6414/05-1 (Fig. 3C). As CNRQ data showed large variances between the eight experiments, other values failed to be statistically significant (p≥0.05).
Fig. 1
Transcription of gadX in transformed EPEC strains. Plasmid (pQE-80 L)-encoded gadX transcription was induced in two atypical (P185/04-2 and 4181/05-2) and one typical EPEC strain (6414/05-1) with IPTG for two hours. Analysis by RT-qPCR revealed that gadX mRNA was significantly increased in gadX transformants (hatched bars) compared with respective transformants harboring the empty plasmid pQE-80L only (black bars, mRNA level set to 1.0). Data are given as arithmetic means and standard errors of means of eight replicates (duplicates tested on four consecutive days); **p<0.01.
Fig. 2
Transcription of gadA/B in transformed EPEC strains. Upon IPTG induction, those transformants harboring pQE-80L:gadX showed significantly higher gadA/B transcription (hatched bars) than the respective transformants harboring the empty plasmid pQE-80L only (black bars, mRNA level set to 1.0). Data are given as arithmetic means and standard errors of means of eight replicates (duplicates tested on four consecutive days); **p<0.01, *p<0.05.
Fig. 3
Transcription of virulence genes in transformed EPEC strains. Transcriptions of eae (A), tir (B), escU (C) and cesT (D) in IPTG-treated pQE-80L::gadX transformants (hatched bars) were compared to those of the respective transformants harboring the empty plasmid pQE-80L only (black bars, mRNA level set to 1.0). Despite a high variability in baseline expression (data not shown), all virulence factors were numerically or significantly down-regulated in all EPEC transformants that had shown gadX overexpression (see Fig. 1). Data are given as arithmetic means and standard errors of means of eight replicates (duplicates tested on four consecutive days); *p<0.05.
Transcription of gadX in transformed EPEC strains. Plasmid (pQE-80 L)-encoded gadX transcription was induced in two atypical (P185/04-2 and 4181/05-2) and one typical EPEC strain (6414/05-1) with IPTG for two hours. Analysis by RT-qPCR revealed that gadX mRNA was significantly increased in gadX transformants (hatched bars) compared with respective transformants harboring the empty plasmid pQE-80L only (black bars, mRNA level set to 1.0). Data are given as arithmetic means and standard errors of means of eight replicates (duplicates tested on four consecutive days); **p<0.01.Transcription of gadA/B in transformed EPEC strains. Upon IPTG induction, those transformants harboring pQE-80L:gadX showed significantly higher gadA/B transcription (hatched bars) than the respective transformants harboring the empty plasmid pQE-80L only (black bars, mRNA level set to 1.0). Data are given as arithmetic means and standard errors of means of eight replicates (duplicates tested on four consecutive days); **p<0.01, *p<0.05.Transcription of virulence genes in transformed EPEC strains. Transcriptions of eae (A), tir (B), escU (C) and cesT (D) in IPTG-treated pQE-80L::gadX transformants (hatched bars) were compared to those of the respective transformants harboring the empty plasmid pQE-80L only (black bars, mRNA level set to 1.0). Despite a high variability in baseline expression (data not shown), all virulence factors were numerically or significantly down-regulated in all EPEC transformants that had shown gadX overexpression (see Fig. 1). Data are given as arithmetic means and standard errors of means of eight replicates (duplicates tested on four consecutive days); *p<0.05.
Influence of gadX overexpression on adhesion ability in vitro
Adhesion and FAS tests were performed to test for the functional consequences of decreased virulence factor expression following gadX overexpression. Wild type porcine EPEC and those transformed with empty pQE-80L adhered to IPEC-J2 cells distinctively, whereas bacteria transformed with pQE-80:gadX did not show any adhesion (Fig. 4). Noticeably, not a single colony forming unit was detected to be adherent in any tested EPEC strain after transformation with pQE-80L:gadX. The latter finding suggests that gadX overexpression leads to functionally relevant downregulation of virulence genes in porcine EPEC.
Fig. 4
Adhesion of wild type and transformed EPEC strains to IPEC-J2 cells. After transformation with pQE-80L:gadX, all three strains lost their ability to adhere to jejunal porcine epithelial cells (IPEC-J2) in vitro (hatched bars; not visible as the number of adhering bacteria was below the detection limit of the assay which was 10 cfu/well). In contrast, all wild type strains were able to adhere, as well as the respective transformants harboring empty pQE-80L. (one replicate per strain).
Adhesion of wild type and transformed EPEC strains to IPEC-J2 cells. After transformation with pQE-80L:gadX, all three strains lost their ability to adhere to jejunal porcine epithelial cells (IPEC-J2) in vitro (hatched bars; not visible as the number of adhering bacteria was below the detection limit of the assay which was 10 cfu/well). In contrast, all wild type strains were able to adhere, as well as the respective transformants harboring empty pQE-80L. (one replicate per strain).In agreement with the results of the in vitro adhesion test, transformation of porcine EPEC with pQE-80L::gadX completely abolished characteristic microfilament accumulation in IPEC-J2 cells that usually occurs upon exposure to LEE-encoding E. coli such as EPEC and some EHEC. Thus, adhering bacteria and actin accumulation beneath these bacteria were only found in IPEC-J2 cells cultured with wild type EPEC or their derivatives transformed with empty pQE-80L but not after incubation with pQE-80L:gadX transformants (Fig. 5).
Fig. 5
IPEC-J2 cells in the fluorescent-actin staining (FAS) test of EPEC strain 4181/05-2 and its transformants. In an IPTG-containing medium, IPEC-J2 cells (red nuclei, green actin/cell membranes) had been incubated with the (A) wild type strain, (B) pQE-80L transformant, or (C) pQE-80L:gadX transformant. Localized adherence of bacteria (conglomerates of tiny red spots) and accumulated actin (green accumulations right underneath bacteria) were only visible in A and B. Original magnifications×1000.
IPEC-J2 cells in the fluorescent-actin staining (FAS) test of EPEC strain 4181/05-2 and its transformants. In an IPTG-containing medium, IPEC-J2 cells (red nuclei, green actin/cell membranes) had been incubated with the (A) wild type strain, (B) pQE-80L transformant, or (C) pQE-80L:gadX transformant. Localized adherence of bacteria (conglomerates of tiny red spots) and accumulated actin (green accumulations right underneath bacteria) were only visible in A and B. Original magnifications×1000.
pH measurements in the gastrointestinal tract
As expected, the lowest pH was found in the digesta fluid of the stomach (4.1±0.3, average pH of N=6), whereas the jejunum appeared to have the highest pH (6.5±0.1), decreasing again in the cecum (6.0±0.2, see additional file 1). These findings are very much in line with the results of our previous study (Braun et al., 2015): highest concentrations of GABA were found in the stomach whereas the lowest GABA concentration was detected in the jejunum, increasing again towards the hindgut.
Discussion
EPEC have been intensely studied due to their causative role in endemic infant diarrhea in developing countries (Levine and Edelman, 1984, Rowe, 1979, Trabulsi et al., 2002) and they were even regarded to be the most common bacterial pathogens in infants (Gomes et al., 1991, Katouli et al., 1990, Khan et al., 1988, Mubashir et al., 1990). Animals have been considered a significant source for atypical EPEC infections in humans (Chandran & Mazumder, 2013), whereas typical EPEC have mainly been isolated from humans and only infrequently from dogs or pigs (Beaudry et al., 1996, Kaufmann et al., 2006). Thus, EPEC infections are still of importance, requiring further elucidation of the interplay of EPEC metabolism and the hosts immune system. The fact that crucial functions of pathogenicity – as for the induction of LEE genes by gadX (Branchu et al., 2014)- have also been found to be present in other pathogens like EHEC- might imply a viable approach for new prevention and treatment strategies.In the present study, we could show that acidification of the growth medium of a wild type EPEC strain can upregulate gadA/B expression, lead to measurable concentrations of GABA, and suppress eae expression. Plasmid-driven gadX overexpression in a pH neutral environment can lead to a complete loss of EPEC's ability to attach to and interact with IPEC-J2 cells due to downregulation of LEE virulence genes. Additionally, gadX overexpression in a pH neutral environment also increased GABA production. These results clearly demonstrate that GadX is important for GABA production and a crucial factor of the regulation of AE-promoting EPEC virulence genes.Regarding Gad expression after acidification, we found a 7.2-fold increased gadA/B expression at pH 5.0. Accordingly, we found an average production of 81.2 µmol/l GABA of wild type EPECs at pH 5.0, whereas at pH 7.0 GABA amounts appeared to be below the detection limit of 5 µmol/l. This is not astonishing, as both Gad expression and decarboxylation of glutamic acid are usually stimulated by the presence of excess protons (Castanie-Cornet et al., 1999). Nevertheless, this does not explain why GABA production of the wild type strain at pH 7.0 was below the detection limit, whereas the same strain containing an empty plasmid produced 174–193 µmol/l GABA at pH 7.0. Even though this effect might have been induced by the transformation with the empty plasmid, or by the use of IPTG, we should also consider that the variance between experiments might have been caused by other factors. When looking closer into our data, differences were primarily due to considerable variance in growth performance (expressed as OD600) and baseline expression of the selected LEE genes between strains (e.g., very low expression levels of all factors in strain 4181/05-2), between virulence factors (e.g., generally low expression of cesT in all strains) and even between experiments performed under apparently identical experimental conditions.The importance of growth performance on bacterial gene expression and metabolism is already known from previous studies. For example, Castanie-Cornet et al. (1999) and De Biase et al. (1999) showed that gadA/B gene activity depends on whether bacteria are in the log phase or in the stationary phase. Shin et al. (2001) found large variances in virulence gene expression related to slight changes of growth conditions. Also Yokoigawa, Takikawa, Okubo, and Umesako (2003) showed that growth phase and temperature can influence the expression of Gad genes. Although the experimental setup was always the same, we cannot tell whether the growth phase of all strains and experiments was always identical at the time of sampling. As there was no difference seen between the three time points tested with strain P185/04-2, neither in terms of OD600 nor in terms of GABA production, we assumed that after two hours the stationary phase had been reached. Hence, all further experiments (GABA measurements and RNA isolations) were conducted after two hours of incubation. Although GABA concentrations were distinctly lower in strains P6414/05-1 and 4181/05-2, using OD600 to normalize GABA levels resulted in GABA differences between empty vector controls and pQE-80L::gadX transformants comparable to those seen in P185/04-2 with 2.7–3.4-fold higher values.Our results partially conflict with those of Shin et al. (2001), who tested gadX-transformed typical EPEC positive in FAS test despite lower protein expression levels for intimin, Tir, CesT and even slightly decreased BfpA expression. They concluded that the production of virulence proteins – although reduced – was still sufficient to induce actin cytoskeletal rearrangements in HeLa cells. Since these authors did not use a vector providing overexpression driven by the taq promoter, gadX overexpression in transformed EPEC could have been lower compared to our study. This could explain why interaction of transformed EPEC with cultured epithelial cells (HeLa) was not completely abolished in their study.Dose effects of GadX may also be expected from the results of an analysis of the LEE-encoding EHEC strain O157:H7 (Branchu et al., 2014). This study showed that GadX is not only a negative regulator of LEE1 (thereby suppressing the expression of all other LEE genes) but also a positive regulator of LEE4 and LEE5. For this reason, we focused especially on LEE5 genes (eae, tir, cesT) to evaluate the net effect of gadX on these genes. The net effect was consistently negative, although not always statistically significant.To date, it is well known that GABA - as an exemplary neurotransmitter - has many functions outside the mammalian brain (Erdo & Wolff, 1990). Even for the gut, various effects of GABA have already been described, as for example the alteration of smooth muscle activity (Bayer, Crenner, Aunis, & Angel, 2002) or the activation of antibody secretion by the intestinal epithelium (Jin, Guo, & Houston, 1989). A recent study demonstrated the modulation of abdominal pain by GABA derived from enteric Bifidobateria (Pokusaeva et al., 2016). In accordance with our recent hypothesis that GABA levels influence mucin-1 expression, McGuckin, Linden, Sutton and Florin (2011) described that the mucus layer is thickest in the stomach and colon. Apparently this does not only correlate with the number and distribution of mucus-producing cells throughout the gastrointestinal tract but also with our finding that GABA levels are highest in the stomach and colon (Braun et al., 2015). These GABA levels were derived from the same animals and correlate well with measured pH levels. At least for the hindgut, this supports our hypothesis that there is a link between pH and resulting GABA production by enteric bacteria.Considering these facts, we assume that the GABA content in the intestinal fluid, which might – at least in parts - be derived from bacterial production, can remarkably influence the gastrointestinal physiology via specific GABA receptors. An increase of intestinal GABA production could lead to increased GABA resorption and resulting higher blood levels, however, effects would probably be restricted to the gastrointestinal tract since GABA as a zwitterion cannot pass the blood brain barrier. Thus, effects on the central nervous systems, as they are known from commonly available drugs like GABA receptor agonists or modulators of the GABA synthesis in the brain, are rather unlikely.However, the interplay between bacterial GABA and the intestine is poorly understood so far. The lack of knowledge in this field offers another interesting subject for further research.Finally, we have to answer the question of the applicability of our results. The signal that the environment is unfavorably acidic is translated via GadX into reduced efforts of the bacterium to adhere and stay at this unfavorable site as well as into increased efforts to defend (real or fake) intracellular bacterial pH via GABA production. Mimicking such an unfavorable environment by intentional activation of the GadX regulon may reprogram bacteria so that virulence is suppressed. Drugs activating the bacterial GadX regulon are not available so far but there might be other options to modulate this pathway. For instance, Branchu et al. (2014) postulate that the nitric oxide (NO) sensor nitrite-sensitive repressor (NsrR) is a direct positive regulator of the transcription of LEE1, LEE4 and LEE5 genes and an indirect repressor of gadE and gadX genes. However, supporting antibiotics in their mode of action or even replacing them by GadX modulators is still a long way off and requires further research.
Conclusions
We conclude that intensified gadX activation in EPEC can abolish EPEC´s ability to adhere to the intestinal epithelium by reducing expression of virulence genes like intimin. Since production of GABA, a neurotransmitter with potentially positive effects on the mucosal barrier, was increased at the same time, the GadX regulon could be an interesting target for the prevention of EPEC-associated postweaning diarrhea in piglets.
Funding
The study was supported by Pfizer Animal Health (Zoetis).
Declarations
The authors declare no conflict of interest related to this work.The study was financially supported by Pfizer Animal Health (Zoetis).
Authors' contributions
JRA and CD conceived and designed the experiments. HSB, GS, KK and CD performed the laboratory work. KK and RB acquired and provided EPEC isolates. GS performed the transformation of the EPEC isolates. HSB, JRA, KK, RB, and CD analyzed the data. HSB, JRA and CD prepared the manuscript. All authors participated in interpretation and discussion of results and have read and approved the final manuscript.
Authors: Guillaume Bruant; Yongxiang Zhang; Philippe Garneau; Justin Wong; Chad Laing; John M Fairbrother; Victor P J Gannon; Josée Harel Journal: BMC Genomics Date: 2009-08-26 Impact factor: 3.969
Authors: K Pokusaeva; C Johnson; B Luk; G Uribe; Y Fu; N Oezguen; R K Matsunami; M Lugo; A Major; Y Mori-Akiyama; E B Hollister; S M Dann; X Z Shi; D A Engler; T Savidge; J Versalovic Journal: Neurogastroenterol Motil Date: 2016-07-25 Impact factor: 3.598
Authors: William R Schwan; Joshua Luedtke; Kathleen Engelbrecht; Jeremy Mollinger; Andrew Wheaton; John W Foster; Robert Wolchak Journal: Microbiology (Reading) Date: 2022-03 Impact factor: 2.956