Distribution of cells expressing vomeronasal receptors in the olfactory organ of turtles.

Generally, the olfactory organ of vertebrates consists of the olfactory epithelium (OE) and the vomeronasal organ (VNO). The OE contains ciliated olfactory receptor neurons (ORNs), while the VNO contains microvillous ORNs. The ORNs in the OE express odorant receptors (ORs), while those in the VNO express type 1 and type 2 vomeronasal receptors (V1Rs and V2Rs). In turtles, the olfactory organ consists of the upper (UCE) and lower chamber epithelia (LCE). The UCE contains ciliated ORNs, while the LCE contains microvillous ORNs. Here we investigated the distribution of cells expressing vomeronasal receptors in the olfactory organ of turtles. The turtle vomeronasal receptors were encoded by two V1R genes and two V2R genes. Among them, V2R1 and V2R26 were mainly expressed in the LCE, while V1R3 was expressed both in the UCE and LCE. Notably, vomeronasal receptors were expressed by a limited number of ORNs, which was confirmed by the expression of the gene encoding TRPC2, an ion channel involved in the signal transduction of vomeronasal receptors. Furthermore, expression of ORs by the majority of ORNs was suggested by the expression of the gene encoding CNGA2, an ion channel involved in the signal transduction of ORs. Thus, olfaction of turtle seems to be mediated mainly by the ORs rather than the vomeronasal receptors. More importantly, the relationship between the fine structure of ORNs and the expression of olfactory receptors are not conserved among turtles and other vertebrates.

Many tertapods have two olfactory organs: the olfactory epithelium (OE) and the vomeronasal organ (VNO) [4, 15, 21, 54]. In mice, the OE lines dorso-caudal portion of the nasal cavity, while the VNO is situated at the base of the nasal septum. Chemosensory cells in the olfactory organs, namely, olfactory receptor neurons (ORNs), are bipolar neurons extending an axon basally and a dendrite apically. Generally, the ORNs in the OE bear cilia at the tip of their dendrites and project their axons to the main olfactory bulb, while those in the VNO bear microvilli at the tip of their dendrites and project their axons to the accessory olfactory bulb [20, 53, 54]. In fish, a discrete VNO does not exist and the olfactory organ is represented solely by the OE. The OE of fish contains both ciliated and microvillous ORNs which project their axons to the distinct parts of olfactory bulb [22, 45, 54].

Olfactory chemoreception is mediated by the olfactory receptors which are members of seven transmembrane, G protein coupled receptors. They are categorized into three families: odorant receptors (ORs), type 1 vomeronasal receptors (V1Rs) and type 2 vomeronasal receptors (V2Rs) coupled to Gαolf, Gαi2 and Gαo, respectively [8, 11, 12, 24, 36, 44]. In mice, each ORN in the OE expresses only one OR gene out of a repertoire of over 1,000 OR genes [38, 52], whereas that in the VNO expresses one or a few members of vomeronasal receptor (VR) genes [25, 34, 50]. Furthermore, the ORNs in the apical layer of the vomeronasal sensory epithelium express V1Rs, while those in the basal layer express V2Rs [3, 11, 12, 24, 36, 44]. In the OE of fish, as in the olfactory organ of mice, ciliated ORNs express ORs and Gαolf, while microvillous ORNs express V2Rs and Gαo [23, 45]. Thus, it is generally believed that the fine structure of ORNs and the gene expression of olfactory receptors are closely related to each other, and that this relationship is conserved among vertebrates [14, 23].

The olfactory organ of turtles is comprised of two types of sensory epithelia: the upper chamber epithelium (UCE), lining the dorsal portion of the nasal cavity, and the lower chamber epithelium (LCE), lining the ventral portion of the nasal cavity. The ORNs in the UCE and LCE project their axons to the ventral and dorsal parts of the olfactory bulb, respectively [1, 37, 46].

As described above, the OE of mammals contains ciliated ORNs while the VNO contains microvillous ORNs. Meanwhile, the OE of reptiles and birds contains ORNs bearing both cilia and microvilli at the tip of their dendrites [13, 29]. In general, the ORNs in the UCE of turtles bear cilia and microvilli at the tip of their dendrites and thus the UCE is regarded as the OE. On the other hand, the ORNs in the LCE bear only microvilli and thus the LCE is regarded as the VNO [17, 41, 57].

​Based on the fine structure of ORNs, it is speculated that the ORNs of turtles in the UCE express both OR and VR genes, while those in the LCE express only VR genes. Nevertheless, immunohistochemical analyses of the olfactory organ of turtles, including Reeve’s turtle, snapping turtle and red-eared slider, expression of the Gαolf and Gαo have been demonstrated both in the UCE and LCE [41, 42, 55]. Moreover, expression of Gαi1-3 has been reported in the LCE of the common musk turtle and red-eared slider [40]. These pieces of evidence suggest that ORNs in the UCE of turtles express both ORs and V2Rs, whereas those in the LCE express ORs, in addition to VRs.

The inconsistency between the olfactory receptors deduced by the fine structure of ORNs and the G protein expression in the LCE leads to the need for the elucidation of olfactory receptor genes expressed in the olfactory organ of turtles. Thus, we analyzed the expression of VRs in the present study. Also, expression of the gene encoding TRPC2, an ion channel mediating the signal transduction of VRs [12, 33, 59], and the expression of the gene encoding CNGA2, an ion channel mediating the signal-transduction of ORs [6, 12], were examined to proxy the type of olfactory receptors expressed in the olfactory organ of turtles.

MATERIALS AND METHODS

Animal handling and tissue preparation

Totally twelve red-eared sliders Trachemys scripta of both sexes weighing 457–1,698 g and two soft-shelled turtles Pelodiscus sinensis, one male (1,132 g) and one female (1,164 g), were used in the present study (Table 1). Red-eared sliders captured at Hyogo prefecture, Japan, were generous gift from Suma Aqualife Park (Kobe, Japan). Soft-shelled turtles were purchased from a local turtle farm. Samplings were done during 2017–2019.

Table 1.

Details of animals used in this study

Animal number	Sex	Sampling date(Day/Month/Year)	Body weight (g)	Carapace length (cm)
1	Female	19/06/2017	1,164	19.0
2	Female	19/06/2017	1,294	21.0
3	Female	03/02/2018	995	20.0
4	Female	31/03/2019	1,698	22.7
5	Female	31/03/2019	1,346	20.1
6	Female	02/06/2018	1,143	19.5
7	Female	26/09/2018	1,200	20.0
8	Female	26/09/2018	1,248	20.0
9	Female	17/12/2018	1,200	20.8
10	Male	31/03/2019	883	18.5
11	Male	02/06/2018	457	14.5
12	Male	02/06/2018	442	15.0
13	Male	20/09/2018	916	18.6
14	Male	17/12/2018	556	15.8
15	Male	26/09/2018	1,132	20.0

Animals #1 and #2 were used for RNA extraction; animals #3–15 were used for in situ hybridization. #2–-14, red-eared sliders; #1 and #15, soft-shelled turtles.

Animals were anesthetized by intraperitoneal injection of pentobarbital sodium, 60 mg/kg of body weight. For RNA isolation and reverse transcription-polymerase chain reaction (RT-PCR), one soft-shelled turtle and one red-eared slider were killed by decapitation. The UCE and LCE were immediately dissected out and preserved at −80°C until use.

The remaining animals were sacrificed by exsanguination through transcardial perfusion with Ringer’s solution and fixed by 4% paraformaldehyde (PFA) in 0.1 M phosphate buffer (PB). After decapitation, tissues surrounding the nasal cavity were removed. Heads were immersed in the same fixative solution overnight at 4°C and then decalcified in 10% ethylenediamine tetra acetic acid in 0.1 M PB for several days. After decalcification, olfactory organs were cryoprotected in sucrose gradient, embedded in O.C.T. compound (Sakura Finetek, Tokyo, Japan) and cryosectioned at 20 µm in thickness.

All procedures of the animal handling were carried out in accordance with Standards for Animal Care and Use at Iwate University (approval No. A201720).

PCR cloning

Total RNA was isolated from the turtle olfactory organ according to the manufacturer’s protocol. Briefly, the samples containing both UCE and LCE were homogenized using 1 ml ISOGEN reagent (Nippon gene, Tokyo, Japan) with a homogenizer and incubated for 5 min at room temperature. An appropriate amount of chloroform was added and mixed vigorously. The samples were centrifuged at 15,000 rpm for 10 min at 4°C. The supernatant was transferred to new tubes, mixed with isopropanol and kept at room temperature for 10 min. Subsequently, samples were centrifuged at 15,000 rpm for 20 min at 4°C to obtain RNA pellets. The pellets were washed with 1 ml of 70% ethanol and dissolved into 30 µl diethyl pyrocarbonate (DEPC)-treated water. Total RNA was digested with DNase I (Takara, Kusatsu, Japan) to remove contaminating genome DNA. After evaporation of ethanol, an absorbance of 260 nm was measured for RNA by a spectrophotometer and preserved at −80°C until use.

For synthesizing first-strand cDNA, the total RNAs were subjected to reverse transcription. For each sample, 2 µg of total RNA was mixed with ReverTra Ace (Toyobo, Osaka, Japan), (1µl, 100 U/µl), oligo-(dT) (1 µl, 10 pmol/µl), dNTPs (1 µl, 10 mM; Takara) in a final volume of 20 µl by adding DEPC-treated water. PCR primers were designed based on the nucleotide sequences of soft-shelled turtle V2R1 [GenBank: XM-006123493], V2R26 [XM-006111317], V1RA14 [XM-014581607], TRPC2 [XM-006111779] and CNGA2 [XM-014580174]. For red-eared slider, primers were designed based on the nucleotide sequence of western painted turtle Chrysemys picta V2R1 [XM-005287015], V2R26 [XM-005284259], V1RA14 [XM-005291513] and V1R3 [XM-0053033611]. A list of primers is shown in Table 2. PCR was performed using Takara Ex Taq (Takara). The PCR products were mixed with 1 µl loading buffer and loaded into 1% gel electrophoresis. The gel extraction was performed to purify the cDNAs by MinElute Gel Extraction Kit (Qiagen, Hilden, Germany), and cDNAs were cloned using TOPO TA cloning Kit (Thermo Fisher Scientific, Rockford, IL, USA). The sequences of cDNA fragments were analyzed by a genetic analyzer (HITACHI 3500). Finally, the sequence similarity search for obtained fragments of red-eared slider with corresponding genes in the western painted turtle were done by BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The obtained nucleotide sequences of V2Rs and V1R3 showed 99 and 98% identity with their counterpart sequences in western painted turtle, respectively.

Table 2.

Primers for PCR amplification

Genes	Forward primers	Reverse primers
PelodiscussinensisV2R1	gtatgctggccattcaaggt	cctcacttgcaatccaggtt
P. sinensis V2R26	ttctcaacaccagcttgacg	cagaaccacaaggacggttt
P. sinensisV1RA14	ggcaacctcgttgttgtctt	tttcaggcaccaacaggctt
P. sinensisTRPC2	tgcgagaaggacctctacga	agatggaggacagcacttgc
P. sinensisCNGA2	cttccaggactgtgaggctg	cttgatcaggatctcccggc
ChrysemyspictaV2R1	tggtgcacctcttgtagcag	agtgctgatgtaacccaggc
C. pictaV2R26	tcccaactcacccggactat	caacccaggtccatcggaaa
C. pictaV1R3	ggaaaagtcacgccctctga	cctgcttcccgtgctgataa
C. pictaV1RA14	acacttaccacacgtgagg	agacaccattgaggacgctg

Probe preparation

Digoxigenin (DIG)-labeled cRNA sense and antisense probes were synthesized for soft-shelled turtle and red-eared slider individually by in vitro transcription using DIG RNA labeling kit (SP6 and T7) (Roche Diagnostics GmbH, Mannheim, Germany).

In situ hybridization

Sections were washed in 0.1 M phosphate buffered saline (PBS) for 15 min and fixed in 4% PFA for 10 min. Subsequently, sections were treated with 10 µl/ml proteinase K for 15 min at 37°C followed by washing in PBS glycine for 10 min plus PBS for 6 min. The sections were stabilized with 4% PFA and immersed in 0.1% acetic anhydrate in the acetylation buffer for 15 min followed by washing in 4×saline-sodium citrate (SSC) for 20 min. Pre-hybridization was carried out using hybridization buffer ISHR7 (Nippon gene, Tokyo, Japan) at 55°C. Hybridization was performed using 0.25 ng/µl of cRNA sense and antisense probes in the hybridization buffer overnight at 55°C. Post-hybridization washes were carried out in formamide/2×SSC for 1 hr and 0.1×SSC for 2 hr at same temperature. And then sections were treated with blocking buffer for 30 min. The sections were incubated with anti-DIG antibody (Roche Diagnostics GmbH) for 2 hr and washed with Tris-buffered saline (TBS) for 30 min. Sections were transferred in NTM buffer containing 1 M Tris HCl, 1 M MgCl2, 5 M NaCl and distilled water. Lastly, sections were colorized by 5-bromo-4-chloro-s-indolyl-phosphate (BCIP) and 4-nitro blue tetrazolium chloride (NBT) coloring agent (Roche Diagnostics GmbH) and washed with TE and TBS buffers each for 5 min.

Analyzing the density of cells expressing VRs and TRPC2

Serial sections were prepared along the whole extent of the olfactory organ and three to five sections were picked up from each of the rostral, intermediate and caudal regions, to examine the distribution of cells expressing VRs and TRPC2 in all regions of olfactory organ. The number of cell bodies with a clear signal was counted for UCE and LCE, individually. At the same time, the area of the UCE and LCE were measured with ImageJ software (http://rsb.info.nih.gov/ij/). Subsequently, the number of cells expressing VRs and TRPC2 were divided by the area of each epithelium to obtain the density of cells expressing VRs and TRPC2 (cells per mm2). Data was represented as mean ± standard error (SE). The difference in the density of cells expressing VRs and TRPC2 along the rostro-caudal axis of the olfactory organ and their relative abundance in the UCE and LCE were statistically analyzed by either student’s t-test for comparison of two means or a one-way analysis of variance for more than two means. P<0.05 was considered to be statistically significant.

Spatial distribution analysis

The distribution of cells expressing VRs and TRPC2 along the apical-to-basal axis of epithelium were analyzed as described by Syed et al. (2013) [51] with slight modification. Briefly, the relative depth of cells expressing VRs and TRPC2 was defined as the distance of the cell soma center from the apical surface of epithelium divided by the entire thickness of epithelial layer at the position. Data were arranged in bins with 0.1 intervals. Zero corresponds to most apical and one corresponds to most basal.

RESULTS

Expression of the genes encoding V2Rs

In turtles, V2Rs are encoded by two genes, including V2R1 and V2R26. By the RT-PCR conducted to determine the genes encoding V2Rs expressed in the olfactory organ of red-eared slider, a single band was obtained for both V2R1 and V2R26 genes (Fig. 1), indicating the expression of V2R genes in the olfactory organ of red-eared slider.

Fig. 1.

Reverse transcription-polymerase chain reaction analysis for the V2R1 and V2R26 genes showing the expression of both V2R genes in the olfactory organ of red-eared slider.

By the in situ hybridization performed to clarify the localization of cells expressing V2Rs in the olfactory organ of red-eared slider, cells expressing V2R1 were found only in the LCE (Fig. 2A and 2B), whereas those expressing V2R26 were found both in the UCE and LCE (Fig. 2D–F). No signals were detected in the sections hybridized with sense probes (Fig. 2C and 2G). As shown in the Fig. 2H, the density of cells expressing V2R26 was significantly higher in the LCE than in the UCE (1.823 ± 0.132 cells/mm2 in the LCE, 0.34 ± 0.08 cells/mm2 in the UCE). Furthermore, statistical analysis indicated no significant difference in the density of cells expressing V2R26 along the rostro-caudal axis of the olfactory organ (1.303 ± 0.308 cells/mm2 in the rostral, 1.106 ± 0.269 cells/mm2 in the intermediate and 0.87 ± 0.24 cells/mm2 in the caudal regions) (Fig. 3A–C). Similarly, cells expressing V2R1 distributed almost evenly along the rostro-caudal axis of the olfactory organ (3.342 ± 1.259 cells/mm2 in the rostral, 3.296 ± 1.531 cells/mm2 in the intermediate and 3.229 ± 1.172 cells/mm2 in the caudal regions). Thus, a region containing higher density of cells expressing V2Rs was not found.

Fig. 2.

In situ hybridization analysis for the localization of cells expressing V2Rs in the olfactory organ of red-eared slider. Cells expressing V2R1 were localized only in the lower chamber epithelium (LCE) (A, B), while those expressing V2R26 were localized both in the upper chamber epithelium (UCE) and LCE (D–F). Asterisks in (A, D) indicate the boundary between UCE and LCE. (B, E and F) Higher magnification views for boxed areas in A and D, respectively. No signals were detected in the sections hybridized with sense probes (C, G). Scale bars=1 mm in (A, D), 50 µm in (B, C and E–G), 20 µm in insets. (H) Relative abundance of cells expressing V2R26 between the UCE and LCE of red-eared slider. The density of cells expressing V2R26 was significantly higher in the LCE than in the UCE. Each column and vertical bar represent the mean and standard error (n=9). Asterisk indicates a significant difference between the UCE and LCE (P<0.05).

Fig. 3.

Distribution of cells expressing V2R genes along the rostro-caudal axis of olfactory organ. (A) Schematic drawing of the head of red-eared slider. Dotted lines correspond positions in (B). (B) Transverse sections through the olfactory organ. Scale bars=1 mm. (C) Density of V2R-cells along the rostro-caudal axis of olfactory organ. Each column and vertical bar represent the mean and standard error (n=9 for V2R26 and n=6 for V2R1). No significant difference was found in the density of cells expressing V2Rs along the rostro-caudal axis of olfactory organ (P>0.05).

Moreover, differences in the expression of V2Rs were investigated among individuals with different carapace length. The density of cells expressing V2R1 varied (1.24–9.27 cells/mm2) among some individuals with different carapace lengths 15.8–22.7 cm (#4, #6, #7, #8 and #14) (Fig. 4A). Furthermore, the cells expressing V2R1 were not found in other individuals with carapace lengths of 18.5, 14.5 and 15.8 cm (#10, #11 and #13, respectively). Meanwhile, the density of cells expressing V2R26 was similar (0.2–2.54 cells/mm2) among individuals with different carapace lengths 14.5–22.6 cm (#5, #6, #8-#14) indicating the absence of individual difference for the expression of V2R26 (Fig. 4B). Data is summarized in Table 3.

Fig. 4.

The density of cells expressing V2R1 (A) and V2R26 (B) in the olfactory organ of red-eared sliders with different carapace lengths. Filled circles represent females; open circles represent males.

Table 3.

Density of cells expressing type 2 vomeronasal receptors (V2Rs) in the olfactory organ of red-eared slider

Animal number	V2R1-cells(cells/mm2)a)	V2R26-cells(cells/mm2)a)
4	2.109 ± 0.163	Not available
5	Not available	0.79 ± 0.197
6	1.243 ± 0.143	2.118 ± 0.146
7	9.271 ± 0.522	Not available
8	Not available	0.202 ± 0.05
9	1.253 ± 0.209	0.431 ± 0.059
10	0	0.362 ± 0.079
11	0	1.474 ± 0.197
13	0	1.083 ± 0.123
14	4.075 ± 0.368	2.542 ± 0.178

a) Data are represented as mean ± standard error.

Subsequently, mRNA expression of the genes encoding V2Rs was investigated in the olfactory organ of soft-shelled turtle. RT-PCR analysis revealed the expression of V2R1 only in the LCE, and V2R26 both in the UCE and LCE (Fig. 5A). Furthermore, in situ hybridization analysis demonstrated the expression of V2R26 both in the UCE and LCE (Fig. 5B and 5C). No signals were detected in the sections hybridized with sense probes (Fig. 5D). As in the case of red-eared slider, the density of cells expressing V2R26 was significantly higher in the LCE (1.456 ± 0.094 cells/mm2) than in the UCE (0.294 ± 0.12 cells/mm2) (Fig. 5E). Cells expressing V2R1 were not found either in the UCE or LCE (not shown).

Fig. 5.

Reverse transcription-polymerase chain reaction analyses for the expression of genes encoding V2Rs in the olfactory organ of soft-shelled turtle, indicating the expression of V2R1 only in the lower chamber epithelium (LCE), whereas the V2R26 was expressed both in the upper chamber epithelium (UCE) and LCE (A). (B, C) In situ hybridization analysis for the gene encoding V2R26 in the olfactory organ of soft-shelled turtle. Cells expressing V2R26 were found both in the UCE and LCE. No signals were detected in the sections incubated with sense probe (D). Scale bars=50 µm in (B–D), 20 µm in insets. (E) The relative abundance of cells expressing V2R26 in the UCE and LCE of soft-shelled turtle. The LCE contained significantly higher density of cells expressing V2R26 than the UCE (P<0.05). Each column and vertical bar represent the mean and standard error. Asterisk indicates a significant difference between the UCE and LCE.

Expression of the genes encoding V1Rs

The V1R is encoded by two genes, V1R3 and V1RA14, in western painted turtle, while the V1R is encoded by a single gene V1RA14 in soft-shelled turtle. In order to determine the V1R genes expressed in the olfactory organ of turtles, the mRNA expression of the V1R genes was investigated by RT-PCR. Obtained results indicated the expression of V1R3 in the olfactory organ of red-eared slider, but not that of V1RA14 (Fig. 6A). Also, the expression of V1RA14 was not detected in the olfactory organ of soft-shelled turtle (Fig. 6B).

Fig. 6.

Reverse transcription-polymerase chain reaction analysis for the expression of V1Rs in the olfactory organ of red-eared slider (A) and soft-shelled turtle (B). V1R3 was expressed both in the upper (UCE) and lower chamber epithelia (LCE), whereas V1RA14 was not in the olfactory organ of red-eared slider. The expression of V1RA14 was not detected in the olfactory organ of soft-shelled turtle as well. Genomic DNA was used as a control (B). (C, D) In situ hybridization analysis for V1R3 mRNA in the olfactory organ of red-eared slider. Cells expressing V1R3 were localized both in the UCE (C) and LCE (D). Scale bars=50 µm in (C, D), 20 µm in insets.

Subsequently, the localization of cells expressing V1R3 in the olfactory organ of red-eared slider was analyzed by in situ hybridization. V1R3 gene was sparsely expressed by cells both in the UCE and LCE (Fig. 6C and 6D).

Although the density of cells expressing V1R3 varied among individuals (0.906 ± 0.153 cells/mm2 in animal #3, 1.811 ± 0.133 cells/mm2 in animal #6, 1.845 ± 0.197 cells/mm2 in animal #11 and 0.254 ± 0.07 cells/mm2 in animal #12), the cells expressing V1R3 were almost evenly distributed along the rostro-caudal axis of olfactory organ. A significant difference was not found between the rostral (1.308 ± 0.355 cells/mm2), intermediate (1.232 ± 0.438 cells/mm2) and caudal regions (0.951 ± 0.301 cells/mm2) (Fig. 7A and 7B). Meanwhile, the relative abundance of cells expressing V1R3 in the UCE and LCE varied among individuals (Fig. 8). In most cases, the density of cells expressing V1R3 was higher in the UCE (1.492 ± 0.398 cells/mm2 in animal #3 and 3.366 ± 0.331 cells/mm2 in animal #11) than in the LCE (0.576 ± 0.118 cells/mm2 in animal #3 and 0.511 ± 0.151 cells/mm2 in animal #11). On the other hand, in animal #6, the density of cells expressing V1R3 was higher in the LCE (2.064 ± 0.207 cells/mm2) than in the UCE (1.369 ± 0.178 cells/mm2). Moreover, in animal #12 the density of cells expressing V1R3 was almost equal between the UCE (0.274 ± 0.081 cells/mm2) and LCE (0.244 ± 0.078 cells/mm2).

Fig. 7.

Density of cells expressing V1R3 (A) and the distribution of cells expressing V1R3 along the rostro-caudal axis of olfactory organ (B) in red-eared slider. The density of cells expressing V1R3 varies among individuals, whereas the density of V1R3 expressing cells does not show any significant difference along the rostro-caudal axis of olfactory organ (P>0.05). Each column and vertical bar represent the mean and standard error (n=4).

Fig. 8.

The relative abundance of cells expressing V1R3 in the upper and lower chamber epithelia of red-eared slider, showing variations among individuals.

Expression of the genes encoding TRPC2 and CNGA2

The expression of VR genes by a small number of ORNs described above implies the presence of unknown genes encoding VRs and their expression in the LCE which contains microvillous ORNs. Thus, we further investigated the expression of the gene encoding TRPC2 in the olfactory organ of red-eared slider. In situ hybridization analysis demonstrated the expression of TRPC2 mRNA by sparsely distributed cells both in the UCE and LCE (Fig. 9A–C). The density of cells expressing TRPC2 was significantly higher in the LCE than in the UCE (9.083 ± 0.813 cells/mm2 in the LCE and 2.394 ± 0.106 cells/mm2 in the UCE) (Fig. 9D). The density of cells expressing TRPC2 in each chamber was almost equal to that of the cells expressing VRs. For instance, the density of cells expressing TRPC2 was 2.387 cells/mm2 in the UCE and 8.661 cells/mm2 in the LCE, while those expressing VRs were 1.72 cells/mm2 in the UCE and 6.64 cells/mm2 in the LCE in animal #3 (Fig. 10A). Furthermore, the distribution of cells expressing TRPC2 along the apical-to-basal axis of the epithelium closely resembled that of the cells expressing VRs (Fig. 10B), i.e., cells expressing TRPC2 and those expressing VRs were not found in the most apical part of the epithelium, where the nuclei of supporting cells were situated. Conversely, they were present mainly in the middle to basal parts of the epithelium (bins 0.3–0.9), where the nuclei of ORNs were situated. As in the case of cells expressing VR genes, a significant difference was not found in the density of cells expressing TRPC2 along the rostro-caudal axis of olfactory organ. They were almost evenly distributed along the rostro-caudal axis of olfactory organ: 6.174 ± 0.966 cells/mm2 in the rostral, 6.081 ± 1.085 cells/mm2 in the intermediate and 6.317 ± 0.79 cells/mm2 in the caudal regions (Fig. 11).

Fig. 9.

In situ hybridization analysis for the gene encoding transient receptor potential cation channel subfamily C member 2 (TRPC2) in the olfactory organ of red-eared slider showing cells expressing TRPC2 both in the upper (A) and lower chamber epithelia (B). No signals were detected in the section hybridized with sense probe (C). Scale bars=50 µm in (A–C), 20 µm in insets. (D) Localization of cells expressing TRPC2 in the olfactory organ of red-eared slider. Each column and vertical bar represent the mean and standard error (n=4). Asterisk indicates a significant difference between the UCE and LCE (P<0.05).

Fig. 10.

Density of the cells expressing transient receptor potential cation channel subfamily C member 2 (TRPC2) and VRs (V1R3, V2R1 and V2R26) in the upper and lower chamber epithelia of red-eared slider (A) and the distribution of cells expressing TRPC2 and VRs along the apical-to-basal axis of epithelium (B). 0 is most apical and 1 is most basal.

Fig. 11.

Distribution of cells expressing transient receptor potential cation channel subfamily C member 2 (TRPC2) along the rostro-caudal axis of the olfactory organ of red-eared slider. A significant difference was not found in the density of cells expressing TRPC2 along the rostro-caudal axis of olfactory organ (P>0.05). Each column and vertical bar represent the mean and standard error (n=4).

Lastly, mRNA expression of the gene encoding CNGA2 was analyzed to proxy the type of olfactory receptors expressed by the majority of ORNs in the olfactory organ of red-eared slider. In situ hybridization analysis unveiled an extensive expression of CNGA2 both in the UCE and LCE (Fig. 12), in support of pervious reports suggesting the expression of ORs by the majority of ORNs in the olfactory organ of turtles [41, 42, 55].

Fig. 12.

Localization of cells expressing cyclic nucleotide gated channel alpha 2 (CNGA2) in the upper chamber epithelium (A) and lower chamber epithelium (B) of red-eared slider. Scale bars=50 µm in (A, B), 20 µm in insets.

DISCUSSION

The results in the present study demonstrated the expression of genes encoding VRs in the olfactory organ of turtles. The V2R genes were expressed mainly in the LCE, while a single V1R gene was expressed both in the UCE and LCE of red-eared slider, but not in that of soft-shelled turtle. Notably, VR genes were expressed by a small number of ORNs. In addition, the gene encoding TRPC2, an ion channel mediating the downstream signaling for VRs [12, 33, 59], was expressed by a small number of ORNs in a similar manner to that of VRs, suggesting that unknown VR genes are less likely to exist in turtles. Meanwhile, the gene encoding CNGA2, an ion channel involved in the signal-transduction of ORs [6, 12], was extensively expressed by the ORNs both in the UCE and LCE, suggesting the expression of OR genes by the majority of ORNs in the olfactory organ of turtles. Conceivably, the olfactory chemoreception of turtles might be mediated mainly by the ORs rather than the VRs.

An intimate relationship between the fine structure of ORNs and the gene expression of olfactory receptors, i.e., the expression of OR genes by ciliated ORNs and the expression of VR genes by microvillous ORNs, has been demonstrated in the olfactory organ of fish and mammals [14, 23]. However, the results in the present study indicated the expression of VR genes by a small population of ORNs in the LCE of turtle, despite the fact that the LCE contains microvillous ORNs [17, 41, 57]. In addition, the expression of OR genes by the majority of the ORNs in the LCE of turtle was suggested by the extensive expression of the gene encoding CNGA2. Thus, it is likely that the correlation between the fine structure of ORNs and the gene expression of olfactory receptors is not conserved among turtles and other vertebrates, and that the fine structure of ORNs will not always help us to predict the expression of genes encoding olfactory receptors.

The sparse expression of V1R gene in the olfactory organ of turtles demonstrated here is compatible with that of snakes, which is characterized by a punctate expression of V1R genes in the VNO [7]. This suggests that the expression of V1R genes by a small number of ORNs might be a common feature among reptiles. Meanwhile, comparative genomic analyses of vertebrates indicate an increase in the number of genes encoding V1Rs in terrestrial vertebrates, suggesting that the expansion in the number of genes encoding V1Rs is associated with the terrestrial adaptation [43, 48, 49]. However, such an expansion has not found in reptiles, and they retain a very small number of V1R genes [7, 47, 58], implying that reptiles and other vertebrates evolved different disciplinary for olfaction and that the V1R mediated-chemoreception is less important for reptiles.

Furthermore, the small number of V1R genes are accompanied by a large repertoire of V2R genes in snakes, which are expressed by the majority of ORNs in the VNO [7]. In contrast, there are only two genes encoding V2Rs in the genome of turtles [47, 58], and they are expressed by a small number of ORNs in the olfactory organ as shown here. These pieces of evidence suggest that olfactory chemoreception is much diversified among reptiles and each reptile evolved different strategies for the detection of olfactory chemical cues.

Several lines of evidence suggest that the V2Rs are involved in the detection of non-volatile substances in mammals [9, 18, 20, 28, 31]. Meanwhile, turtles have ability to detect odorants both on land and in water [16, 35, 39]. Moreover, the UCE and LCE of turtles are regarded as the air-nose and water-nose, respectively [46]. Thus, the V2Rs might be involved in the detection of non-volatile substances for turtles as well, since they were expressed mainly in the LCE as shown here.

Expression of a single V1R gene by the ORNs both in the UCE and LCE of red-eared slider, but not in that of soft-shelled turtle suggests the importance of V1R-mediated chemoreception in the olfactory organ of semi-aquatic turtles including red-eared slider, but not in that of highly-aquatic turtles including soft-shelled turtle. The involvement of V1Rs in the detection of volatile substances has been reported in the VNO of mice [5, 30, 32, 49]. Moreover, comparative genomic analysis among vertebrates indicates an increase in the number of genes encoding V1Rs in terrestrial animals over aquatic animals [43, 48, 49]. These pieces of evidence suggest that, although the ligand for V1Rs in turtles is not known at present, the V1R might be involved in the detection of volatile substances in the olfactory organ of semi-aquatic turtles, and that the V1R-mediated chemoreception might have been lost secondarily in highly-aquatic turtles.

The VR genes have been shown to be expressed in a sexually dimorphic manner in the VNO of several vertebrates [2, 24, 27]. In mice, the density of particular V2R genes is biased toward males and is hormone dependent [2]. In addition, the density of cells expressing some V2Rs is higher in female salamanders than in males [27]. In the present study, cells expressing V2R1 were not found in the olfactory organ of male red-eared sliders sampled in March, June and September. In addition, the expression of V2R1 was not detected by in situ hybridization in the olfactory organ of male soft-shelled turtle. Moreover, the density of cells expressing V1R3 varied among individuals. These pieces of evidence are in accordance with that of Murphey et al., (2001) indicating the expression of the components of vomeronasal signaling cascade, including TRPC2 and Gαi1-3, in a sexually dimorphic manner [40]. Collectively, these findings suggest the presence of both sex and seasonal differences for the expression of VR genes in the olfactory organ of turtles. Additional observations will be required to elucidate the sex and seasonal differences for the expression of VR genes in the olfactory organ of turtles in detail.

The expression site of V1Rs in the olfactory organ varies among vertebrates, e.g., the V1Rs of Xenopus laevis are expressed in the OE and MCE [10], whereas the V1Rs of mammals are principally expressed in the VNO [11, 56, 57]. Therefore, it has been speculated that the V1R genes have shifted their expression site from the OE to the VNO during the evolution from amphibians to mammals [10, 20]. Moreover, the results in the present study indicated the expression of a single V1R gene both in the OE (UCE) and VNO (LCE) of semi-aquatic turtles. These pieces of evidence suggest that the V1R genes begun their expression in the VNO of common ancestor of reptiles and mammals. In support of this, expression of some V1R genes in the VNO has been reported in snakes [7].

In the OE of mammals, ORNs bear cilia at the tip of their dendrites and each ORNs express only one OR gene [8, 38, 52]. Meanwhile, ORNs in the UCE of turtles bear both cilia and microvilli [17, 41, 55]. Expression of the genes encoding CNGA2 and TRPC2 demonstrated here suggests the expression of OR genes by the majority of ORNs and VR genes by a small number of ORNs in the UCE. Possibly, ORs might be expressed at the cilia and the VRs at the microvilli of distinct ORNs. Another possibility is that the ORs and VRs are expressed at the cilia and microvilli of a single ORN, respectively. Further analyses are required to ask if multiple receptors are expressed by a single ORN or not.

In the olfactory organ of mammals and amphibians, the ORNs expressing Gαolf express ORs and those expressing Gαo express V2Rs [10, 12, 19]. Therefore, by the extensive expression of both Gαolf and Gαo [41, 57], expression of both ORs and V2Rs has been suggested in the olfactory organ of turtles. However, the results in the present study demonstrated the expression of CNGA2 mRNA by the majority of ORNs and the expression of TRPC2 mRNA by a small number of ORNs, suggesting the expression of ORs by the majority of ORNs and VRs by a limited number of ORNs. This implies that the expression of Gαo is not necessarily associated with the expression of genes encoding V2Rs in turtles, i.e., it is not possible to infer the expression of V2R genes by the expression of Gαo. The involvement of Gαo in the synaptic function, such as cell-to-cell contact, has been suggested in the nervous system [26]. Thus, the Gαo may play a role in these neural activities in the olfactory organ of turtles rather than the olfactory chemoreception.

Although the fine structure of ORNs in the OE varies among tetrapods, the VNO inevitably contains microvillous ORNs [13]. Therefore, the presence of microvillous ORNs is generally accepted as a definitive characteristic of the VNO. In many turtles, the LCE contains microvillous ORNs and is regarded as the VNO [17, 41, 57]. However, present study suggested the expression of OR genes by the majority of ORNs in the LCE. Instead, limited number of ORNs in the LCE were demonstrated to express the genes encoding VRs, not only in the olfactory organ of soft-shelled turtle, where microvillous ORNs are not found [42], but also in the olfactory organ of red-eared slider. This is in marked contrast to the situation in the VNO of many tetrapods, which principally express VRs rather than ORs. Further studies are required to see if the expression of VR genes by a small population of ORNs in the LCE is a common feature among turtles.