Point prevalence of asymptomatic Plasmodium infection and the comparison of microscopy, rapid diagnostic test and nested PCR for the diagnosis of asymptomatic malaria among children under 5 years in Ghana.

BACKGROUND: Plasmodium infection among children is a serious public health problem. Asymptomatic malaria infection among humans serves as a significant reservoir for transmitting Plasmodium to uninfected Anopheles mosquitoes, fueling malaria endemicity and asymptomatic malaria may progress to clinical malaria. Therefore, prompt and accurate diagnosis of malaria infection is crucial for the management and control of malaria, especially in endemic areas. This study assessed the point prevalence of asymptomatic malaria infection and evaluated the performance of malaria Rapid Diagnostic Tests (RDT), light microscopy and nested PCR (nPCR) for the diagnosis of asymptomatic malaria infection in a paediatric population in the Atwima Nwabiagya North district, Ghana.
METHODS: This cross-sectional study enrolled 500 asymptomatic children aged ≤ 5 years. After consent was obtained from a parent, blood samples were collected from each participant to assess for Plasmodium infection based on histidine rich protein-2 (pfHRP-2)-based malaria RDT, light microscopy and nPCR.
RESULTS: The point prevalence of asymptomatic malaria by microscopy, RDT, and nPCR were 116/500 (23.2%), 156/500 (31.2%), and 184/500 (36.8%), respectively. Using nPCR as the reference, RDT presented with a perfect sensitivity (100.0%), specificity (100.0%), accuracy (100.0%), and reliability (100.0%) in detecting asymptomatic P. falciparum infection. Likewise, microscopy presented with an excellent specificity and high accuracy in detecting both P. falciparum (100.0%; 85.6%) and P. malariae (100.0%; 100.0%). However, the sensitivity (56.4%) and reliability (56.4%) of microscopy was low for both P. falciparum.
CONCLUSION: The findings of this study indicate a high point prevalence of asymptomatic Plasmodium infection among children in Atwima Nwabiagya North district, Ghana. In the absence of the more sensitive PCR, pfHRP-2-based malaria RDT provides substantial diagnostic sensitivity, specificity, accuracy and reliability and is superior to microscopy.

Introduction

Malaria is a pervasive parasitic disease in the tropical and subtropical regions which is mostly prevalent in sub-Saharan Africa, Asia, and Latin America [1]. Currently, the World Health Organization (WHO) estimates 219 million cases and 435,000 malaria-related deaths globally [2]. In the WHO African Region, malaria causes significant morbidity and mortality with annual infection and mortality rates of 213 million and 380,000 individuals, respectively, and it claims the life of a child under five years every two minutes [3, 4]. Despite successes in global malaria control in previous years, recent data indicate insufficient progress. In Ghana, malaria remains a major cause of loss of days of healthy life, accounting for not less than 20% of child deaths, 40% of child hospital admissions, and more than 50% of outpatient attendances [5-8]. The enormous toll on life and both national and household economics [9] underscores the need for ongoing malaria diagnosis, treatment, and disease surveillance.

Clinically, the diagnosis of malaria is often based on signs and symptoms alone. However, due to overlapping symptoms between malaria and other infectious conditions, a malaria diagnosis based solely on signs and symptoms may be inaccurate leading to improper use of anti-malarial medication or the delay in proper diagnosis and treatment of an alternative condition [10]. As a result, the WHO recommends the use of microscopy or rapid diagnostic tests (RDT) as confirmatory diagnostic tools for malaria prior to initiation of treatment in suspected malaria cases, which also minimizes the likelihood of the development of drug resistant strains [11].

In many developing countries, microscopic examination of Giemsa-stained blood smears is considered the “gold standard” for malaria diagnosis and a mandatory test prior to antimalarial therapy. Though it is cost-effective, malaria microscopy is limited by several factors including quality control, limited availability of microscopes, time consuming for optimal film preparation, examination, and interpretation, diagnostic biases as a result of its dependence on operator’s experience and low diagnostic sensitivity [12-14]. Furthermore, bacteria, fungi, dirt, cell debris, and poor blood film preparation result in formation of artifacts and are associated with false positive results [15].

In an effort to improve diagnostic sensitivity and turnaround time and abate diagnostic errors related to microscopy, RDTs were developed. Currently, the most widely utilized RDTs exploit the presence of Plasmodium falciparum Histidine-Rich Protein-2 (pfHRP-2), parasite-specific Lactate Dehydrogenase (pLDH) or Plasmodium aldolase to detect parasitemia [16, 17]. The performance of RDT is influenced by manufacturing and environmental conditions in addition to its inability to quantify parasitemia and to accurately identify species other than P. falciparum [18-20]. Additionally, false negatives due to pfHRP-2 gene deletions and non-reliability for non-Plasmodium falciparum infections have been reported [21-23]. Moreover, persistence of pfHRP-2 antigens in circulation even after parasite clearance may result in false positive results; limiting RDT specificity [24].

Taken together, both RDT and microscopy are limited by low detection threshold, especially in low parasitaemic cases [20, 25]. As such, Polymerase Chain Reaction (PCR) based assays have been developed to remedy some of the limitations. PCR is very sensitive, particularly in cases of low density or mixed infection and it is valuable for accurate collection of malaria epidemiological data [26, 27]. However, the expensive, technical and time-consuming nature of PCR limits its utilization in routine practice, especially in remote or resource-limited settings.

Asymptomatic carriers of malaria parasites have recently received considerable attention as global strides towards malaria eradication are underway. Some reports indicate that asymptomatic malaria infection may serve as a significant reservoir, transmitting Plasmodium to uninfected Anopheles mosquitoes which fuels malaria endemicity [28, 29]. There is also the possibility that asymptomatic malaria will transition into clinical malaria. Thus, accurate diagnosis of asymptomatic malaria as a potential reservoir of infection, especially in children, is crucial. Although a number of studies on asymptomatic malaria in older children have been conducted across Ghana [30-32] and children under 5 in neighboring African countries [33-35], there remains a dearth of published data on asymptomatic malaria in children under 5 years in Ghana, particular in the northern sectors of the country where adequate health facilities are wanting. This study assessed the point prevalence of asymptomatic malaria infection and evaluated the performance of malaria RDT, light microscopy and nested PCR (nPCR) for the diagnosis of asymptomatic malaria infection in children under 5 years old in Atwima Nwabiagya North district, Ghana.

Materials and methods

Study design/area and participants

The study was conducted in July, 2015 in peri-urban and rural communities of the Atwima Nwabiagya North district in the Ashanti region of Ghana. The district lies approximately on latitude 6° 32’N and 6° 75’N and between longitude 1° 45’ W and 2° 00’ W. It is located in the western part of the region and shares common boundaries with Offinso Municipal (to the North), Ahafo Ano South and Atwima Mponua Districts (to the West), Amansie-West and Atwima Kwanwoma Districts (to the South), Kumasi Metropolis and Afigya Kwabre Districts (to the East). It covers an estimated area of 294.84 square kilometers and has an estimated population of 149,025 according to the 2010 Population and Housing Census [36].

The minimum sample size of 196 was calculated at 95% confidence level, 7% margin of error, and a response distribution of 50% using the Raosoft sample size calculator [37]. However, in an effort to enhance the statistical power of the study, a total of 500 asymptomatic children of age ≤ 5 years old were recruited to the study. Inclusion criteria were: lack of fever in the last 3 days, no history of anti-malarial treatment in the last 14 days, an axillary temperature less than 37.5°C, and no known acute/chronic or disease. Ethical approval for this study was obtained from the committee on Human Research, Publications and Ethics (CHRPE) of the School of Medical Sciences of the Kwame Nkrumah University of Science and Technology (CHRPE/AP/257/15). Written informed consent was obtained from parents/ guardians of all participating children after the aims and objectives of the study had been explained to them. Participation was voluntary, and respondents were assured that the information obtained was strictly for research and academic purposes only and were guaranteed the liberty to opt out from the study at their own convenience.

Data and sample collection

Parents/guardians of participating children were interviewed to obtain participants’ information on gender, age, history of malaria/fever and treatments, and presence of acute and/or chronic disease. Fingerprick blood samples were obtained from children who satisfied the inclusion criteria. About 8 μl of the blood was used for haemoglobin measurement using HemoPoint H2 Hemoglobin analyzer (Accuracy of 14.0 g/dl ± 0.3 g/dl; Linearity of 0–20 g/dl ± 0.3 g/dl; total precision CV <1.5%) (EKF Diagnostics, Stanbio Laboratory, USA). Anaemia was defined as haemoglobin level <11 g/dl, and graded as mild (10–10.9 g/dl), moderate (7–9.9 g/dl), and severe (<7 g/dl) [38]. Approximately 5 μl of blood was used for malaria diagnosis by RDT. Giemsa-stained thick and thin blood films were also prepared. Additionally, about 3–5 drops of the blood were spotted onto Whatman 903™ Filter Paper (Schleicher and Schuell BioScience, Inc., Keene, New Hampshire), air dried and individually kept in sealed plastic bag for subsequent nPCR analysis. All samples were tested for malaria by RDT, microscopy, and nested PCR. PCR was considered the gold standard.

Malaria diagnosis by RDT

Malaria RDT diagnosis was based on the detection of Histidine rich protein 2 (HRP-2) produced by P. falciparum only (paraHIT f, Span Diagnostics Limited, Surat, India). Testing and reporting was done according to the manufacturer’s instructions. Briefly, approximately 5 μl of the blood sample was transferred to the sample window using a micropipette, followed by 4 drops of the Reaction buffer into the buffer window. A sample was considered positive for P. falciparum malaria if the test line and control line appeared within the result window. The presence of the control line only, was considered a negative result. Results were declared invalid if the control line failed to appear within the result window, warranting re-testing. The test was done in duplicates. A third RDT was performed in the case of non-concordant result. Patients who tested positive were referred to the closest community health care facility for further diagnosis and treatment in accordance with the Ghana Health Service guidelines.

Malaria diagnosis by microscopy

Thick and thin blood smears were prepared (in duplicate) on clean, grease-free glass microscope slides immediately after sample collection. The films were allowed to air-dry and thin films were fixed with methanol. Both thick and fixed thin films were stained with 5% Giemsa solution for 30 minutes prior to microscopic examination. Examination and reporting of both thick and thin films were performed independently by two trained microscopists. The thin film was used to identify the specific species of Plasmodium. A film was considered positive by microscopy when both microscopists recorded a positive result for the same species. A film was considered negative only after observing at least 200 high-power fields (HPF) without finding parasites on a thick film. In the case of non-concordant result, a third examination was performed by a different microscopist. All microscopists were blinded to the results of RDT. Parasites were counted per 200 white blood cells (WBCs) per HPF from the thick film. The parasite density was calculated by assuming a WBC count of 8000/μl and 4.5 million RBC/μl in accordance with the WHO standard [39].

DNA extraction and molecular analysis

DNA isolation from Whatman filter papers was based on the Chelex-based technique as previously described [40]. Nested polymerase chain reaction was used for the determination of Plasmodium species, as previously described [41]. Briefly, Plasmodium genus was detected based on amplification of the outer genus-specific primers (rPLU1 and rPLU5). The reaction mixture for the initial outer reaction contained 4 mM of MgCl2, 200 μM DNTPs, 0.0625 μM of each primer and one unit of Taq DNA polymerase (Sigma-Aldrich, USA). For the primary reaction (Nested 1), the PCR cycling conditions consisted of an initial denaturation at 94°C for 4 min, denaturation at 94°C for 30 secs, annealing at 60°C for 1 min, extension at 72°C for 1 min (for 5 cycles), followed by denaturation at 94°C for 30 secs, annealing at 55°C for 1 min, extension at 72°C for 1 min, and final extension at 72°C for 4 min (for 45 cycles). Subsequently, a secondary amplification reaction (Nested 2) using the genus-specific (rPLU3 and rPLU4) and species-specific primer pairs (rFAL1 and rFAL2, rMAL1 and rMAL2, rOVA1 and rOVA2) was performed with 1 μL of the product of the first amplification reaction as a template DNA as previously described [27, 42–44] (). All PCR reactions were performed using a GeneAmp PCR System 2700 (Applied Biosystems Incorporated, USA). The amplified products were separated by electrophoresis on 2% agarose gels, stained with 0.5 μg/mL ethidium bromide and visualized under UV light. ().

Agarose gel electrophoresis showing nPCR products under UV light.

The top panel shows representative results of the P. falciparum-specific nested PCR. Lanes 1, 4, 5, 6, 8, 12, 14, and 15 contain the positive 205 bp PCR products expected. The bottom panel shows representative results of the P. malariae-specific nested PCR. Lane 12 contains the positive 144 bp PCR product expected. Smaller bands are likely due to low DNA concentration in those samples. L represents the molecular ladder.

Statistical analysis

Data processing was done using Microsoft Excel 2016. Statistical analysis and graphical presentation was performed using the R Language for Statistical Computing version 3.5.2 (R Core Team, Vienna, Austria) [45]. Categorical data were presented as frequency (percentages). Continuous data were presented as mean ± standard deviation (SD). Univariate logistic regression analysis was used to assess the association between sociodemographic characteristics and malaria infection for each test methods used in this study. The receiver operating characteristics (ROC) curve analysis was used to assess the diagnostic performance of malaria RDT and microscopy using PCR as the reference. Reliability was expressed as the J index [(TP×TN)—(FP×FN)]/ [(TP+FN) (TN+FP)]. All tests were two-sided and a 𝑝-value < 0.05 was considered statistically significant.

Results

A total of 500 children with mean age and haemoglobin level of 2.21 years and 10.26 g/dl, respectively, were included in this study. A higher proportion of the participants were male (51.2%), between 1–2 years of age (47.2%), and resided in the community of Barekuma (28.4%). A total of 189 (75.6%) were anaemic and the point prevalence of mild, moderate, and severe anaemia was 55.2%, 16.8%, and 3.6%, respectively. Only P. falciparum [parasite density = 1,1540 (2,000–34,000) parasites/μL] and P. malariae [parasite density = 2,100 (1,270–3,720) parasites/μL] were identified in this study. There were no mixed infections ().

The overall point prevalence of asymptomatic malaria by microscopy, RDT and nPCR were 116/500 (23.2%), 156/500 (31.2%), and 184/500 (36.8%), respectively ().

The point prevalence of asymptomatic malaria was 98 (19.6%) for males and 86 (17.2%) for females based on nPCR. Using microscopy and RDT, the point prevalence among males was 66 (13.2%) vs 86 (17.2%), respectively, and 50 (10.0%) vs 70 (14.0%) among females, respectively. Upon stratification by age, the point prevalence of asymptomatic malaria was highest in children between 1–2 years of age based on nPCR (16.4%), microscopy (11.2%), and RDT (15.6%), respectively. A similar observation was made after age groups were stratified by gender. Children residing in the community of Worapong (13.2%) presented with the highest point prevalence of asymptomatic malaria, followed by Abira (8.0%), Barekuma and Adankwame (4.4%), and Barekese (4.0%), with the lowest being Esaaso (2.8%). Children in Abira [OR = 4.55, 95% CI (1.90–10.90), p<0.01], Barekese [OR = 4.55, 95% CI (1.58–13.08), p<0.01], and Worapong [OR = 36.0, 95% CI (11.52–112.48), p<0.0001] had significantly higher odds of asymptomatic malaria compared to Barekuma. A similar observation was made when using microscopy and RDT. In addition, children experiencing any anaemia had an increased odds of asymptomatic malaria ().

Nested PCR detected 156 P. falciparum cases, of which microscopy identified 88 cases and did not identify 68 cases. RDT detected all 156 cases of P. falciparum. All 28 cases of P. malariae identified by nPCR were also detected by microscopy. RDT did not detect any P. malariae cases ().

RDT presented with a perfect sensitivity (100.0%) specificity (100.0%), accuracy (100.0%), and reliability (100.0%) in detecting P. falciparum infection. Microscopy presented with a similar performance with respect to P. malariae infection. However, the sensitivity (56.4%), accuracy (85.6%) and reliability (56.4%) of microscopy was attenuated for detecting P. falciparum ().

Discussion

Based on nested PCR, this study reports a high point prevalence (36.8%) of asymptomatic Plasmodium infection among a paediatric population in the Atwima Nwabiagya North district of Ghana. Asymptomatic malaria in children under 5 years has been reported in some African countries [33-35]. In Ghana, Crookston, et al. [46] reported an asymptomatic malaria prevalence of 31.8% based on PCR among children less than five years of age in Kumasi, Ghana which is similar to our study finding. Other studies in Ghana such as those by Dinko, et al. [31] in Kumasi and Danquah, et al. [47] in northern Ghana reported asymptomatic malaria among older children. The prevalence found in the studies by Dinko et al. (76.6%) and Danquah et al. (89.7%) are higher compared to this study and the discrepancy may be linked to the fact that older children tend to be the major asymptomatic carriers of Plasmodium compared to younger children [47, 48], possibly as a result of protective immunity acquired over the years.

We also found asymptomatic malaria to be more prevalent among male children compared to females, similar to the findings of Golassa et al. in Ethiopia [29]. The higher point prevalence of asymptomatic malaria among male children compared to females could be explained by the fact that, in Ghana, males are more exposed to both daytime and nighttime outdoor activities than females and thus, at higher risk of mosquito bites compared to females who are usually indoors. Our findings also indicate a strong association between presence of asymptomatic malaria and anaemia as consistent with studies by Crookston et al. [46], Verhoef et al. [49], and Stoltzfus et al. [50]. This study also presents information on the point prevalence of asymptomatic malaria in six different communities, providing data on potential hotspots for malaria screening and treatment. Children residing in Worapong presented with the highest point prevalence of asymptomatic malaria, followed by children in Abira. The higher point prevalence in Worapong compared to the other communities could be due to the relative accessibility of the communities or the agricultural practices of the specific communities. Barekese and Adankwame are economically diverse communities and on a main through-road, whereas Worapong is very difficult to get access due to poor roads and flooded rice field farming provides habitat for malaria transmitting mosquitoes. Nonetheless, owing to the fact that malaria-related morbidity and mortality is high among children and the propensity of asymptomatic malaria transitioning into clinical malaria, the children in these communities should be given substantial precedence during national and regional malaria surveillance exercises.

Due to the high point prevalence of asymptomatic malaria in Ghana [31, 32, 48], and the possibility that people with asymptomatic malaria infection may serve as a significant reservoir, transmitting Plasmodium to uninfected Anopheles mosquitoes [28, 29], prompt and accurate diagnosis of asymptomatic Plasmodium infection is crucial. In this study, despite the high specificity, microscopy presented with poor sensitivity and reliability for the detection of asymptomatic P. falciparum compared to nPCR as consistent with previous reports [14, 19, 27, 29, 44]. Taken together, these findings indicate that a negative result by microscopy does not exclude the presence of malaria infection since a substantial number of false negatives were associated with microscopy for P. falciparum. Microscopy thus seems to have an inherent limitation for asymptomatic P. falciparum detection, with proficiency of technicians and microscopists likely to be a significant contributor. This underscores the need for continued refinement through constant re-training to sharpen microscopists’ ability to detect malaria cases especially at low parasite densities, since refresher training has been reported to significantly improve the diagnostic accuracy of parasitological diagnosis of malaria by microscopy [51]. Meanwhile, the high specificity and positive predictive value of microscopy in detecting malaria parasites, regardless of the species, suggest that positive malaria microscopy is a good confirmation of malaria, regardless of the presence of symptoms. Thus, a positive result from microscopy could be trusted as the presence of the Plasmodium infection and anti-parasitic therapy should be guided by the species identified.

Strikingly, despite the possibility of false negatives due to pfHRP-2 gene deletions [21-23] and the persistence of pfHRP-2 antigens in circulation even after parasite clearance, which may increase the incidence of false positive results [24], malaria diagnosis by RDT provided a better estimate of asymptomatic P. falciparum infection, with a perfect sensitivity, specificity, accuracy and reliability compared to microscopy when nPCR is used as the reference. Indeed, RDT was able to correctly classify all P. falciparum cases detected by nPCR. This may be due to the fact that the RDT used in this study detects pfHRP-2 antigen and not malaria parasites, affording it an added advantage over microscopy through the detection of antigens produced in very low parasite densities below the detection threshold of microscopy. This finding strongly suggests that detection of pfHRP-2 by RDT accurately identifies P. falciparum infection in asymptomatic children and is an indication for anti-malarial therapy. However, it is worthy of note that there is the possibility that the pfHRP-2 antigen may be persistent in the blood, even in the absence of viable parasites. Our study excluded children who had received anti-malaria therapy in the prior 14 days. It is possible that if the study had included children who have had such therapy within the prior 14 days, we would have identified children who had persistent pfHRP-2 antigenemia but who were no longer parasitemic. Thus, interpretation should be done with caution. Additionally, it should be noted that the widely used RDT for malaria diagnosis in Ghana is pfHRP-2-based RDT which detects on P. falciparum but not P. malariae. The choice of this RDT is attributed to the relatively higher point prevalence of P. falciparum and its associated clinical significance in Ghana compared to the P. malariae which causes less severe clinical outcomes [52]. In other words, a negative pfHRP-2-based RDT does not exclude infection with non-falciparum malaria species.

Although the finding of this study and several other reports point to the fact that RDT should be used as a surrogate to microscopy due to the low sensitivity of microscopy, it is worthy of note that, microscopy allows for the quantification and calculation of malaria parasite densities, a function which RDT cannot be used to assess. Thus, microscopy should not be abandoned. We, however, recommend consistent re-training of malaria microscopists in the region to enhance their Plasmodium detection skills and abilities. Moreover, despite the high sensitivity and specificity, PCR is still expensive which limits its usefulness in routine malaria diagnosis.

Study strengths and limitations

The strength of the study is in the reporting of the point prevalence of asymptomatic malaria infection among children less than 5 years old in the northern sector of Ghana. We also highlight potential hotspots for malaria screening and treatment during national and regional malaria surveillance exercises. The study also corroborates previous reports on the usefulness of molecular detection methods for asymptomatic malaria diagnosis. We showed that, in the absence of PCR, RDT performs better in the diagnosis of asymptomatic malaria caused by P. falciparum among children compared to microscopy.

This study is however limited the fact that we used only a single brand of malaria RDT; the prevalence may not be the same when other commercially available test kits are used. Also, data on the use of long-lasting insecticidal nets was unavailable. Additionally, the study was conducted in a peri-urban setting and the findings may not be generalizable to other areas. Thus, we recommend that further studies be conducted in the larger population.

Conclusions

The findings of this study indicate a high point prevalence of Plasmodium infection and anemia among asymptomatic children in Atwima Nwabiagya North district of Ghana. Since Ghana remains in the control stage, there is the exigent need for effort intensification through detection of asymptomatic malaria, using highly sensitive diagnostic tools, in order to reach the pre-eradication stage of malaria. The use of microscopy for Plasmodium detection in children who are asymptomatic presents several challenges. However, in the absence of the more sensitive PCR, the use RDT provides substantial diagnostic sensitivity and reliability.

Author information TDickerson malaria RDT Ghana.

(DOCX)

Click here for additional data file.

18 Feb 2020

PONE-D-20-02713

Asymptomatic Plasmodium infection in a paediatric population in Ghana: prevalence and comparison of microscopy, rapid diagnostic tests and nested PCR

PLOS ONE

Dear  Dr. DICKERSON,

Thank you for submitting your manuscript for review to PLoS ONE. After careful consideration, we feel that your manuscript will likely be suitable for publication if the authors revise it to address specific point raised by the reviewers. According to reviewers, there are still some areas where further improvements would be of substantial benefit to the readers, including study design and results.  A major concern raised by the reviewer #1 was about the PCR protocol used as reference, as it cannot identify P.vivax infections (potential bias). Consequently, the tittle of the manuscript should be properly adjusted as suggested by reviewer #2.  Finally, the manuscript should benefit from a proofreading.

We would appreciate receiving your revised manuscript by March 30. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Luzia Helena Carvalho, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

1. Thank you for including your funding statement;"The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."

Please provide an amended Funding Statement that declares *all* the funding or sources of support received during this specific study (whether external or internal to your organization) as detailed online in our guide for authors at http://journals.plos.org/plosone/s/submit-now.

Please state what role the funders took in the study.  If any authors received a salary from any of your funders, please state which authors and which funder. If the funders had no role, please state: "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

2.

PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

3. Please amend the manuscript submission data (via Edit Submission) to include author Eddie-Williams Owiredu

4. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The submission by Dickerson and colleagues describes a comparison between light microscopy, rapid diagnostic tests and nPCR (as reference) to assess malaria asymptomatic infection in children less than 5 years. The methodology globally sounds good and is clearly reproductible. Their results are in line with relative literature.

The paper is clearly written and the discussion is thoughtful as they point out limits of their work.

This paper should, as the authors emphasize, galvanize far more intensive surveillance for these asymptomatic bearers.

My minor comments are detailed below.

Line 65: there is no reference between brackets

Lines 120 -121: Have you collected any information about LLIN use?

Lines 160-161: the sentence ‘Only P. 161 falciparum and P. malariae were identified in this study. There were no mixed infections by nPCR’ should be moved to Results section.

One question: The PCR you used cannot diagnose P. vivax. As you consider this PCR as the reference, I think that there is a little bias. Could you explain this choice ?

Reviewer #2: General comments;

This manuscript addresses an important area which is highly relevant to malaria control in areas which are transitioning from holo/hyper-endemic to hypo-endemic transmission of malaria. However, the manuscript needs minor revision to better present the key questions addressed, the findings, and clearly show the novelty.

1. Title: Well written but it can be rephrased to give a clear message. The authors were assessing the prevalence of asymptomatic P. falciparum infection in paediatric population in Ghana, but also compared the diagnostic tools, so they should rephrase these two sentences in order to capture reader's attention just from the title.

2. Background: The concept of malaria prevalence in endemic areas and in the country where the study was conducted needs to be thoroughly explained. The authors should clearly indicate the relevance of conducting this study. A number of this kind of studies have been conducted in Ghana, I suggest that, the authors should clearly show that the study was conducted in (Atwima Nwabiagya) Northern district in Ghana, not just Ghana in general.

3. Results: The authors need to check their results the way they have reported them. What I know and from several reports, asymptomatic malaria occurs in children above 5 years of age and not less than 5 because of immunity. But their results indicate children of 1-2 years appear to be asymptomatic compared to other age groups. They need to justify this.

- Figures are also missing in the document that I review.

- Parasite density is also important to be shown

- There should be parasite density of the results obtained by microscopy. This will add value and will be a relevant information as well.

4. Discussion: this section is poorly written. There are some facts that need to be considered in order to reflect the rationale of the study and the findings. Authors should handle all issues raised and re-write this section accordingly.

5. Study strength and limitations: This section is missing. They should have clearly pointed this out.

6. Other minor comments

The authors should check the language throughout the manuscript and correct typos. I have done my comments in the manuscript in track changes.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Dr. Deborah Sumari

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

Submitted filename: Manuscript TDickerson Malaria RDT Ghana-Reviewed DS.docx

Click here for additional data file.

14 Apr 2020

The Editor,

PLOS ONE

Dear Sir/ Madam,

RESPONSE TO REVIEWERS

The authors appreciate the timely and scrupulous review of our manuscript (PONE-D-20-02713). The authors note seventeen (17) comments in total. Kindly find below the responses to the reviewers’ comments. Tracked changes have been employed to highlight manuscript texts revised per the reviewers’ recommendations. Revised text indicated in this response are in “quotation marks”.

Reviewer #1:

Line 65: there is no reference between brackets

Response 4: Reference #4 has been added to the appropriate text

Lines 120 -121: Have you collected any information about LLIN use?

Response: Thank you for your comment. Because objective of the study is to determine the prevalence of asymptomatic malaria infection and evaluate the performance of RDT, microscopy and PCR for malaria diagnosis, we did not collect other data such as use of LLIN. However, we have included it as a limitation of the study (lines 279-282).

“This study is however limited the fact that we used only a single brand of malaria RDT; the prevalence may not be the same when other commercially available test kits are used. Also, data on the use of long-lasting insecticidal nets was unavailable. Additionally, the study was conducted in a peri-urban setting and the findings may not be generalizable to other areas. Thus, we recommend that further studies be conducted in the larger population.”

Lines 160-161: the sentence ‘Only P. 161 falciparum and P. malariae were identified in this study. There were no mixed infections by nPCR’ should be moved to Results section.

Response: Thank you for your comment. The statement has been moved to the results section (lines 178-179)

“Only P. falciparum [parasite density= 1,1540 (2,000- 34,000) parasites/µL] and P. malariae [parasite density= 2,100 (1,270- 3,720) parasites/µL] were identified in this study. There were no mixed infections”

One question: The PCR you used cannot diagnose P. vivax. As you consider this PCR as the reference, I think that there is a little bias. Could you explain this choice?

Response: Thank you for your comment. The PCR primers were selected based on the occurrence/prevalence of the different species of Plasmodium in Ghana. It is known that there are currently five major clinically relevant Plasmodium species, namely, P. falciparum, P. ovale, P. malariae, P. vivax and P. knowlesi. However, only P. falciparum, P. ovale, P. malariae have been documented to occur in Ghana (https://www.who.int/malaria/publications/country-profiles/profile_gha_en.pdf?ua=1/ and https://www.severemalaria.org/countries/ghana and http://www.ghanahealthservice.org/downloads/GHS_Antimalaria_drug_policy.pdf ). We did not include P. vivax because reports of its infection in the Ghana is rare.

Reviewer #2:

1. Title: Well written but it can be rephrased to give a clear message. The authors were assessing the prevalence of asymptomatic P. falciparum infection in paediatric population in Ghana, but also compared the diagnostic tools, so they should rephrase these two sentences in order to capture reader's attention just from the title.

Response: Thank you for your comment. We have rephrased the title to clearly highlight the prevalence and comparison of test methods (lines 1-3).

“Prevalence of asymptomatic Plasmodium infection and the comparison of microscopy, rapid diagnostic test and nested PCR for the diagnosis of asymptomatic malaria among children under 5 years in Ghana”

2. Background: The concept of malaria prevalence in endemic areas and in the country where the study was conducted needs to be thoroughly explained. The authors should clearly indicate the relevance of conducting this study. A number of this kind of studies have been conducted in Ghana, I suggest that, the authors should clearly show that the study was conducted in (Atwima Nwabiagya) Northern district in Ghana, not just Ghana in general.

Response: Thank you for your comment. The relevance of the study has been clarified and (Atwima Nwabiagya) Northern district as the study site has been highlighted (lines 96-101)

“Although a number of studies on asymptomatic malaria in older children have been conducted across Ghana [30-32] and children under 5 in neighboring African countries [33-35], there remains a dearth of published data on asymptomatic malaria in children under 5 years in Ghana, particular in the northern sectors of the country where adequate health facilities are wanting. This study assessed the prevalence of asymptomatic malaria infection and evaluated the performance of malaria RDT, light microscopy and nested PCR (nPCR) for the diagnosis of asymptomatic malaria infection in children under 5 years old in Atwima Nwabiagya North district, Ghana.

3. Results: The authors need to check their results the way they have reported them. What I know and from several reports, asymptomatic malaria occurs in children above 5 years of age and not less than 5 because of immunity. But their results indicate children of 1-2 years appear to be asymptomatic compared to other age groups. They need to justify this.

- Figures are also missing in the document that I review.

- Parasite density is also important to be shown

- There should be parasite density of the results obtained by microscopy. This will add value and will be a relevant information as well.

Response: Thank you very much for your comment. The data has been rechecked and the results remained the same. In this study, simple random sampling procedure was used to recruit asymptomatic children. The higher prevalence of asymptomatic malaria among 1-2 years old children could be due to the greater number/size of 1-2 year aged children obtained in this study. This could also highlight the distribution of asymptomatic malaria cases in children under 5 in the region. The figures were included during the submission. Parasite densities have been included (table 1 and lines 178-179).

“Only P. falciparum [parasite density= 1,1540 (2,000- 34,000) parasites/µL] and P. malariae [parasite density= 2,100 (1,270- 3,720) parasites/µL] were identified in this study. There were no mixed infections”

4. Discussion: this section is poorly written. There are some facts that need to be considered in order to reflect the rationale of the study and the findings. Authors should handle all issues raised and re-write this section accordingly.

Response: Thank you for your comment. The discussion section has been revised, taking into consideration all comments attached (line 216-227)

“Based on PCR, this study reports a high prevalence (36.8%) of asymptomatic Plasmodium infection among a paediatric population in the Atwima Nwabiagya North district of Ghana. Asymptomatic malaria in children under 5 years has been reported in some African countries [33-35]. In Ghana, Crookston, et al. [46] reported an asymptomatic malaria prevalence of 31.8% based on PCR among children less than five years of age in Kumasi, Ghana which is similar to our study finding. Other studies in Ghana such as those by Dinko et al. [31] in Kumasi and Danquah et al. [47] in northern Ghana reported asymptomatic malaria among older children. The prevalence found in the studies by Dinko et al. (76.6%) and Danquah et al. (89.7%) are higher compared to this study and the discrepancy may be linked to the fact that older children tend to be the major asymptomatic carriers of Plasmodium compared to younger children [47, 48], possibly as a result of protective immunity acquired over the years.

We also found asymptomatic malaria to be more prevalent among male children compared to females, similar to the findings of Golassa et al. in Ethiopia [29]. The higher prevalence of asymptomatic malaria among male children compared to females could be explained by the fact that, in Ghana, males are more exposed to both daytime and nighttime outdoor activities than females and thus, at higher risk of mosquito bites compared to females who are usually indoors …”

5. Study strength and limitations: This section is missing. They should have clearly pointed this out.

Response: Thank you for your comment. We have included a section for study strength and limitations (line 273-282)

“Study strengths and limitations

The strength of the study is in the reporting of the prevalence of asymptomatic malaria infection among children less than 5 years old in the northern sector of Ghana. We also highlight potential hotspots for malaria screening and treatment during national and regional malaria surveillance exercises. The study also corroborates previous reports on the usefulness of molecular detection methods for asymptomatic malaria diagnosis. We showed that, in the absence of PCR, RDT performs better in the diagnosis of asymptomatic malaria among children compared to microscopy.

This study is however limited the fact that we used only a single brand of malaria RDT; the prevalence may not be the same when other commercially available test kits are used. Also, data on the use of long-lasting insecticidal nets was unavailable. Additionally, the study was conducted in a peri-urban setting and the findings may not be generalizable to other areas. Thus, we recommend that further studies be conducted in the larger population.”

6. Other minor comments

The authors should check the language throughout the manuscript and correct typos. I have done my comments in the manuscript in track changes.

Response: Thank you very much for your comment. The language and typos have been reviewed and revised and all comments included as tracked changes have been addressed.

Miscellaneous Author Responses:

• The 2010 Population and Housing Census of Ghana is the latest published data. A newer census is scheduled to take place in 2020.

• The authors initially chose to use the term point prevalence for malaria as our study reports the prevalence of malaria cases among individual asymptomatic children at a single point in time. Whereas point prevalence addresses the question of whether a person currently has malaria, period prevalence addresses the question of whether that subject had malaria at any time during the period under investigation. Since the study did not test individual children for malaria at multiple times over a defined period of time, we are unable to report the period prevalence for asymptomatic malaria infection.

Thank you once again for the timely review and scrupulous of our manuscript. Looking forward to hear favorably from you.

Sincerely,

Ty Dickerson

Corresponding author

Submitted filename: Response to Reviewers 28March2020.docx

Click here for additional data file.

24 Apr 2020

Point prevalence of asymptomatic Plasmodium infection and the comparison of microscopy, rapid diagnostic test and nested PCR for the diagnosis of asymptomatic malaria among children under 5 years in Ghana

PONE-D-20-02713R1

Dear Dr.  DICKERSON,

We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.

Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.

Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

With kind regards,

Luzia Helena Carvalho, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: We are thankful to the authors and approve this updated version of the manuscript. The authors replied to all of our comments.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Dieudonné M. Mvumbi

8 Jul 2020

PONE-D-20-02713R1

Point prevalence of asymptomatic Plasmodium infection and the comparison of microscopy, rapid diagnostic test and nested PCR for the diagnosis of asymptomatic malaria among children under 5 years in Ghana

Dear Dr. DICKERSON:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Luzia Helena Carvalho

Academic Editor

PLOS ONE

Table 1

Nested PCR protocol and Plasmodium ssrRNA genes used in this study.

Target species	Primer	Sequence (5'-3')	Reaction
Plasmodium genus-specific	rPLU1	TCAAAGATTAAGCCATGCAAGTGA	Nested 1
	rPLU5	CCTGTTGTTGCCTTAAACTTC
	rPLU3	TTTTTATAAGGATAACTACGGAAAAGCTGT	Nested 2
	rPLU4	TACCCGTCATAGCCATGTTAGGCCAATACC
Plasmodium species-specific
Plasmodium falciparum	rFAL1	TTAAACTGGTTTGGGAAAACCAAATATATT	Nested 2
	rFAL2	ACACAATGAACTCAATCATGACTACCCGTC
Plasmodium malariae	rMAL1	ATAACATAGTTGTACGTTAAGAATAACCGC	Nested 2
	rMAL2	AAAATTCCCATGCATAAAAAATTATACAAA
Plasmodium ovale	rOVA1	ATCTCTTTTGCTATTTTTTAGTATTGGAGA	Nested 2
	rOVA2	GGAAAAGGACACATTAATTGTATCCTAGTG

Table 2

Baseline characteristics of the study population.

Variables	Frequency (n = 500)	Percentage (%)
Age (years)	2.21 ± 1.28*
≤1	62	12.4
>1–2	236	47.2
>2–3	54	14.8
>3–4	76	15.2
>4–5	52	10.4
Sex
Male	256	51.2
Female	244	48.8
Residence
Abira	88	17.6
Adankwame	94	18.8
Barekese	44	8.8
Barekuma	142	28.4
Esaaso	56	11.2
Worapong	76	15.2
Anaemia	368	75.6
Mild	276	55.2
Moderate	84	16.8
Severe	18	3.6
Variable	Mean	Standard Deviation
Haemoglobin (g/dL)	10.26	± 1.46
Variable	Median	Interquartile Range
Parasite density (microscopy)‡
P. falciparum (parasites/μL)	11,540	(2,000–34,000)
P. malariae (parasites/μL)	2,100	(1,270–3,720)

*Anaemia was defined as haemoglobin level <11 g/dL and graded as mild (10–10.9 g/dL), moderate (7–9.9 g/dL), and severe (<7 g/dL).

Table 3

Sociodemographic-stratified point prevalence and odds ratios for asymptomatic malaria infection by microscopy, RDT and nPCR.

Variables	Microscopy		RDT		nPCR
	Prevalence	OR (95% CI)	Prevalence	OR (95% CI)	Prevalence	OR (95% CI)
Sex
Female	50 (10.0)	1	70 (14.0)	1	86 (17.2)	1
Male	66 (13.2)	1.35 (0.75–2.44)	86 (17.2)	1.26 (0.74–2.15)	98 (19.6)	1.14 (0.68–1.14)
Age group (years)
≤1	12 (2.4)	1	14 (2.8)	1	18 (3.6)	1
>1–2	56 (11.2)	1.30 (0.48–3.48)	78 (15.6)	1.69 (0.67–4.27)	82 (16.4)	1.30 (0.55–3.09)
>2–3	18 (3.6)	1.34 (0.42–4.30)	22 (4.4)	1.45 (0.48–4.35)	30 (6.0)	1.67 (0.60–4.46)
>3–4	22 (4.4)	1.70 (0.55–5.28)	26 (5.2)	1.78 (0.61–5.23)	32 (6.4)	1.78 (0.65–4.87)
>4–5	8 (1.6)	0.76 (0.19–3.04)	16 (3.2)	1.52 (0.47–4.98)	22 (4.4)	1.79 (0.60–5.38)
Female
≤1	8 (3.3)	1	12 (4.9)	1	12 (4.9)	1
>1–2	22 (9.0)	0.84 (0.23–3.04)	30 (12.3)	0.71 (0.23–2.24)	34 (13.9)	0.85 (0.27–2.64)
>2–3	10 (4.1)	1.03 (0.23–4.58)	14 (5.7)	0.93 (0.25–3.52)	20 (8.2)	1.67 (0.46–6.06)
>3–4	4 (1.6)	0.70 (0.11–4.59)	6 (2.5)	0.67 (0.13–3.41)	10 (4.1)	1.43 (0.32–6.46)
>4–5	6 (2.5)	1.05 (0.19–5.76)	8 (3.3)	0.89 (0.19–4.11)	10 (4.1)	1.25 (0.28–5.53)
Male
≤1	4 (1.6)	1	2 (0.8)	1	3 (2.3)	1
>1–2	34 (13.3)	2.13 (0.43–10.60)	48 (18.8)	7.78 (0.95–63.80)	48 (18.8)	2.16 (0.54–8.67)
>2–3	8 (3.1)	2.00 (0.30–13.27)	8 (3.1)	4.36 (0.42–45.26)	10 (3.9)	1.67 (0.31–8.93)
>3–4	18 (7.0)	2.91 (0.53–16.09)	20 (7.8)	7.50 (0.84–66.86)	22 (8.6)	2.44 (0.54–11.03)
>4–5	2 (0.8)	0.46 (0.04–5.79)	8 (3.1)	5.33 (0.51–56.24)	12 (4.7)	2.86 (0.53–15.47)
Anaemic status
Non-anaemic	8 (1.6)	1	16 (3.2)	1	18 (3.6)	1
Anaemic	108 (21.6)	5.70 (1.97–16.48)**	140 (28.0)	3.90 (1.75–8.67)**	166 (33.2)	4.54 (2.11–9.71)***
Residence
Barekuma	16 (3.2)	1	20 (4.0)	1	22 (4.4)	1
Barekese	8 (1.6)	1.75 (0.47–6.48)	10 (2.0)	1.79 (0.54–5.96)	20 (4.0)	4.55 (1.58–13.08)**
Adankwame	16 (3.2)	1.62 (0.56–4.65)	18 (3.6)	1.45 (0.54–3.88)	22 (4.4)	1.67 (0.66–4.23)
Esaaso	0 (0.0)	-	10 (2.0)	1.33 (0.41–4.30)	14 (2.8)	1.82 (0.62–5.30)
Abira	28 (5.6)	3.68 (1.39–9.71)**	40 (8.0)	5.08 (2.08–12.43)***	40 (8.0)	4.55 (1.90–10.90)**
Worapong	48 (9.6)	13.50 (5.03–36.25)***	58 (11.9)	19.66 (7.21–53.60)***	66 (13.2)	36.00 (11.52–112.48)***

**; Significant at p<0.01

***; Significant at p<0.0001

Table 4

Comparison of microscopy and RDT with nPCR for the detection of asymptomatic malaria infection.

Methods	P. falciparum	P. malariae	Negative
Microscopy	88	28	384
RDT	156	n/a	344
nPCR	156	28	316

Table 5

Diagnostic performance of microscopy and RDT in detecting asymptomatic malaria infection.

Methods	Microscopy		RDT
	P. falciparum	P. malariae	P. falciparum
Sensitivity (95% CI)	56.4 (48.3–64.3)	100.0 (87.7–100.0)	100.0 (97.7–100.0)
Specificity (95% CI)	100.0 (98.8–100.0)	100.0 (98.8–100.0)	100.0 (98.9–100.0)
PPV	100.0	100.0	100.0
NPV	82.3	100.0	100.0
TP	88	28	156
TN	316	316	344
FP	0	0	0
FN	68	0	0
Accuracy (%)	85.6	100.0	100.0
AUC (%)	78.2 (74.2–81.8)	100.0 (98.9–100.0)	100.0 (99.3–100.0)
Reliability (%)	56.4	100.0	100.0

nPCR was used as the reference