| Literature DB >> 32715269 |
Yilong Liu1, Xianan Zhang2, Liuhuan Zhan1, Chang Xu1, Linxiao Sun3, Huamin Jiang4, Chongde Sun1, Xian Li1.
Abstract
The present study is to investigate theEntities:
Year: 2020 PMID: 32715269 PMCID: PMC7377368 DOI: 10.1021/acsomega.0c02759
Source DB: PubMed Journal: ACS Omega ISSN: 2470-1343
Figure 1(A) Shui Jing cultivar of the Chinese bayberry fruit. (B) Schematic diagram for the preparation of the Shui Jing fruit extract (SJE). (C) Pi chart representation of the polyphenolic composition in the SJE. (D) Aglycons of the proanthocyanidins (PAs) and derivatives, flavonoid glycosides, and phenolic acid and derivatives.
Main Polyphenols Identified by Liquid Chromatography Quadrupole Time-of-Flight Tandem Mass Spectrometry (LC-Q-TOF-MS) and Their Contents in the Shui Jing Fruit Extract (SJE)
| no. | compound | RT | [M –
H]− ( | molecular formula | fragment ions (relative abundance) | refs | content (mg/100 g DW) |
|---|---|---|---|---|---|---|---|
| Proanthocyanidins and Derivatives | |||||||
| 1 | 32.891 | 457.0775 | C22H18O11 | 305.0671(14), 169.0143(100), 125.0247(37.5) | ( | 1706.09 ± 16.87 | |
| 2 | (E)GC-(E)GCG | 23.483 | 761.1366 | C37H30O18 | 609.1294(19), 591.1182(18), 423.0739(100), 305.0675(29) | ( | 185.37 ± 2.74 |
| 3 | 21.168 | 305.0669 | C15H14O7 | 125.0243(100), 219.0654(30), 221.0451(15), 165.0197(25) | ( | 127.44 ± 0.67 | |
| 4 | (E)GCG-(E)GCG | 30.964 | 913.1485 | C44H34O22 | 761.144(36), 743.133(33), 591.1191(42), 573.1077(23), 423.0738(100), 285.0407(23) | ( | 98.58 ± 1.00 |
| Flavonoid Glycosides | |||||||
| 5 | myricetin-3- | 44.885 | 463.0876 | C21H20O12 | 317.0309(29), 316.0221(100), 287.0193(26), 271.0243(35), 259.0244(7) | ( | 834.18 ± 4.51 |
| 6 | quercetin-3- | 53.954 | 447.093 | C21H20O11 | 301.0349(61), 300.0271(100), 271.0247(48), 255.03(30), 243.0298(11), 151.0033(7) | ( | 779.95 ± 4.31 |
| 7 | kaempferol-3- | 62.243 | 431.0981 | C21H20O10 | 285.0409(100), 284.033(81), 255.0304(75), 227.0352(40), 229.0508(13) | ( | 279.14 ± 1.79 |
| 8 | myricetin-3- | 61.781 | 615.0991 | C28H24O16 | 463.0918(9), 317.0309(100), 178.9984(9) | ( | 118.41 ± 1.35 |
| 9 | cyanidin-3- | 18.304 | 449.1078 | C21H20O11 | 284.0324(100), 447.0954(74) | ( | 78.52 ± 0.16 |
| Phenolic Acid and Derivatives | |||||||
| 10 | 3′- | 52.823 | 447.0576 | C20H16O12 | 315.0153(100), 299.9921(96), 285.0401(7), 284.0329(21), 255.0293(12), 227.034(12) | ( | 92.31 ± 0.04 |
RT: Retention time.
EGCG: Epigallocatechin gallate.
EGC: Epigallocatechin.
Further confirmed in comparison with authentic standard and its quantitative analysis was absolute. Others were relatively quantified.
Effects of the SJEa (200 mg/kg Bodyweight (BW)) on Growth Parameters, Tissue Index, and Serum Parameters in Diabetic KK-Ay Mice
| parameters | C57BL/6 + water | KK-Ay + water | KK-Ay + SJE |
|---|---|---|---|
| Bodyweight (g) | |||
| 0 week | 22.24 ± 0.72 | 36.89 ± 0.68 | 37.05 ± 0.61 |
| 1 week | 25.04 ± 0.86 | 39.57 ± 0.75 | 38.75 ± 0.47 |
| 2 week | 25.78 ± 0.81 | 41.76 ± 1.05 | 38.77 ± 0.53* |
| 3 week | 26.24 ± 1.05 | 43.57 ± 1.05 | 39.41 ± 0.77** |
| 4 week | 26.88 ± 1.04 | 45.75 ± 1.19 | 40.73 ± 0.53** |
| 5 week | 24.32 ± 0.77 | 46.76 ± 1.56 | 41.82 ± 0.65* |
| food intake (g per day) | 2.99 ± 0.09 | 5.29 ± 0.05 | 5.01 ± 0.08 |
| Tissue Index (%) | |||
| liver | 3.79 ± 0.24 | 5.11 ± 0.29 | 3.88 ± 0.18* |
| epididymal WAT | 1.00 ± 0.19 | 2.63 ± 0.13 | 2.44 ± 0.09 |
| perirenal WAT | 0.19 ± 0.07 | 1.29 ± 0.11 | 1.08 ± 0.07 |
| BAT | 0.31 ± 0.05 | 0.63 ± 0.07 | 0.87 ± 0.15 |
| heart | 0.53 ± 0.06 | 0.34 ± 0.01 | 0.37 ± 0.01 |
| kidney | 1.13 ± 0.09 | 0.99 ± 0.03 | 1.00 ± 0.02 |
| Serum Lipids | |||
| TC | 2.13 ± 0.24 | 3.77 ± 0.32 | 2.70 ± 0.13* |
| TG | 0.64 ± 0.06 | 0.74 ± 0.02 | 0.60 ± 0.02* |
| HDL-c | 2.18 ± 0.16 | 1.72 ± 0.19 | 2.34 ± 0.11* |
| LDL-c | 0.05 ± 0.02 | 0.53 ± 0.11 | 0.19 ± 0.04* |
| Liver Function | |||
| ALT | 27.5 ± 1.06 | 66.71 ± 10.79 | 38.25 ± 3.75* |
| AST | 112.5 ± 7.85 | 138.86 ± 9.96 | 122.75 ± 8.34 |
| AST/ALT | 4.11 ± 0.31 | 2.28 ± 0.16 | 3.36 ± 0.28** |
SJE: Shui Jing fruit extract.
C57BL/6 mice as nondiabetic control (n = 10).
KK-Ay mice as a diabetic model (n = 10 for each group).
Tissue index (%) = tissue weight (g)/bodyweight (g) × 100.
WAT: White adipose tissue.
BAT: Brown adipose tissue.
TC: Total cholesterol.
TG: Triglycerides.
HDL-c: High-density lipoprotein cholesterol.
LDL-c: Low-density lipoprotein cholesterol.
ALT: Alanine aminotransferase.
AST: Aspartate transaminase. Values are expressed as the mean ± standard error (SE). *p < 0.05, **p < 0.01, compared to the KK-Ay + water group.
Figure 2Effects of the SJE at a dose of 200 mg/kg BW on fasting blood glucose (A), oral glucose tolerance (B), and insulin resistance (C) in diabetic KK-Ay mice during the 5 week experiment, with an oral glucose tolerance test (OGTT) in week 4 and the insulin tolerance test (ITT) in week 5. Values are mean ± SE of 7–10 mice. *p < 0.05, **p < 0.01, and ***p < 0.001; the KK-Ay + SJE group compared to the KK-Ay + water group.
Figure 3Effects of the SJE at a dose of 200 mg/kg BW on levels of serum insulin, glucagon, leptin, resistin, and adiponectin in diabetic KK-Ay mice at the end of the experiment. Values are expressed as mean ± SE (n = 7–10). *p < 0.05 and ***p < 0.001; the KK-Ay + SJE group compared to the KK-Ay + water group.
Figure 4(A) Liver weight, hepatic cholesterol (TC) level, and hepatic triglyceride level (TG) in diabetic KK-Ay mice (n = 5); (B) Hematoxylin and eosin staining and Oil Red O staining of transverse liver section (200× magnification) (n = 5). Values are expressed as mean ± SE. *p < 0.05 and **p < 0.01; the KK-Ay + SJE group compared to the KK-Ay + water group.
Primer Sequences Used for qPCR in This Studya
| genes | forward (5′ to 3′) | reverse (5′ to 3′) |
|---|---|---|
| AGAGCCCCATCTGTCCTCTC | ACTGGTAGTCTGCAAAACCAAA | |
| CAGCACAGCATCGTACCCA | TCCCAATGCCGTTCTCAAAAT | |
| TTATTGAACCAGTAGGCAACCG | GCTATGAGGCGAGTTGAGATCC | |
| TGGCAGCAAGGTAACCACAG | CGGTTCTTAAATCGCTTGTCCTG | |
| ACCGGCACACATTTGAAGAAG | CTCGTTGAGGATCAGCAAGG | |
| GGACCTTTCCCAATTCCTTTCTT | TCTTGTGGTTCAGTAGCACCT | |
| GGGATTGCTGTGGTAGTGAGC | GGTATGGAATCAACCCGTTGTC | |
| AAGGTGCCAACCTCAATTCATC | CACATTGTCGGCTAAACCTGC | |
| ATGGGCTGTGATCGGAACTG | TTTGCCACGTCATCTGGGTTT | |
| CACTTCCTACCCCTGCTGG | ACCACAAAGATGCTGTTTGACA | |
| CTGTATGACGCTGTGCCCATT | AAGGGGTTGGTGCTTGGTC | |
| ACAGCCTCAGCGTCCAATC | GTGGAGCCGATGTCCATCAT | |
| CCAGCCTGAGGGCTTACTG | CTCCATTGACTGTGACATCTCG | |
| CATGTGCTGGCAGTATAACCC | TCGGGAGGCTTGTTCTCCT | |
| CTGGACCAGAGACCCTTTGC | GGACGGGGACTTCTGAGTCTT | |
| β | GGCTGTATTCCCCTCCATCG | CCAGTTGGTAACAATGCCATGT |
Ppara, peroxisome proliferator-activated receptor α. Cpt2, carnitine O-palmitoyltransferase 2. Pik3ca, phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit α. Gsk3b, glycogen synthase kinase 3 β. mTOR, mammalian target of rapamycin. Cyp2e1, cytochrome P450, family 2, subfamily E, polypeptide 1. Cyp7a1, cholesterol 7alpha-monooxygenase. Hnf4a, hepatocyte nuclear factor 4-α. CD36, cluster of differentiation 36. INS1, insulin 1. Pdpk1, 3-phosphoinositide dependent protein kinase-1. Crtc2, CRE-binding protein (CREB)-regulated transcription coactivator 2. HSL, hormone-sensitive lipase. IGF1, insulin-like growth factor 1. IGF1R, insulin-like growth factor 1 receptor.
Figure 5(A) Gene expressions of hepatic glucose and lipid metabolism markers related to the AMPK pathway in the liver of diabetic KK-Ay mice (n = 3). (B) Effects of the SJE (200 mg/kg BW) on p-AMPKα protein expression in the liver of diabetic KK-Ay mice (n = 3). Values are expressed as mean ± SE. *p < 0.05 and **p < 0.01; the KK-Ay + SJE group compared to the KK-Ay + water group.