Literature DB >> 32712318

Overexpression of MicroRNA-340-5p Inhibits Pulmonary Arterial Hypertension Induced by APE by Downregulating IL-1β and IL-6.

Minghui Ou1, Chuntang Zhang2, Jing Chen1, Shibo Zhao1, Shichao Cui1, Jie Tu3.   

Abstract

Pulmonary arterial hypertension (PAH) is a fatal cardiovascular disease that could eventually result in right ventricular failure. Recently, the roles of microRNAs (miRNAs) in PAH have been highlighted. The present study aims to investigate the effects of miRNA (miR)-340-5p on PAH induced by acute pulmonary embolism (APE) and the underlying mechanisms. miR-340-5p was lowly expressed, whereas interleukin 1β (IL-1β) and IL-6 were highly expressed in plasma of APE-PAH patients as compared to normal human plasma. Subsequently, IL-1β and IL-6 were confirmed to be two target genes of miR-340-5p using a dual-luciferase reporter gene assay. By conducting overexpression and rescue experiments, overexpression of miR-340-5p was evidenced to inhibit proliferation and migration of pulmonary artery smooth muscle cells (PASMCs) and inflammation via reducing IL-1β and IL-6 levels. Meanwhile, miR-340-5p led to the blocked nuclear factor κB (NF-κB) pathway with reduced NF-κB p65, matrix metalloproteinase 2 (MMP2), and MMP9 expression in PASMCs. Finally, the ameliorative effect of miR-340-5p on pathological lesions was further verified in rat models of APE-PAH. Altogether, overexpressed miR-340-5p inhibited the inflammatory response, proliferation, and migration of PASMCs by downregulating IL-1β and IL-6, thereby suppressing the progression of APE-PAH. miR-340-5p therefore holds promise as an anti-inflammatory therapeutic target.
Copyright © 2020 The Author(s). Published by Elsevier Inc. All rights reserved.

Entities:  

Keywords:  acute pulmonary embolism; inflammatory response; interleukin-1β; interleukin-6; microRNA-340-5p; migration; proliferation; pulmonary arterial hypertension

Year:  2020        PMID: 32712318      PMCID: PMC7378273          DOI: 10.1016/j.omtn.2020.05.022

Source DB:  PubMed          Journal:  Mol Ther Nucleic Acids        ISSN: 2162-2531            Impact factor:   10.183


Introduction

Pulmonary arterial hypertension (PAH) is a progressive, fatal disease, characterized by a persistent increase in pulmonary arterial pressure and vascular resistance, which may cause right ventricular failure and eventually death. The symptoms of PAH range from exertion dyspnea and fatigue to chest pain and dizziness. Pulmonary embolism (PE) is a potentially fatal complication of venous thromboembolism (VTE), which might result in the elevation of right ventricular pressure, due to the blockage of the pulmonary arteries, induced by deep-vein thrombosis in legs or pelvis. Moreover, acute pulmonary embolism (APE) can also lead to PAH following the obstruction of the pulmonary vascular vessels. Proliferation of pulmonary artery endothelial cells (PAECs) and pulmonary artery smooth muscle cells (PASMCs) induces vascular lumen obstruction in the late stage. Despite the progress made in recent years regarding the treatment of PAH, these options have limited efficacy in treating the disease. Therefore, in-depth investigations in the molecular mechanisms of PAH are required to discover the effective therapeutic targets for PAH treatment. MicroRNAs (miRNAs) are involved in a number of fundamental biological processes, such as cell migration, metabolism, proliferation, and apoptosis. Furthermore, miRNAs are known for their significant role in cardiovascular diseases. Recently, accumulating evidence suggested that the abnormal expression of miRNAs participates in the biological development of PAH., The downregulation of miRNA (miR)-126 plays a functional role in hindering the development of right ventricular failure in PAH. Furthermore, miR-340-5p has also been found to function critically in heart failure and dilated cardiomyopathy, which could be induced by CT-1 that belongs to the interleukin-6 (IL-6) family. Meanwhile, miR-340-5p has been found to mediate IL-1β. IL-1β and IL-6 are proinflammatory cytokines that are associated with chronic or increased inflammation. Evidence has been presented, suggesting that the upregulation of IL-1β is correlated with APE. Moreover, the contribution of IL-6 to chronic hypoxia-induced pulmonary hypertension has been illustrated by a previous study. The aforementioned findings lead to a presumption that miR-340-5p may interact with IL-1β and IL-6 to participate in APE-PAH. Therefore, we conducted the present study to explore the possible effects of miR-340-5p on the inflammatory response and progression of PAH by regulating IL-1β and IL-6.

Results

Differential Expression of miR-340-5p, IL-1β, and IL-6 in Human Normal Plasma and APE-PAH Patient Plasma

Quantitative reverse transcription polymerase chain reaction (qRT-PCR) and enzyme-linked immunosorbent assay (ELISA) were performed to measure the expression of miR-340-5p in human APE-PAH. The results revealed that miR-340-5p was downregulated, whereas IL-1β and IL-6 were upregulated in patients with APE-PAH in comparison with normal human plasma (p < 0.05) (Figures 1A and 1B). The results of correlation analysis showed that there exists significant negative correlations of miR-340-5p with IL-1β and IL-6, respectively (p < 0.05) (Figures 1C and 1D).
Figure 1

miR-340-5p, IL-1β, and IL-6 Are Dysregulated in Plasma of Patients with APE-PAH

(A) The relative expression of miR-340-5p in APE-PAH plasma and normal human plasma measured by qRT-PCR. (B) The levels of IL-1β and IL-6 in APE-PAH plasma examined by ELISA. (C and D) The correlation analyses of the expression of miR-340-5p with the level of IL-1β (C) and the level of IL-6 (D). The data were all measurement data and were expressed as mean ± standard deviation. Unpaired t test was used for the comparison between two groups, and the correlation between two factors was analyzed by Pearson correlation (n = 48 for normal controls, and n = 118 for the APE-PAH group). ∗p < 0.05 versus normal controls.

miR-340-5p, IL-1β, and IL-6 Are Dysregulated in Plasma of Patients with APE-PAH (A) The relative expression of miR-340-5p in APE-PAH plasma and normal human plasma measured by qRT-PCR. (B) The levels of IL-1β and IL-6 in APE-PAH plasma examined by ELISA. (C and D) The correlation analyses of the expression of miR-340-5p with the level of IL-1β (C) and the level of IL-6 (D). The data were all measurement data and were expressed as mean ± standard deviation. Unpaired t test was used for the comparison between two groups, and the correlation between two factors was analyzed by Pearson correlation (n = 48 for normal controls, and n = 118 for the APE-PAH group). ∗p < 0.05 versus normal controls.

Localization of miR-340-5p in the Cytoplasm of PASMCs

In order to determine the localization of miR-340-5p in PASMCs, fluorescence in situ hybridization (FISH) was conducted. The results showed that miR-340-5p was mainly located in the cytoplasm of PASMCs (Figure 2A). Following nucleus/cytoplasm RNA extraction, qRT-PCR was conducted for miR-340-5p expression determination. The obtained results were consistent with the aforementioned FISH data (Figure 2B).
Figure 2

miR-340-5p Is Observed to Be Mainly Localized in the Cytoplasm of PASMCs

(A) Subcellular localization of miR-340-5p determined using FISH. (B) Nuclear and cytoplasmic expression of miR-340-5p determined by qRT-PCR.

miR-340-5p Is Observed to Be Mainly Localized in the Cytoplasm of PASMCs (A) Subcellular localization of miR-340-5p determined using FISH. (B) Nuclear and cytoplasmic expression of miR-340-5p determined by qRT-PCR.

Verification of IL-1β and IL-6 as the Target Genes of miR-340-5p

To further explore the relationship between miR-340-5p and IL-1β and IL-6, the online software starBase analysis was used. The prediction results revealed that there were miR-340-5p binding sites in IL-6 and IL-1β, respectively (Figures 3A and 3B). In addition, dual-luciferase reporter gene assay results showed a decrease in luciferase signal in cells cotransfected with miR-340-5p mimic and plasmids containing IL-1β-wild-type (WT) or IL-6-WT 3′ untranslated region (UTR), compared to the cells cotransfected with IL-1β-WT or IL-6-WT and miR-negative control (NC) or empty plasmids. There was no significant change observed in the luciferase activity of cells transfected with IL-6-mut (mutation) and IL-1β-mut in the presence of miR-340-5p mimic (p < 0.05), respectively (Figures 3C and 3D). The above results confirmed that IL-1β and IL-6 were targets of miR-340-5p.
Figure 3

IL-6 and IL-1β Are Verified as Targets of miR-340-5p

(A) Prediction of binding sites between miR-340-5p and IL-6 using starBase software. (B) Prediction of binding sites between miR-340-5p and IL-1β using starBase software. (C and D) Dual-luciferase reporter gene assay for the confirmation of the relationships between miR-340-5p and IL-6 (C) and miR-340-5p and IL-1β (D). The data were all measurement data and were expressed as mean ± standard deviation. Unpaired t test was used for the comparison between two groups. The experiment was repeated three times. ∗p < 0.05 versus the empty group; #p < 0.05 versus the miR-NC group.

IL-6 and IL-1β Are Verified as Targets of miR-340-5p (A) Prediction of binding sites between miR-340-5p and IL-6 using starBase software. (B) Prediction of binding sites between miR-340-5p and IL-1β using starBase software. (C and D) Dual-luciferase reporter gene assay for the confirmation of the relationships between miR-340-5p and IL-6 (C) and miR-340-5p and IL-1β (D). The data were all measurement data and were expressed as mean ± standard deviation. Unpaired t test was used for the comparison between two groups. The experiment was repeated three times. ∗p < 0.05 versus the empty group; #p < 0.05 versus the miR-NC group.

miR-340-5p Inhibits PASMC Proliferation and Migration by Inhibiting IL-1β or IL-6

In order to further explore the role of miR-340-5p in APE-PAH, IL-1β or IL-6 was used to stimulate PASMCs in order to observe the inflammatory response of the cells following the overexpression of miR-340-5p and its regulation on PASMC proliferation and migration and the pleural vascular remodeling in APE-PAH. The results from qRT-PCR and ELISA showed that levels of IL-1β and IL-6 in cells transfected with miR-340-5p inhibitor were higher than cells treated with inhibitor NC (p < 0.05). There was a decrease in the level of IL-1β and IL-6 in cells transfected with miR-340-5p mimic in contrast to cells transfected with mimic NC (p < 0.05). Meanwhile, cells cotransfected with miR-340-5p mimic and over-expression (oe)-IL-6 showed an increase in IL-6 level in comparison to miR-340-5p mimic transfection alone (p < 0.05). IL-1β level was elevated following cotransfection of miR-340-5p mimic and oe-IL-1β in comparison to miR-340-5p mimic transfection alone (p < 0.05) (Figures 4A and 4B). These results revealed that the inhibition of miR-340-5p resulted in increased levels of IL-1β and IL-6 in PASMCs.
Figure 4

miR-340-5p Impedes Cell Proliferation and Migration via Inhibiting Levels of IL-1β and IL-6

(A) mRNA expression of IL-1β and IL-6 in PASMCs determined by qRT-PCR. (B) The expression of IL-1β and IL-6 in the supernatant of PASMCs measured by ELISA. (C) Viability of PASMCs assessed using the CCK-8 assay. (D) Percentages of PASMCs at G1 and S phases calculated using flow cytometry. (E) PASMC proliferation examined using EdU assay. (F) Migration ability of PASMCs evaluated using Transwell assay. The data were all measurement data and were expressed as mean ± standard deviation. Unpaired t test was used for the comparison between two groups. The experiment was repeated three times. ∗p < 0.05 versus cells transfected with inhibitor NC; #p < 0.05 versus cells transfected with mimic NC; &p < 0.05 versus cells transfected with miR-340-5p mimic.

miR-340-5p Impedes Cell Proliferation and Migration via Inhibiting Levels of IL-1β and IL-6 (A) mRNA expression of IL-1β and IL-6 in PASMCs determined by qRT-PCR. (B) The expression of IL-1β and IL-6 in the supernatant of PASMCs measured by ELISA. (C) Viability of PASMCs assessed using the CCK-8 assay. (D) Percentages of PASMCs at G1 and S phases calculated using flow cytometry. (E) PASMC proliferation examined using EdU assay. (F) Migration ability of PASMCs evaluated using Transwell assay. The data were all measurement data and were expressed as mean ± standard deviation. Unpaired t test was used for the comparison between two groups. The experiment was repeated three times. ∗p < 0.05 versus cells transfected with inhibitor NC; #p < 0.05 versus cells transfected with mimic NC; &p < 0.05 versus cells transfected with miR-340-5p mimic. Flow cytometry, Cell Counting Kit-8 (CCK-8) assay, and 5-ethynyl-2′-deoxyuridine (EdU) assay were then performed to evaluate the cell cycle, growth, and proliferation. The results showed less G1-phase-arrested cells and more S-phase-arrested cells upon inhibition of miR-340-5p, in addition to enhanced cell proliferation (p < 0.05). By contrast, reduced cell proliferation, more G1-phase-arrested cells, and less S-phase-arrested cells were observed in the presence of miR-340-5p mimic (p < 0.05). Less G1-phase-arrested cells and more S-phase-arrested cells, as well as enhanced cell proliferation, were presented upon cotransfection of miR-340-5p mimic and oe-IL-6 or miR-340-5p mimic and oe-IL-1β as compared to the transfection with miR-340-5p mimic alone (p < 0.05) (Figures 4C–4E). Therefore, the inhibition of miR-340-5p can facilitate the proliferation of PASMCs through the elevation of IL-1β and IL-6 levels. The results from the Transwell assay showed an increase in the migration ability of PASMCs after transfection with the miR-340-5p inhibitor was enhanced (p < 0.05). After treatment with miR-340-5p mimic, cell migration was reduced (p < 0.05), whereas the migration ability of PASMCs inhibited by miR-340-5p was rescued by the overexpression of either IL-6 or IL-1β (p < 0.05) (Figure 4F). The aforementioned results revealed that the overexpression of miR-340-5p resulted in the inhibition of IL-1β and IL-6 levels, thus hindering proliferation and migration of PASMCs.

Overexpression of miR-340-5p Inhibits IL-6- or IL-1β-Induced Activation of the Nuclear Factor κB (NF-κB) Pathway in PASMCs

qRT-PCR and western blot analysis were conducted to measure the expression of NF-κB pathway-related genes and vascular cell adhesion molecule (VCAM-1) in PASMCs to evaluate the inflammatory response. As shown in Figures 5A and 5B, expression of NF-κB p65, VCAM-1, matrix metalloproteinase 2 (MMP2), and MMP9 was increased in PASMCs following the downregulation of miR-340-5p (p < 0.05). In contrast, the expression of NF-κB p65, VCAM-1, MMP2, and MMP9 after miR-340-5p mimic transfection was decreased in PASMCs (p < 0.05), which was rescued by upregulation of either IL-6 or IL-1β (p < 0.05).
Figure 5

miR-340-5p Blocked the IL-6- or IL-1β-Induced NF-κB Pathway in PASMCs

(A) mRNA expression of NF-κB p65, VCAM-1, MMP2, and MMP9 in the PASMCs examined by qRT-PCR. (B) Western blot analysis of NF-κB p65, VCAM-1, MMP2, and MMP9 proteins in the PASMCs. The data were all measurement data and were expressed as mean ± standard deviation. Unpaired t test was used for the comparison between two groups. The experiment was repeated three times. ∗p < 0.05 versus cells transfected with inhibitor NC; #p < 0.05 versus cells transfected with mimic NC; &p < 0.05 versus cells transfected with miR-340-5p mimic.

miR-340-5p Blocked the IL-6- or IL-1β-Induced NF-κB Pathway in PASMCs (A) mRNA expression of NF-κB p65, VCAM-1, MMP2, and MMP9 in the PASMCs examined by qRT-PCR. (B) Western blot analysis of NF-κB p65, VCAM-1, MMP2, and MMP9 proteins in the PASMCs. The data were all measurement data and were expressed as mean ± standard deviation. Unpaired t test was used for the comparison between two groups. The experiment was repeated three times. ∗p < 0.05 versus cells transfected with inhibitor NC; #p < 0.05 versus cells transfected with mimic NC; &p < 0.05 versus cells transfected with miR-340-5p mimic. The aforementioned findings revealed that miR-340-5p overexpression can inhibit IL-1β and IL-6 levels, thus blocking the NF-κB pathway, as well as reducing VCAM-1 expression.

Overexpressed miR-340-5p Suppresses the Development of APE-PAH in Rats

To explore the effect of miR-340-5p on the formation of APE-PAH disease, the human and rat sequences of miR-340-5p were evaluated. The results showed conservation between human and rat miR-340-5p sequences (Figure 6A). Next, the APE-PAH rat models were established. The establishment of the APE-PAH rat models was assessed by examining the general condition of the model rats, such as respiratory rate and extent, electrocardiogram, mean pulmonary artery pressure (mPAP) monitoring, and hematoxylin and eosin (H&E) staining of pulmonary artery tissues. Electrocardiogram monitoring revealed that the heart rate of rats in the APE-PAH group was slightly faster than that before embolization, which was characterized by shortness of breath, rapid breathing, shallow breathing, and skin and lips from pink to cyanosis (Figure 6B). mPAP of rats in the APE-PAH group, 24 h and 1 week after embolization, was higher than that in the control and the sham groups (Figure 6C).
Figure 6

miR-340-5p Inhibited the Progression of APE-PAH in Rat Models

(A) Human and rat sequences of miR-340-5p. Query 1 represents the rat miR-340-5p sequence, and subject (Sbjct) 1 represents the human miR-340-5p sequence. (B) Changes of electrocardiogram before and after embolization in APE-PAH model rats. (C) mPAP of normal, sham-operated rats and rats with APE at the 24th h and 1 week. (D) H&E staining analysis of the lung tissue sections of normal, sham-operated rats, and rats from the APE-PAH model at the 24th h and 1 week (×400). (E) H&E staining analysis of the lung tissue sections of rats from the APE-PAH model (×400). (D and E) Blue arrows indicate the pulmonary artery wall, and black arrows indicate the thrombus. (F) mPAP of rats from the APE-PAH model. (G) The levels of IL-6 and IL-1β in peripheral blood of rats from the APE-PAH model measured by ELISA. (H) The expression of miR-340-5p in pulmonary artery tissues of rats from the APE-PAH model assessed by qRT-PCR. (I) The apoptosis in pulmonary artery tissues of rats among the four groups was detected by TUNEL assay. (J) Comparisons of the apoptosis rate in pulmonary artery tissues of rats among the four groups. (K) Western blot analysis of VCAM-1, MMP2, and MMP9 proteins in pulmonary artery tissues of rats from the APE-PAH model. (L) mRNA expression of VCAM-1, MMP2, and MMP9 in pulmonary artery tissues of rats from the APE-PAH model examined by qRT-PCR. The data were all measurement data and were expressed as mean ± standard deviation. The one-way analysis of variance was used for the comparison among multiple groups, followed by Tukey’s post hoc test. The experiment was repeated three times. ∗p < 0.05 versus the sham group or the control group; #p < 0.05 versus the APE-PAH group.

miR-340-5p Inhibited the Progression of APE-PAH in Rat Models (A) Human and rat sequences of miR-340-5p. Query 1 represents the rat miR-340-5p sequence, and subject (Sbjct) 1 represents the human miR-340-5p sequence. (B) Changes of electrocardiogram before and after embolization in APE-PAH model rats. (C) mPAP of normal, sham-operated rats and rats with APE at the 24th h and 1 week. (D) H&E staining analysis of the lung tissue sections of normal, sham-operated rats, and rats from the APE-PAH model at the 24th h and 1 week (×400). (E) H&E staining analysis of the lung tissue sections of rats from the APE-PAH model (×400). (D and E) Blue arrows indicate the pulmonary artery wall, and black arrows indicate the thrombus. (F) mPAP of rats from the APE-PAH model. (G) The levels of IL-6 and IL-1β in peripheral blood of rats from the APE-PAH model measured by ELISA. (H) The expression of miR-340-5p in pulmonary artery tissues of rats from the APE-PAH model assessed by qRT-PCR. (I) The apoptosis in pulmonary artery tissues of rats among the four groups was detected by TUNEL assay. (J) Comparisons of the apoptosis rate in pulmonary artery tissues of rats among the four groups. (K) Western blot analysis of VCAM-1, MMP2, and MMP9 proteins in pulmonary artery tissues of rats from the APE-PAH model. (L) mRNA expression of VCAM-1, MMP2, and MMP9 in pulmonary artery tissues of rats from the APE-PAH model examined by qRT-PCR. The data were all measurement data and were expressed as mean ± standard deviation. The one-way analysis of variance was used for the comparison among multiple groups, followed by Tukey’s post hoc test. The experiment was repeated three times. ∗p < 0.05 versus the sham group or the control group; #p < 0.05 versus the APE-PAH group. The results from H&E staining demonstrated that the rats in the APE-PAH group showed thrombosis in the lumen of the pulmonary artery, infiltration of inflammatory cells, and widening of the alveolar space. 1 week after embolization, the thrombus in the pulmonary lumen was partially dissolved, and the wall of the pulmonary artery was thickened (Figure 6D), which provide evidence for the successful establishment of the APE-PAH rat models. In contrast to the sham group, the miR-340-5p-agomir group presented with a small amount of thrombi formed, whereas more formed thrombi with arterial-wall thickening were observed in the miR-340-5p-antagomir group and the APE-PAH group (Figure 6E). mPAP was higher in the miR-340-5p-antagomir group and the APE-PAH model group than that in the sham group (Figure 6F). This demonstrated that miR-340-5p inhibited the progression of APE-PAH in rats. The levels of IL-6 and IL-1β in peripheral blood were measured by ELISA. The results showed that the levels of IL-6 and IL-1β in the miR-340-5p-antagomir group and the APE-PAH model group were much higher relative to those in the sham group (p < 0.05). Levels of IL-6 and IL-1β remained statistically similar between the miR-340-5p-agomir group and the sham group (Figure 6G). Compared with the sham group, miR-340-5p was expressed at a higher level in the pulmonary artery tissues in the miR-340-5p-agomir group, whereas the miR-340-5p-antagomir group and the APE-PAH rat models showed significantly lowered expression in miR-340-5p, suggesting that the above changes were correlated with miR-340-5p expression (p < 0.05) (Figure 6H). The results from terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL) assay provided evidence that the overexpression of miR-340-5p attenuated apoptosis in the pulmonary artery tissues of APE-PAH-modeled rats (p < 0.05) (Figures 6I and 6J). The results obtained from qRT-PCR and western blot analysis demonstrated that levels of VCAM-1, MMP2, and MMP9 in the pulmonary artery tissues were elevated in the APE-PAH group compared with the sham group and increased in the miR-340-5p-antagomir group, whereas it was reduced in the miR-340-5p-agomir group (p < 0.05) (Figures 6K and 6L). These results suggested that the upregulation of miR-340-5p inhibited the levels of VCAM-1, MMP2, and MMP9 in pulmonary artery tissues of APE-PAH rat models, which led to the conclusion that overexpressed miR-340-5p contributed to the suppression in the development of APE-induced PAH in rats.

Discussion

PAH is a serious disorder with remodeling of pulmonary arteries, leading to the gradual elevation of pulmonary vascular resistance and right ventricular failure and death. There was evidence showing that miRNAs, including miR-143/145, miR-126, and miR-126, are implicated in PAH. The results obtained from this study suggested that the upregulation of miR-340-5p could potentially inhibit inflammation, cell proliferation, and migration of PASMCs by downregulating IL-1β and IL-6, thus suppressing thrombosis and APE-induced PAH. Initial results in the present study showed that miR-340-5p was poorly expressed, whereas IL-1β and IL-6 were highly expressed in APE-PAH-modeled rats. miRNAs have been found to be dysregulated in PAH. miR-140-5p is downregulated in PAH, and its enforced expression results in the inhibition of PAH development in a rat model. According to the findings from our study, IL-1β and IL-6 were confirmed to be the target genes of miR-340-5p, and miR-340-5p could negatively regulate IL-1β and IL-6. IL-1β is secreted by vascular smooth muscle cells (VSMCs) and endothelial cells, which activate a series of inflammatory factors and abnormal proliferation and migration of VSMCs. Moreover, an elevated level of IL-1β was found in APE rat models, and the increase in IL-6 expression is associated with chronic hypoxia-induced pulmonary hypertension., An increase in IL-6 contributes to pathogenesis of pulmonary hypertension in patients with chronic obstructive pulmonary disease. Our study also demonstrated that miR-340-5p inhibited PASMC proliferation and migration by suppressing IL-6 and IL-1β, thereby obstructing thrombosis and the development of PAH in the rat model. The proliferation and migration of VSMC are significant, as they contribute to the development of cardiovascular diseases., MMP2 and MMP9 have been identified to promote migration and proliferation of VSMCs. Moreover, a previous study found that IL-1β stimulated the expression of MMP2 and MMP9. VCAM-1 is an inflammatory mediator secreted from endothelial cells and has been identified as a marker of endothelial dysfunction in the inflammatory response, whereas endothelial injury and dysfunction are compulsory conditions for the development of thrombosis. In addition, IL-1β increases the expression of VCAM-1 to improve cardiac function following an ischemic attack. Both IL-6 and IL-1β are proinflammatory cytokines involved in the mediation of inflammation. Furthermore, there is evidence showing that IL-6 mediates cell proliferation of multiple myeloma (MM), IL-6 is an important cytokine that is released from multiple cell types, including VSMCs, macrophages, fibroblasts, and endothelial cells. Endothelial dysfunction induced by overexpressed proinflammatory cytokines, such as IL-1β and IL-6, partially attributes to the development of PAH., Smooth muscle cells (SMCs) are responsible for regulating blood pressure and blood flow in healthy arteries, whereas inflammatory cytokine IL-1β modulates SMC phenotypes to an inflammatory state by inhibiting SMC differentiation marker genes and promoting proinflammatory factors. Thus, in the present study, miR-340-5p suppressed PASMC proliferation and migration by downregulating IL-6 and IL-1β, thereby inhibiting thrombosis and PAH in the rat model. In the study, we also demonstrated that overexpressed miR-340-5p inhibited IL-6- or IL-1β-induced activation of the NF-κB pathway in PASMCs. NF-κB is a transcription factor in the nucleus, which presents in variety of tissue cells and covers a wide range of biological activities. It has the ability to regulate multiple genes involved in the immune function and inflammatory process and plays important roles in several physiological and pathological conditions. Meanwhile, the relationship between NF-κB with cell proliferation and the inflammatory response has also been identified. NF-κB is one of the main inflammatory pathways for proinflammatory cytokines and is activated by IL-1β., Li et al. mentioned in their study that miR-340 could promote cell apoptosis in ovarian cancer by suppressing NF-κB1. Wynants and colleagues have also identified that NF-κB is involved in pulmonary arterial endothelial cells in chronic thromboembolic pulmonary hypertension. Moreover, MMP2 and MMP9 are important NF-κB signaling pathway-related downstream proteins. A previous study conducted by Liu et al. revealed that IL-17A could potentially accelerate the invasiveness of esophageal adenocarcinoma cells through the upregulation of NF-κB-mediated MMP2 and MMP9. In addition, inhibition of the NF-κB/MMP2/MMP9 signaling pathway leads to the suppression of proliferation, migration, and invasion of endometrial cells. Thus, the upregulation of miR-340-5p inhibited IL-6- or IL-1β-induced inflammation by suppressing the NF-κB pathway. Taken together, upregulation of miR-340-5p is conducive to prevent the development of APE-PAH through suppression of IL-1β and IL-6 (Figure 7). Thus, miR-340-5p can serve as a potential therapeutic target for APE-induced PAH. However, the present study was conducted with the main focus placed on the effect of miR-340-5p on inflammation of APE-induced PAH in rats. Hence, more pathological processes involving PAH should be explored. Additionally, more investigations are needed in order to elucidate the specific mechanisms of miR-340-5p in APE-PAH.
Figure 7

The Molecular Mechanism of miR-340-5p in Suppressing Proliferation and Migration of PASMCs

Overexpression of miR-340-5p can inhibit the levels of IL-6 and IL-1β in PASMCs, thereby inhibiting PASMC migration and thrombosis and ultimately preventing the progression of APE-PAH.

The Molecular Mechanism of miR-340-5p in Suppressing Proliferation and Migration of PASMCs Overexpression of miR-340-5p can inhibit the levels of IL-6 and IL-1β in PASMCs, thereby inhibiting PASMC migration and thrombosis and ultimately preventing the progression of APE-PAH.

Materials and Methods

Ethics Statement

This study was approved by the Ethics Committee of Qingdao Municipal Hospital, and signed, informed consents were obtained from all patients prior to the study. All animal experiments were conducted in accordance with the principles and procedures of the National Institutes of Health. All operations were approved by the Animal Ethics Committee of Qingdao Municipal Hospital.

Study Subjects

A total of 118 patients, including 48 men and 70 women, aged 23–76 years with an average age of 50.23 years, who had been diagnosed with APE-PAH between 2016 and 2018 at Qingdao Municipal Hospital, were selected for the present study. None of the patients included in the study had cardiopulmonary diseases, such as cardiomyopathy, myocardial infarction, heart failure, valvular diseases, pericardial diseases, chronic thromboembolic disease, and chronic obstructive pulmonary disease. All patients underwent echocardiography and computed tomographic pulmonary angiography (CTPA). Patients with APE, diagnosed by CTPA and echocardiographic examinations with pulmonary artery systolic blood pressure greater than 30 mmHg, were used as the standard for the diagnosis of PAH. All patients had complete clinical data and had not received any surgery or medication before. The corresponding patients’ detailed information is shown in Table 1. Plasma from APE-PAH patients (n = 118) and normal human plasma from healthy controls (n = 48) were collected.
Table 1

The Expression of miR-340-5p in Patients with APE-PAH

Variablesn (%)
Age

<5061 (51.69)
≥5057 (48.31)

Gender

Male48 (40.68)
Female70 (59.32)

Risk Stratification

High risk26 (22.03)
Intermediate risk58 (49.15)
Low risk34 (28.81)

Main Clinical Symptoms

Dyspnea58 (49.15)
Thoracic pain64 (54.24)
Hemoptysis14 (11.86)
Syncope18 (15.25)
Chest distress94 (79.66)
Cough42 (35.59)
Palpitation38 (32.20)

Signs

Shortness of breath53 (44.92)
Cyanosis28 (23.73)
Tachycardia46 (38.98)
Lung rale41 (34.75)
Fever57 (48.31)
Fall of blood pressure11 (9.23)

miR-340-5p, microRNA-340-5p; APE-PAH, acute pulmonary embolism pulmonary arterial hypertension. n = 118.

The Expression of miR-340-5p in Patients with APE-PAH miR-340-5p, microRNA-340-5p; APE-PAH, acute pulmonary embolism pulmonary arterial hypertension. n = 118.

FISH Assay

According to the manufacturer’s instructions, the RNA-FISH experiment was performed using miRNA FISH probes (Guangzhou RiboBio, Guangdong, China). The cells were settled on the slices and fixed with 4% paraformaldehyde upon reaching appropriate confluence. Next, the cells were washed three times with distilled water (5 min/time), followed by incubation with the miRNA FISH probe at 4°C overnight, after which dye solution was added for a 2-h reaction at 37°C. Finally, the images of selected visual fields were captured under a fluorescence microscope.

Fractionation of Nuclear/Cytoplasmic RNA

The nuclear/cytoplasmic RNA fractions were separated based on the experimental steps provided by the nuclear/cytoplasmic cellular component extraction kit (BioVision Technologies, Palo Alto, CA, USA). The cells were treated with the buffer containing 10 mM Tris-HCl (pH 7.4), 100 mM NaCl, 2.5 mM MgCl2, and 40 mg/mL digitonin for 10 min and then centrifuged at 16,000 rpm, 4°C, for 5 min. Subsequently, the supernatant, namely cytoplasmic fractions, were collected. Next, 100 μL precooled radioimmunoprecipitation assay (RIPA) buffer was added for the suspension of the pellet containing the nuclear components. The pellet was subjected to vortexing for 15 s, after which, it was replaced on the ice, which was repeated every 10 min for 4 times. After centrifugation at 16,000 × g for 5 min, the supernatant, namely the nuclear fractions, was transferred immediately to a fresh tube. Subsequently, the RNA in nuclear and cytoplasmic fractions was extracted and reversely transcribed for qRT-PCR to determine the nuclear and cytoplasmic expression of miR-340-5p and to further determine the cellular localization of miR-340-5p. The experiment was conducted in triplicate independently.

RNA Isolation and Quantitation

The total RNA from plasma, tissue-grinding solution, or cells was extracted with the use of Trizol (10296010; Invitrogen, Carlsbad, CA, USA). The primers used were all synthesized by Huda Gene (Shenzhen Huada Gene, Shenzhen, Guangdong, China) (Table 2). miRNA-specific complementary DNA (cDNA) was synthesized using the TaqMan Reverse Transcription Kit (4366596; Applied Biosystems, Foster City, CA, USA). The cDNA template was synthesized by reverse transcription reaction using a PCR instrument, according to the instructions of the reverse transcription kit (Beijing TransGen Biotech, Beijing, China). Fluorescence quantitative PCR was carried out using SYBR Premix Ex Taq II Kit (RR820A; TaKaRa, Dalian, Liaoning, China). Quantitative real time PCR experiments were conducted using an ABI7500 quantitative PCR instrument (Applied Biosystems [ABI], Oyster Bay, NY, USA). Expression of target genes and miRNA was calculated by the relative quantitative method (2−ΔΔCt method), with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and U6 used as the internal control. The experiment was conducted in triplicate independently.
Table 2

Primer Sequence for qRT-PCR

GenePrimers (5′–3′)
miR-340-5pF: GCGGTTATAAAGCAATGAGA
R: GTGCGTGTCGTGGAGTCG
U6F: GCGCGTCGTGAAGCGTTC
R: GTGCAGGGTCCGAGGT
IL-6F: AAGCCAGAGCTGTGCAGATGAGTA
R: TGTCCTGCAGCCACTGGTTC
IL-1βF: TTCGACACATGGGATAACGA
R: TCTTTCAACACGCAGGACAG
NF-κB p65F: GCGTACACATTCTGGGGAG
R: CCGAAGCAGGAGCTATCAA
VCAM-1F: CTCACCTTAATTGCTATG
R: GTTTTTACCTTCTAAGAC
MMP2F: TGATGGTGTCTGCTGGAAAG
R: GACACGTGAAAAGTGCCTTG
MMP9F: CCCGGACCAAGG ATACAG
R: GGCTTTCTCTCGGTACTG
GAPDHF: TCAGCAATGCCTCCTGCAC
R: TCTGGGTGGCAGTGATGGC

qRT-PCR, quantitative reverse transcription polymerase chain reaction; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; miR-340-5p, microRNA-340-5p; IL-1β, interleukin-1β; IL-6, interleukin-6; VCAM-1, vascular cell adhesion molecule 1; MMP2, matrix metalloproteinase 2; MMP9, matrix metalloproteinase 9; NF-κB, nuclear factor κB; f, forward; r, reverse.

Primer Sequence for qRT-PCR qRT-PCR, quantitative reverse transcription polymerase chain reaction; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; miR-340-5p, microRNA-340-5p; IL-1β, interleukin-1β; IL-6, interleukin-6; VCAM-1, vascular cell adhesion molecule 1; MMP2, matrix metalloproteinase 2; MMP9, matrix metalloproteinase 9; NF-κB, nuclear factor κB; f, forward; r, reverse.

Western Blot Analysis

Total protein was extracted. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) protein-loading buffer (P0015; Beyotime, Shanghai, China) was added to the collected protein samples, boiled for 5 min, and loaded into the gel for electrophoresis separation. The protein was then transferred onto a polyvinylidene fluoride (PVDF; FFP36; Beyotime, Shanghai, China) membrane and blocked with 5% bovine serum albumin (BSA) at 37°C for 2 h. The membrane was incubated overnight at 4°C with the primary antibody, rabbit polyclonal antibodies to GAPDH (SAB2701826, 1:10,000), NF-κB p65 (SAB4301496, 1:1,000), VCAM-1 (ab134047, 1:5,000), and diluted MMP2/MMP9 (AV20016/AV33090). All antibodies were purchased from Sigma-Aldrich (St. Louis, MO, USA). Subsequently, the membrane was washed with 0.1% Tris-buffered saline with Tween 20 (TBST) for 10 min, followed by incubation with the secondary antibody, rabbit antibody (ab6721, 1:20,000; Abcam, Cambridge, MA, USA), for 1 h. The membrane was washed with 0.1% TBST for 10 min and developed using the developer solution (P0020; Beyotime, Shanghai, China) under dark conditions. GAPDH served as an internal control, and the Bio-Rad gel imaging system was used to obtain the images. The gray values of experimental protein expression were determined using ImageJ software.

Dual-Luciferase Reporter Gene Assay

Based on the predicted binding sites, the synthetic IL-1β and IL-6 mRNA 3′ UTR fragments were inserted into the plasmid pmirGLO (E1330; Promega, Madison, WI, USA) luciferase vector, respectively. The complementary sequence of the seed sequence with the binding site mutated was designed based on the IL-1β- and IL-6-WT fragments and was inserted into the reporter plasmid. The correctly sequenced luciferase reporter plasmid (IL-1β-WT, IL-1β-mut, IL-6-WT, or IL-6-mut) was cotransfected with miR-340-5p into HEK239T cells, respectively, and luciferase activity was measured using a dual-luciferase assay kit (E1910; Promega, Madison, WI, USA). Luminance was detected with the use of Promega’s GloMax 20/20 Luminometer (E5311; Shanxi Zhongmei Biotechnology, Xi’an, Shanxi, China).

Cell Treatment

Human PASMCs and HEK293T cells were purchased from American Type Culture Collection (ATCC) (https://www.atcc.org/). Human PASMCs were cultured in Smooth Muscle Cell Growth Medium-2 (SmGM-2; S00725; Gibco-BRL/Invitrogen, Carlsbad, CA, USA) containing 5% fetal bovine serum (FBS). HEK293T cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% FBS (10100147; Gibco-BRL/Invitrogen, Carlsbad, CA, USA) supplemented with 100 units penicillin/streptomycin (15140122; Gibco-BRL/Invitrogen, Carlsbad, CA, USA) at 37°C and 5% CO2. PASMCs were transfected with miR-340-5p mimic or inhibitor, overexpressed IL-6 or IL-1β plasmids, and their corresponding negative controls (mimic NC, inhibitor NC). The vectors and plasmids used were based on pSilencer 4.1-cytomegalovirus (CMV) neo vector or pEGFP-4.1N and were constructed by Shanghai Sangon Biotech (Shanghai, China). A total of 1 × 10 6 PASMCs were transfected with 50 nM vectors or plasmids (30 nM; Thermo Fisher Scientific, Rockford, IL, USA) using 1 mL Lipofectamine 2000 reagent (11668019; Invitrogen, Carlsbad, CA, USA), according to the instructions, and incubated at 37°C for 6 h. Afterward, the original culture medium was replaced with complete culture medium for a 24- to 48-h incubation.

ELISA

Following deep anesthesia in rats, blood was obtained from the ocular venous plexus and allowed to stand at 4°C for 1 h. This was followed by centrifugation at 700 rpm, and the supernatant was collected for detection. The IL-6 and IL-1β levels in the clinical plasma samples, rat peripheral blood, and culture supernatant of PASMCs were measured by the reference to the instructions of rat IL-6 and IL-1β ELISA kits (ab234570 and ab100767, respectively; Abcam, Cambridge, UK). The value in the microplate at 450 nm was recorded and analyzed using an Eon spectrophotometer (BioTek Instruments, Winooski, VT, USA). The experiment was conducted in triplicate independently.

CCK-8 Assay

Cell viability was detected based on the instructions provided on the CCK-8 kit (C0037; Beyotime Biotechnology, Shanghai, China). Briefly, 100 μL of 2,000 cells per well was incubated with 10 μL of CCK-8 solution in an incubator for 2 h. Next, the absorbance was measured at 450 nm using an Eon spectrophotometer (BioTek Instruments, Winooski, VT, USA). Subsequently, the absorbance was determined at 24 h, 48 h, 72 h, and 96 h, according to the aforementioned methods. The data were then recorded, and a growth curve was plotted. The experiment was conducted in triplicate independently.

EdU Assay

Cell proliferation in PASMCs was assessed, according to the EdU cell proliferation assay kit (CA1170; Beijing Solarbio Science & Technology, Beijing, China). Each well of cells was incubated with 100 μL of EdU medium (50 μM) for 2 h and fixed with 50 μL cell fixative for 30 min. Next, the cells in each well were added with 50 μL of glycine (2 mg/mL), and incubation was carried out for 5 min. Subsequently, the cells were incubated with 100 μL of phosphate-buffered saline (PBS) containing 0.5% Triton X-100 for 10 min. An amount of 100 μL of 1 × Apollo staining reaction solution was added under dark conditions for 30 min. Following this, the cells were washed with 100 μL penetrant and added with 100 μL methanol each time. Reagent F was diluted with deionized water at a ratio of 1:100 to prepare an appropriate amount of 1 × Hoechst 33342 reaction solution. The cells were then added with 100 μL of 1 × Hoechst 33342 reaction solution and incubated under dark conditions for 30 min. The cells were immediately observed under a microscope after staining or preserved at 4°C with the avoidance of light. The experiment was conducted in triplicate independently.

Flow Cytometry

PASMCs at logarithmic growth phase were inoculated in the 100-mm culture dish at a density of 1 × 106 cells/mL and cultured in 5% CO2 at 37°C. After 36-48 h, the cell density was adjusted to 1 × 106 cells/mL, fixed in 0.5 mL of 70% ethanol (precooled to −20°C overnight), and centrifuged at 4,000 rpm for 2 min. The cell pellet was resuspended in 0.5 mL PBS containing 0.25% Triton X-100, followed by incubation on ice for 15 min and centrifugation at 4,000 rpm for 2 min. The cells were resuspended in 0.5 mL of PBS containing 10 μg/mL RNase A and 20 μg/mL propidium iodide (PI) (P4170; Sigma, St. Louis, MO, USA). Subsequently, the cells were transferred to a fluorescent-activated cell sorter (FACS) tube and incubated under dark conditions for 30 min. The cells were filtered through 300 μm nylon meshes and transferred into Eppendorf (EP) tubes containing PBS and labeled. The cell-cycle analysis was performed with the use of the FACSAria III system (Becton Dickinson, Franklin Lakes, NJ, USA).

Transwell Assay

Cell migration was assessed using a 24-well Transwell plate (Corning, Corning, NY, USA). The cells were added to the apical chamber, and resuspension was carried out with serum-free medium. The serum-supplemented medium was added to the basolateral chamber. After 24 h, the apical chamber was wiped off for the removal of the nonmigrated cells. The migrated cells on the lower side of the membrane were fixed in 100% methanol for 10 min, air dried, and then stained with 0.1% crystal violet for 10 min. The migratory cells on the bottom of the gel were observed under a microscope (Leica, Wetzlar, Germany) and quantified.

Establishment of Rat Models of APE-PAH

A dose of miR-340-5p-antagomir or miR-340-5p-agomir was injected from the tail vein of the rats before and after embolization. The rats were assigned into the APE-PAH, miR-340-5p-agomir, and miR-340-5p-antagomir groups. The procedure can be briefly described as follows: 12.5 μg of nucleic acid was diluted to 1 μg/μL with endotoxin-free pure water, then added with 12.5 μL of water, and brought to a final volume of 50 μL with 25 μL of 10% glucose solution (w/v). Next, 25 μL of Entranster in vivo transfection reagent (18668-11-1; Engreen, Beijing, China) was diluted and thoroughly mixed with 25 μL of 10% glucose solution and brought to a final volume 50 μL. The diluted transfection reagent was mixed with the diluted nucleic acid solution and allowed to stand for 15 min. The mixture (100 μg nucleic acid and 50 μL transfection reagent) was then injected into each rat at the distal end of ⅓ of the tail vein. Male healthy Sprague Dawley (SD) rats, aged 6–8 weeks, weighing 270–330 g, were selected (Shanghai Jiesijie Laboratory Animal, Shanghai, China) and assigned into different groups with 9 rats per group. All animals were provided with free access to food and water. The rats were anesthetized with urethane (1 g/kg intraperitoneally [i.p.]), with their trachea cannulated with polyethylene tubing and attached to an animal ventilator (60 breaths per minute), and an electrocardiogram was recorded. The rats were heparinized with 500 U heparin and subjected to central thoracotomy. Blood was taken from the right ventricle (7 mL) and mixed with 7 mL of normal saline containing 1.5% serum albumin. The cannula was inserted into the pulmonary artery through the right ventricle. Partial occlusion was performed by placing ligatures around the trunk of the pulmonary artery. The lungs were perfused with a peristaltic pump (Incibras, Sao Paulo, Brazil) (9 mL/min). The pulmonary venous effluent was transferred to the reservoir with the use of the left atrial cannula. The left ventricle was fixed at the apex with a ligature, and the perfusate mixture was not allowed to flow into the ventricle by placing a ligature over the atrioventricular junction. The perfusate mixture was maintained at 37°C using a heat exchanger. mPAP was measured from the lateral arm of the inflow cannula, where the pressure sensor (Cobe, Arvada, CO, USA) was zeroed in at the level of the pulmonary artery cannula. The reagent was equilibrated for 20 min prior to the experiment. Blood from the venous plexus of the rat was obtained for ELISA, and the pulmonary artery tissues were frozen in liquid nitrogen and stored at −70°C following dissection.

TUNEL

The rat pulmonary artery tissues were excised, fixed, dehydrated, paraffin embedded, dewaxed, hydrated, and antigen repaired. The TUNEL assay solution was prepared, according to the instructions of the one-step TUNEL apoptosis detection kit (C1088; Shanghai Beyotime Biotechnology, Shanghai, China). The sections were covered with 50 μL of TUNEL test solution at 37°C for 30–60 min under dark conditions. Subsequently, peroxidase (POD)-conjugated fluorescent antibody was added to the sections at 37°C for 30 min. The sections were then developed by diaminobenzidine (DAB), stained with hematoxylin, dehydrated, cleared, and sealed. The representative fields of view were selected under the microscope to observe the apoptosis of PASMCs.

H&E Staining

Pulmonary artery tissues were fixed, dehydrated, paraffin embedded, and sliced for dewaxing. The dewaxed sections were soaked in hematoxylin solution for 20 min and rinsed with 0.5% hydrochloric acid solution for 10 to 30 s to terminate the staining. The sections turned blue when washed with tap water, followed by counterstaining with 0.5% eosin alcohol solution for 2 min and rinsed with 95% ethanol to terminate the staining. The sections were dried in an oven at 57°C; then soaked twice in absolute ethanol and xylene, respectively (5 min each time); and sealed with neutral gum. The structure of pulmonary vascular tissue was observed under a light microscope.

Statistical Analysis

All data were processed using SPSS 21.0 statistical software (IBM, Armonk, NY, USA). The measurement data were expressed as mean ± standard deviation. The experiment was repeated three times. Unpaired t test was used for the comparison between two groups, and comparisons among multiple groups were analyzed by one-way analysis of variance (ANOVA) with Tukey’s post hoc test. Data correlation between the two groups was analyzed by Pearson correlation. The enumeration data were expressed as a percentage. p < 0.05 was statistically significant.

Author Contributions

M.O. and C.Z. participated in the conception and design of the study and designed the experiments. J.C. and S.Z. performed the analysis and interpretation of data. S.C. and J.T. contributed to drafting the article. All authors have read and approved the final submitted manuscript.

Conflicts of Interest

The authors declare no competing interests.
  42 in total

1.  Plexiform vasculopathy of severe pulmonary arterial hypertension and microRNA expression.

Authors:  Clemens L Bockmeyer; Lavinia Maegel; Sabina Janciauskiene; Johanna Rische; Ulrich Lehmann; Ulrich A Maus; Nils Nickel; Axel Haverich; Marius M Hoeper; Heiko A Golpon; Hans Kreipe; Florian Laenger; Danny Jonigk
Journal:  J Heart Lung Transplant       Date:  2012-04-24       Impact factor: 10.247

2.  Survival in patients with idiopathic, familial, and anorexigen-associated pulmonary arterial hypertension in the modern management era.

Authors:  Marc Humbert; Olivier Sitbon; Ari Chaouat; Michèle Bertocchi; Gilbert Habib; Virginie Gressin; Azzedine Yaïci; Emmanuel Weitzenblum; Jean-François Cordier; François Chabot; Claire Dromer; Christophe Pison; Martine Reynaud-Gaubert; Alain Haloun; Marcel Laurent; Eric Hachulla; Vincent Cottin; Bruno Degano; Xavier Jaïs; David Montani; Rogério Souza; Gérald Simonneau
Journal:  Circulation       Date:  2010-06-28       Impact factor: 29.690

3.  PDCD4 suppresses proliferation, migration, and invasion of endometrial cells by inhibiting autophagy and NF-κB/MMP2/MMP9 signal pathway.

Authors:  Yue Li; Xiaoyan Wang; Xishuang Wang; Lu Wan; Yanping Liu; Yongyu Shi; Lining Zhang; Zhenghui Fang; Zengtao Wei
Journal:  Biol Reprod       Date:  2018-08-01       Impact factor: 4.285

4.  microRNA-340-5p Functions Downstream of Cardiotrophin-1 to Regulate Cardiac Eccentric Hypertrophy and Heart Failure via Target Gene Dystrophin.

Authors:  Jian Zhou; Jie Gao; Xiaoya Zhang; Yan Liu; Song Gu; Xitao Zhang; Xiangguang An; Jun Yan; Yue Xin; Pixiong Su
Journal:  Int Heart J       Date:  2015-06-18       Impact factor: 1.862

5.  Inhibition of interleukin-1β-induced matrix metalloproteinase expression in human corneal fibroblasts by tranilast.

Authors:  Ye Liu; Dan Xu; Jing Li; Yang Liu
Journal:  Curr Eye Res       Date:  2014-03-03       Impact factor: 2.424

6.  NF-κB pathway is involved in CRP-induced effects on pulmonary arterial endothelial cells in chronic thromboembolic pulmonary hypertension.

Authors:  Marijke Wynants; Leanda Vengethasamy; Alicja Ronisz; Bart Meyns; Marion Delcroix; Rozenn Quarck
Journal:  Am J Physiol Lung Cell Mol Physiol       Date:  2013-10-04       Impact factor: 5.464

Review 7.  Vascular remodeling process in pulmonary arterial hypertension, with focus on miR-204 and miR-126 (2013 Grover Conference series).

Authors:  François Potus; Colin Graydon; Steeve Provencher; Sébastien Bonnet
Journal:  Pulm Circ       Date:  2014-06       Impact factor: 3.017

8.  Circulating microRNAs as Biomarkers in Cardiovascular Diseases.

Authors:  Salvatore De Rosa; Ciro Indolfi
Journal:  Exp Suppl       Date:  2015

9.  Regulation and function of miR-214 in pulmonary arterial hypertension.

Authors:  Hannah C Stevens; Lin Deng; Jennifer S Grant; Karine Pinel; Matthew Thomas; Nicholas W Morrell; Margaret R MacLean; Andrew H Baker; Laura Denby
Journal:  Pulm Circ       Date:  2016-03       Impact factor: 3.017

10.  NF-kappaB-dependent microRNA-425 upregulation promotes gastric cancer cell growth by targeting PTEN upon IL-1β induction.

Authors:  Jun Ma; Jun Liu; Zhiming Wang; Xixi Gu; Yue Fan; Wen Zhang; Lili Xu; Jianjun Zhang; Dingfang Cai
Journal:  Mol Cancer       Date:  2014-02-26       Impact factor: 27.401

View more
  9 in total

1.  Notopterol Attenuates Monocrotaline-Induced Pulmonary Arterial Hypertension in Rat.

Authors:  Lin Huang; Huayang Li; Suiqing Huang; Shunjun Wang; Quan Liu; Li Luo; Shuangjiao Gan; Guangguo Fu; PeiYun Zou; Guangxian Chen; Zhongkai Wu
Journal:  Front Cardiovasc Med       Date:  2022-06-03

2.  Human pulmonary artery smooth muscle cell dysfunction is regulated by miR-509-5p in hypoxic environment.

Authors:  Jingjing Wang; Rong Jiang; Yanlin Tan; Kuan Cheng
Journal:  Cell Cycle       Date:  2022-03-04       Impact factor: 5.173

3.  Overexpression of microRNA-340-5p Ameliorates Inflammatory Response and Intracellular Survival of Mycobacterium Tuberculosis in Alveolar Type II Cells.

Authors:  Bailing Zhang; Honglang Li; Jieling Zhang; Yaping Hang; Yi Xu
Journal:  Infect Drug Resist       Date:  2021-04-21       Impact factor: 4.003

Review 4.  Epigenetic Regulation of Pulmonary Arterial Hypertension-Induced Vascular and Right Ventricular Remodeling: New Opportunities?

Authors:  Jordy M M Kocken; Paula A da Costa Martins
Journal:  Int J Mol Sci       Date:  2020-11-24       Impact factor: 5.923

5.  MiR-34a-3p suppresses pulmonary vascular proliferation in acute pulmonary embolism rat by targeting DUSP1.

Authors:  Yang Li; Jinyan Shao; Jianfeng Song; Shuili Yu; Jiqin Wang; Keyu Sun
Journal:  Biosci Rep       Date:  2022-01-28       Impact factor: 3.840

Review 6.  The Function of microRNAs in Pulmonary Embolism: Review and Research Outlook.

Authors:  Mingyao Luo; Mingyuan Du; Chang Shu; Sheng Liu; Jiehua Li; Lei Zhang; Xin Li
Journal:  Front Pharmacol       Date:  2021-10-19       Impact factor: 5.810

7.  Text Mining-Based Drug Discovery for Connective Tissue Disease-Associated Pulmonary Arterial Hypertension.

Authors:  Jiang-Shan Tan; Song Hu; Ting-Ting Guo; Lu Hua; Xiao-Jian Wang
Journal:  Front Pharmacol       Date:  2022-03-18       Impact factor: 5.810

Review 8.  Circulating MicroRNAs for Diagnosis of Acute Pulmonary Embolism: Still a Long Way to Go.

Authors:  Matteo Sobrero; Fabrizio Montecucco; Federico Carbone
Journal:  Biomed Res Int       Date:  2022-01-10       Impact factor: 3.411

9.  The MFF-SIRT1/3 axis, regulated by miR-340-5p, restores mitochondrial homeostasis of hypoxia-induced pulmonary artery smooth muscle cells.

Authors:  Chun-Xia Huang; Zhi-Xin Jiang; Da-Yong Du; Zhi-Min Zhang; Yang Liu; Yun-Tian Li
Journal:  Lab Invest       Date:  2022-01-18       Impact factor: 5.502

  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.