Dexmedetomidine alleviates LPS‑induced acute lung injury via regulation of the p38/HO‑1 pathway.

Acute lung injury (ALI) is a common critical illness in clinical anesthesia and the intensive care unit that can cause acute hypoxic respiratory insufficiency. Despite various therapeutic regimes having been investigated, there is currently no effective pharmacotherapy available to treat ALI. Previous studies have reported that the NOD‑like receptor protein 3 (NLRP3) signaling pathway plays an important role in the inflammatory response and is involved in the pathogenesis of ALI. Moreover, dexmedetomidine (Dex), an α2‑adrenergic receptor activating agent, has been routinely used as an adjuvant therapy in treating inflammatory diseases, including ALI. However, the precise pathological mechanisms of Dex in ALI remain to be elucidated. Thus, the present study aimed to investigate the effects of the p38/heme oxygenase 1 (HO‑1) signaling pathways in the pathological mechanisms of Dex in ALI. Newborn male Sprague‑Dawley rats (n=48) were randomly divided into four groups (n=12 each), and an intravenous injection of lipopolysaccharide (LPS) was used to successfully induce the ALI model, with increased pulmonary damage, cell apoptosis, interleukin‑1β (IL‑1β) secretion and edema fluid in lungs. Moreover, the mRNA and protein expression levels of NLRP3 were significantly upregulated, while that of HO‑1 were downregulated by LPS treatment. Furthermore, the levels of phosphorylated p38 were also upregulated in ALI rats. It was demonstrated that Dex administration significantly alleviated LPS‑induced ALI, downregulated the secretion of IL‑1β, decreased the expression of NLRP3, inhibited the phospho‑activation of p38 and increased HO‑1 expression. In addition, pharmacological inhibition of p38 using the inhibitor SB20380 further enhanced the effect of Dex. Collectively, these preliminarily results identified the effects of Dex intervention on the pathogenesis of ALI via the regulation of p38/HO‑1 signaling pathways, which impacted the inflammatory effects, thus providing a theoretical basis and novel evidence for the development of new targets for clinical treatment of ALI.

Introduction

Acute lung injury (ALI) is a common critical illness in clinical anesthesia and the intensive care unit (ICU) (1–3). ALI refers to the injury of pulmonary capillary endothelial cells and alveolar epithelial cells during non-cardiac diseases, such as severe infection, shock, trauma and burns, and can cause diffuse pulmonary interstitial and alveolar edema, which can lead to acute hypoxic respiratory insufficiency or failure (4). Moreover, the development of ALI to the severe stages can result in acute respiratory distress syndrome (ARDS) (5,6); ALI/ARDS seriously threaten the lives of patients, affecting quality of life and increasing the economic burden. Compared with older children and adults, infants have smaller airways, increased incomplete alveolar vascular bed development, improved chest wall elasticity and lower functional residual capacity, and thus are a high-risk group of ALI/ARDS (7). Children have high chest wall compliance, low rib support to the lungs, and difficulty in maintaining negative intrathoracic pressure. As a result, the residual volume of lung function is reduced, which is a disadvantageous factor in acute lung injury. Furthermore, the overall mortality rate of ALI in pediatrics is 18–27%, and the mortality rate of ARDS is 29–50% (8,9). Any response of the lung to the injurious stimulus may be mediated by several pathways, depending on the cause of injury. For instance, bacterial antigens trigger the inflammatory response by activating Toll-like receptors (TLR) (10), and chemical injury may induce damage to cell membrane and oxidative stress, leading to the activation of intracellular kinases (11,12). Although the development of intensive care medicine has made progress worldwide, the understanding and treatment status of ALI/ARDS remains unsatisfactory. Therefore, it is of great clinical significance to elucidate the pathogenesis of ALI/ARDS and develop targeted drugs to effectively prevent or treat the disease. As an α2-adrenergic receptor agonist, dexmedetomidine (Dex) has an analgesic effect and is widely used for sedation and anesthesia in patients with ICU ventilator support; however, there are few studies related to the progression of Dex and ALI. Our previous clinical study reported that Dex can reduce the occurrence of delirium during postoperative recovery by reducing the level of inflammatory response (13); however, the detailed underlying signaling mechanisms remain to be elucidated.

The NOD-like receptor protein 3 (NLRP3) signaling pathway plays an important role in the inflammatory response and is involved in the pathogenesis of ALI/ARDS (14–17). Moreover, NLRP3 is composed of NLRs and caspase-1 and is widely present in T cells, B cells, monocytes, macrophages, dendritic cells and granulocytes (18,19). In the absence of an activating substance, the leucine-rich repeat domain of NLRP3 binds to the NACHT domain, inhibiting self-oligomerization and destabilizing the inactive state (20,21). There are numerous substances that activate NLRP3, including lipopolysaccharide (LPS) bacterial toxin, extracellular ATP or necrotic cellular components (22). Furthermore, the activated NLRP3 inflammasome provides a platform for cytokines, including interleukin (IL)-1, IL-6, IL-18 and IL-33, which are subsequently converted into activated IL-1β, IL-6, IL-18 and IL-33 states (23,24).

Heme oxygenase 1 (HO-1) plays a key role in regulating organ protection from ischemia-reperfusion injury (25). In addition, the nuclear factor erythroid 2-related factor 2 (Nrf2)/HO-1 signaling pathway plays an important role in preventing the occurrence of ALI/ARDS, and activation of Nrf2 reduces the severity of ALI/ARDS (26). The activation of the Nrf2/HO-1 signaling pathway also inhibits the activation of NLRP3 inflammasome, thus reducing IL-1β expression and exerting anti-inflammatory and cytoprotective effects (27,28). p38 kinase, which is a member of the mitogen-activated protein kinase (MAPK) family, plays a central role in inflammatory responses in a variety of disease models, such as Parkinson's disease, cancer and inflammatory disease (29–31), and has been the subject of basic research and drug discovery (32). Furthermore, inhibition of p38 activation has been revealed to suppress LPS-induced inflammation in different situations, such as in LPS-induced inflammation in IPEC-J2 cells, bronchial epithelial cells, macrophages and rats (29,33–35).

In the present study, it was hypothesized that Dex may activate the HO-1 signaling pathway by suppressing p38 to mediate the anti-inflammatory effect in LPS induced ALI. Therefore, the activity of NLRP3 may be inhibited by Dex, which could reduce IL-1β secretion and the level of inflammatory response in Sprague-Dawley rats with ALI. Therefore, the present study may provide a theoretical basis and novel evidence for the discovery of new targets for clinical treatment of ALI.

Materials and methods

Animal model of ALI and experimental groups

Newborn male specific pathogen-free Sprague-Dawley rats (age, 7 days; weight, 250–300 g) were provided by Experimental Animal Center of Anhui Medical University (no. SCXK-2017-023). Rats were housed in standard laboratory cages under standard housing conditions of 12 h light/12 h dark cycles at a temperature of 22±2°C, along with free access to food and water, and all animal experiments were performed in accordance with the international standards on animal welfare, as well as being compliant with the committee of Anhui Medical University.

The rats (n=48) were randomly divided into four groups (n=12 rats each) (36,37): i) Saline control group; ii) LPS (cat. no. L2630-100MG; Sigma Aldrich; Merck KGaA) group; iii) LPS and Dex (cat. no. MB1434-S-100MG; Dalian Meilunbio Biology Technology Co., Ltd.) group; and iv) Dex and SB203580 [cat. no. 5633S; Cell Signaling Technology, Inc. (CST)] group. The rats were anesthetized with an intraperitoneal injection of 40 mg/kg pentobarbital sodium (cat. no. 1063180500; Merck KGaA). The rats were tracheal intubated with a micro-atomizer and the control group was given 300 µl physiological saline, the experimental group was administered LPS (5 mg/kg) in 300 µl physiological saline, which was fully administered via a nebulizer at an oxygen flow-rate of 4 L/min for 25 min. The rats were normally fed without intubation for 30 min after each 6 h intubation. Then, 12 h later, rats were sacrificed by decapitation, bronchoalveolar lavage and lung tissue were assessed, after which they underwent thoracotomy. The right bronchus was ligated, and the right lung tissue specimen was isolated for preparation for subsequent experiments.

Morphological analysis of the lungs

The fresh lung samples were weighed for wet mass after harvesting or dried overnight at 75°C for dry mass measurement (38). Haematoxylin and eosin (H&E) staining was used to observe histological pulmonary structures and the condition of inflammation following exposure to LPS. After harvesting at the assigned time points, the lungs were imaged and fixed in 4% paraformaldehyde at room temperature for 12 h, dehydrated, embedded in paraffin wax and serially sectioned at 5-µm. The sections were stained with haematoxylin for 20 min and eosin for 15 min at room temperature. The sections were imaged using a fluorescence microscope (Olympus IX50; Olympus Corporation) linked to the NIS-Elements F3.2 software (Nikon Corporation). The airspace volume density was measured by dividing the sum of the airspace area by the total area (39). In total, ≥3 randomly selected images from five samples were assessed per group at the assigned time point.

Immunohistochemistry

Immunostaining was performed on paraffin transverse sections against IL-1β and NLRP3 (40). Transverse sections of rat lungs were fixed by carnoy solution (1:500) at room temperature for 3 h, de-waxed in xylene, rehydrated (100, 90 and 70% ethanol), heated in a microwave at 92–98°C for 15 min for antigen retrieval before exposure to the primary antibody with citrate buffer (pH=6.0) and serially sectioned at 5 µm. Next, the sections were immersed in 3% hydrogen peroxide for 10 min to block endogenous peroxidase. Non-specific immunoreactions were blocked using 5% inactivated goat serum (Gibco) in PBS for 30 min at room temperature. The sections were washed in PBS and incubated with NLRP3 (1:250; cat. no. ab263899; Abcam) and IL-1β (1:200; cat. no. ab9722; Abcam) antibodies overnight with shaking at 4°C. For immunohistochemistry, following extensive washing, the sections were incubated in horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG secondary antibody (1:400; cat. no. E030120; EarthOx Life Sciences) for 2 h at room temperature in a dark box, and were then subsequently stained with 3′3-diaminobenzidine at room temperature for 5 min (Fuzhou Maixin Biotech Co., Ltd.). After immunostaining, the sections were counterstained with haematoxylin at room temperature for 10 min and observed using an IX50 confocal microscope (Olympus Corporation; magnification, ×200).

TUNEL analysis

TUNEL staining was performed using an In Situ Cell Death Detection kit (Roche Diagnostics) according to the manufacturer's instructions. Sections were fixed with 4% paraformaldehyde for 20 min at 20°C. Sections (thickness, 4 µm) were deparaffinized in xylene by heating at 60°C, rehydrated in decreasing concentrations of ethanol (100, 95, 90, 80 and 70%) and heated for antigen retrieval at 37°C. Endogenous peroxidase was blocked in 3% hydrogen peroxide. Then, three different dilutions (1:7, 1:11 and 1:16) of terminal deoxynucleotidyl transferase in reaction buffer (containing a fixed concentration of digoxigenin-labelled nucleotides) were applied to serial sections at 37°C for 1 h before the slides were placed in stop/wash buffer for 10 min. Following intensive washing, a pre-diluted anti-digoxigenin peroxidase-conjugated antibody (1:2; cat. no. 11207733910; Roche Diagnostics) was applied for 30 min at room temperature. For immunofluorescent staining, the sections were incubated with the corresponding Alexa Fluor 488 secondary antibody (1:1,000; cat. no. A-11029; Invitrogen; Thermo Fisher Scientific, Inc.) at room temperature for 2 h in a dark box. All sections were then counterstained with DAPI (1:1,000; Invitrogen; Thermo Fisher Scientific, Inc.) at room temperature for 30 min. Sections were mounted with Prolong Gold Antifade mounting media containing DAPI (Invitrogen; Thermo Fisher Scientific, Inc.). Stained cells were observed in five randomly selected fields of view. The presence of TUNEL+ cells was determined using Image Analysis Software V.2.4.2 (Olympus Corporation). The percentage of TUNEL+ cells relative to the total cells in the same area between the control and experimental groups was evaluated (n=8 lungs for each group).

Western blotting

Western blotting was performed in accordance with a standard procedure using polyclonal antibodies that specifically recognized phosphorylated (p)-p38, p38, HO-1 and NLRP3. The methods for protein extraction and immunoblotting used in this study have been described previously (40). Protein samples were extracted from lung tissue homogenate using a RIPA buffer (Sigma-Aldrich; Merck KGaA) supplemented with protease and phosphatase inhibitors, and the protein concentrations were quantified using the bicinchoninic acid assay. The extracted protein samples were separated by SDS-PAGE on a 10% gel, and subsequently transferred onto a PVDF membrane (EMD Millipore). The membrane was blocked with 5% non-fat milk at room temperature for 1 h and incubated with antibodies against p38 (1:500; cat. no. 8690; CST), p-p38 (1:500; cat. no. ab4822; Abcam), HO-1 (1:500; cat. no. 82206; CST) and NLRP3 (1:500; cat. no. ab214185; Abcam) in TBS buffer at 4°C overnight. GAPDH was used as a loading control (1:1,000; cat. no. 5174; CST). After incubation with the secondary antibodies at room temperature for 1 h, which were either HRP-conjugated goat anti-rabbit IgG (1:3,000; cat. no. E030120; EarthOx Life Sciences) or HRP-conjugated goat anti-mouse IgG (1:3,000; cat. no. E030110; EarthOx Life Sciences), the blots were developed with the SuperSignal™ West Femto Chemiluminescent Substrate (Thermo Fisher Scientific, Inc.) and Gel Doc™ XR+ System (Bio-Rad Laboratories, Inc.). The intensity of the bands was analyzed using the Quantity One software V.4.6.7 (Bio-Rad Laboratories, Inc.), according to the manufacturer's instructions. The western blotting results are representative of three independent experiments.

ELISA

Briefly, the left lung was lavaged three times with 500 µl saline via tracheal catheter to obtain bronchoalveolar lavage (BAL) fluid. BAL fluid was centrifuged at 4°C at 600 × g for 10 min. The supernatant was stored at −20°C until further examination. The level of secreted IL-1β in BAL fluid was detected using a Rat IL-1β ELISA kit (cat. no. ab100704; Abcam), according to the manufacturer's instructions.

RNA isolation and reverse transcription-quantitative PCR (RT-qPCR)

Total RNA was isolated from fresh rat lung tissue or MLE-12 cells (American Type Culture Collection) stored on ice using the E.Z.N.A® Total RNA kit (Omega Bio-Tek, Inc.), according to the manufacturer's instructions. Total RNA was reverse transcribed into cDNA at 42°C for 15 min and 85°C for 5 sec using the PrimeScript™ RT Reagent kit (Takara Bio, Inc.). Subsequently, qPCR was performed using SYBR® Green qPCR assay (Thermo Fisher Scientific, Inc.). All the specific primers used are described in Table I (41–43). qPCR was performed in the Bio-Rad S1000TM thermocycler (Bio-Rad Laboratories, Inc.), with the following qPCR thermocycling conditions: Initial denaturation at 95°C for a 3 min, followed by 40 PCR cycles (95°C for 5 sec, 60°C for 20 sec and 72°C for 20 sec), using ABI 7000 RT PCR machines. Corresponding relative mRNA expression was calculated by the 2−ΔΔCq method (44) and normalized to β-actin. The qPCR results are representative of three independent experiments.

Table I.

Primers used for reverse transcription-quantitative PCR.

Gene	Primer sequence (5′-3′)
HO-1	F: CGTGCAGAGAATTCTGAGTTC
	R: AGACGCTTTACGTAGTGCTG
p38	F: AGGGCGATGTGACGTTT
	R: CTGGCAGGGTGAAGTTGG
NLRP3	F: GGGACTCAAGCTCCTCTGTG
	R: GAGGCTCTGGTTATGGGTCA
GAPDH	F: AGCCACATCGCTCAGACA
	R: TGGACTCCACGACGTACT

F, forward; R, reverse; HO-1, heme oxygenase 1; NLRP3, NOD-like receptor protein 3.

Data analysis

Data analysis and the construction of statistical graphs were performed using GraphPad Prism 5 software package (GraphPad Software, Inc.). Data are presented as the mean ± SEM from ≥3 independent experiments. ANOVA (followed by Tukey's post hoc test) or an unpaired Student's t-test were used to analyze whether there were any significant differences between the control and treatment groups. P<0.05 was considered to indicate a statistically significant difference.

Results

LPS exposure induces ALI

The histological characteristics of the H&E stained transverse sections of the lungs were compared between the control and LPS groups (Fig. 1A). The integrity of the structure of alveoli before LPS exposure was identified by examination of pathological tissue sections. After LPS exposure, diffuse damage was observed in the alveoli, alveolar sacs, alveolar tubes, alveolar septa and bronchi. Moreover, there were numerous inflammatory cells in the alveolar septa of the LPS group (Fig. 1A). Furthermore, LPS treatment significantly increased the number of TUNEL+ pulmonary cells in lungs of the LPS group compared with the control (Fig. 1B and C), indicating that LPS promoted apoptosis in the pulmonary cells. IL-1β plays an important role in the body's inflammatory response and is involved in the pathogenesis of ALI. With collected rat bronchoalveolar lavage, using ELISA kits, it was demonstrated that the secretion levels of IL-1β in the bronchoalveolar lavage fluid were significantly upregulated upon LPS exposure (Fig. 1D).

Figure 1.

LPS exposure induces ALI. (A) Haematoxylin and eosin staining was performed on transverse sections of the rat lungs in the control and LPS-treated groups. (B) TUNEL staining was performed on transverse sections of the rat lungs from the control and LPS-treated groups. (C) TUNEL+ cells/total cells on lung tissue between the control group and LPS-treated group. (D) ELISA results of the secretion of IL-1β in the lungs of the control or LPS-treated rats. (E) Wet-to-dry weight ratio. Scale bar, 100 µm. *P<0.05 vs. control. LSP, lipopolysaccharide; ALI, acute lung injury; IL, interleukin.

In addition, the quantity of the wet lung and dry lung in the control group and LPS group was weighed. It was indicated that the wet-to-dry weight ratio of the LPS group was significantly higher compared with the control group, which suggested that a large amount of edema fluid was accumulated in the alveolar and interstitial lungs in the LPS group (Fig. 1E). Collectively, the results demonstrated the successful establishment of the ALI model in rats and that LPS induced severe injury in the lungs.

p38/HO-1 signaling pathway is involved in the regulation of NLRP3

p38 plays a central role in the inflammatory response, and to further assess the possible underlying mechanisms of the LPS-induced ALI in rat lungs, the expression levels of inflammatory factors were measured by immunohistochemistry, RT-qPCR and western blotting. NLRP3 inflammasome is a critical component of the innate immune system, and is upregulated when the lungs are injured. The immunohistochemistry (Fig. 2A and B), western blotting (Fig. 2C and D) and RT-qPCR (Fig. 2E) results suggested that the mRNA and protein expression levels of NLRP3 were significantly upregulated upon LPS exposure in lungs. Moreover, western blotting results demonstrated that LPS induced the upregulation of p-p38 expression (Fig. 2C and D). However, there were no significant differences (P>0.05) in the expression of p38 between the two groups (Fig. 2C and D).

Figure 2.

p38/HO-1 signaling pathway is involved in the regulation of LPS-induced ALI. (A and B) NLRP3 immunohistochemistry staining was performed on the transverse sections of rat lungs from the control and LPS-treated groups. (C and D) Western blotting results of the relative protein expression levels of NLRP3, HO-1, p-p38 and p38 in rat lungs from the control and LPS-treated group. (E) Reverse transcription-quantitative PCR results comparing the relative mRNA expression of NLRP3, HO-1 and p38 in the lungs of the control or LPS-treated rats. Scale bar, 100 µm. *P<0.05 vs. control. n.s., no significant differences; p-, phosphorylated; NLRP3, NOD-like receptor protein 3; HO-1, Heme oxygenase 1; LSP, lipopolysaccharide; ALI, acute lung injury.

HO-1 is reported to be a downstream effector of p38, and activation of p38 suppresses the anti-inflammatory effect of HO-1 (45). Thus, the present study determined the expression of HO-1 in ALI, and it was found that both the mRNA and protein expression levels of HO-1 were significantly downregulated after LPS exposure in lungs (Fig. 2C-E). Thus, LPS exposure induced the activation of p38, the downregulation of HO-1 and the upregulation of NLRP3.

Dex and pharmacological inhibition of p38 co-operate to suppress ALI

Our previous results revealed that Dex can reduce the level of inflammatory response (13); however, the role of Dex in ALI remains to be elucidated. Thus, Dex administration was given to LPS-induced ALI model rats. Moreover, inflammation and morphological changes were examined by H&E staining, and the integrity of alveoli structure before LPS exposure was observed by examination of pathologic tissue sections (Fig. 3A). Furthermore, diffuse damage was observed in the alveoli, alveolar sacs, alveolar tubes, alveolar septa and bronchi after LPS exposure, and there was considerable lymphocyte infiltration in the pulmonary interstitium (Fig. 3A). However, the addition of Dex reversed LPS-induced inflammation and morphological damage in the lungs (Fig. 3A). It was demonstrated that LPS induced p38 activation (Fig. 2), and thus it was further investigated whether inhibition of p38 attenuated ALI, using SB203580 (p38 MAPK inhibitor) in the group exposed to LPS and Dex. Compared with the group exposed to Dex and LPS, the occurrence of inflammation and morphological damage was further inhibited by suppressing p38 signaling pathway with SB203580 (Fig. 3A). Furthermore, Dex administration in the LPS group reversed LPS-induced upregulation of NLRP3 expression in the lungs, and this effect could be further enhanced by SB203580 (Fig. 3B and C). Bronchoalveolar lavage was collected and the concentration of inflammatory factor IL-1β was measured by ELISA, the data showed the secretion of IL-1β demonstrated the same trend as NLRP3 expression (Fig. 3D). Therefore, it was speculated that Dex inhibited ALI, which was further enhanced by p38 suppression.

Figure 3.

Dex and p38 inhibition alleviate ALI. (A) H&E staining was performed on transverse sections of the rat lungs from the control group, LPS-treated group, LPS + Dex-treated group, and the LPS + Dex + SB203580-treated group. (B and C) NLRP3 immunohistochemistry staining was performed on the transverse sections of rat lungs from the control group, LPS-treated groups, LPS + Dex-treated group, and the LPS + Dex + SB203580-treated group. (D) IL-1β immunolabeling intensities (IL-1β+ cells) in lung tissue from the control group, LPS-treated groups, LPS + Dex-treated group, and the LPS + Dex + SB203580-treated group. Scale bar, 50 µm. *P<0.05 vs. control; #P<0.05 vs. LPS + Dex group. Dex, dexmedetomidine; IL, interleukin; LSP, lipopolysaccharide; ALI, acute lung injury; H&E, haematoxylin and eosin.

Dex alleviates ALI via inhibition of the p38 signaling pathway

As pharmacological inhibition of p38 enhanced the effect of Dex in ALI, whether Dex function upstream or parallel to the p38 pathway was assessed by detecting its mRNA and protein expression levels by RT-qPCR and western blotting, respectively. Compared with the control group, the phosphorylation level of p38 was significantly suppressed by Dex, while addition of SB203580 further enhanced this effect. Moreover, the mRNA and protein expression levels of NLRP3 were suppressed by Dex, and further reduced by SB203580 treatment (Fig. 4A and C). The LPS-induced decrease in HO-1 expression was reversed by Dex, and the addition of SB203580 further increased HO-1 expression (Fig. 4A-C). Collectively, the results indicated that Dex alleviated ALI by suppressing p38 activation and inducing HO-1 expression.

Figure 4.

Dex alleviates ALI via inhibition of p38. (A and B) Western blotting results of the relative protein expression levels of NLRP3, HO-1, p-p38 and p38 in rat lungs from the control, LPS-treated group, LPS + Dex-treated group, and the LPS + Dex + SB203580-treated group. (C) Reverse transcription-quantitative PCR results of the relative mRNA expression levels of NLRP3, HO-1 and p38. (D) Diagram of the proposed signaling pathway. *P<0.05 vs. control; #P<0.05 vs. LPS group; &P<0.05 vs. LPS + Dex group. p-, phosphorylated; NLRP3, NOD-like receptor protein 3; HO-1, Heme oxygenase 1; LSP, lipopolysaccharide; ALI, acute lung injury.

Discussion

ALI is a serious complication of critical illness and clinical anesthesia, however, the underlying mechanisms remain to be elucidated. The present results suggested that LPS exposure could lead to ALI. Furthermore, it was speculated that LPS activated p38, which subsequently suppressed HO-1 signaling, promoted the expression of NLRP3 and induction of IL-1β, and finally resulted in lung damage. Moreover, it was demonstrated that Dex could prevent ALI by inhibiting p38 activation, rescuing the expression of HO-1 signaling and decreasing NLRP3; these signal pathway interactions are summarized in a schematic diagram (Fig. 4D).

It has been reported that systemic diseases caused by various pathogenic factors in the lungs and outside the lungs are the underlying causes of ALI/ARDS in pediatrics. Moreover, the incidence of ALI/ARDS in sepsis is 25–50%, which remains the main cause of serious complications and mortality (46–48). In addition, a large number of clinical blood transfusions, multiple trauma and aspiration can also cause ALI/ARDS, with an incidence rate of 40, 11–25 and 9%, respectively (49,50). Sepsis can induce inflammatory cell activation, which leads to increased permeability of pulmonary capillary endothelial cells and alveolar epithelium, and a large amount of edema fluid accumulation in the alveolar and interstitial lungs (51,52). Moreover, a variety of inflammatory cells, mainly neutrophils, adhere to the surface of damaged vascular endothelial cells and further migrate to the interstitial and alveolar spaces (53). During this process, a large number of pro-inflammatory mediators, such as IL-1β, IL-6, peroxide, leukotrienes and proteases, are released, which are involved in neutrophil-mediated lung injury, alveolar degeneration, necrosis, apoptosis and alveolar collapse, causing lung dysfunction (54–56).

The Nrf2/HO-1 signaling pathway plays an important role in preventing the occurrence of ALI/ARDS, and activation of Nrf2 prevents or reduces the severity of ALI/ARDS (26). Furthermore, activated Nrf2 is translocated into the nucleus to regulate the expression of HO-1-related genes. The activated HO-1 gene can inhibit the inflammatory cascade, thus protecting organ function and reducing ALI caused by inflammation (57). Previous studies have also reported that activation of the Nrf2/HO-1 signaling pathway inhibits the activation of NLRP3 inflammasome, thus reducing IL-1β expression and exerting anti-inflammatory and cytoprotective effects (58–60). Furthermore, HO-1 expression attenuates NLRP3 inflammasome activation (61), and multiple HO-1 inducers regulate HO-1 gene expression via ≥1 MAPK subtype signal chains (62). In the MAPK family, p38 signal transduction pathway can modulate the expression of HO-1, however, whether it promotes or inhibits the expression of HO-1 remains controversial. Previous studies have revealed that there is relationship between p38, Nrf2 and HO-1, which is characterized by sequential activation (62–64). Kim et al (65) reported that glycyrrhizin could activate p38, following which the expression of HO-1 increased via Nrf2, which could significantly reduce the secretion of inflammatory factors in sepsis. It has also been demonstrated that p38 can inhibit Nrf2/HO-1 gene expression. Furthermore, inhibition or genetic deficiency of p38 upregulates HO-1 via Nrf2 in monocytic cells (45) and in human hepatoma HepG2 cells (66,67). The present results also suggested that LPS stimulated p38 activation to suppress the expression of HO-1 to induce inflammation.

p38 has attracted increased attention in inflammation, and p38 kinase plays a central role in inflammatory responses (29–31). Moreover, inhibition of p38 activation has been demonstrated to suppress LPS-induced inflammation (29,33–35). The present results indicated that LPS exposure caused severe damage in rat lungs by examination of pathological tissue sections. After LPS exposure, diffuse damage was observed in the alveoli, alveolar sacs, alveolar tubes, alveolar septa and bronchi, and there were a considerable number of inflammatory cells in the alveolar septa of the LPS group. Furthermore, the increase of TUNEL+ pulmonary cells in lungs and secretion levels of IL-1β also indicated that the LPS-induced ALI model was successful. It was also demonstrated that the HO-1 signaling pathway was involved in the regulation of NLRP3 via p38 in ALI. Dex has an analgesic effect and is widely used for sedation and anesthesia in patients on ICU ventilator support (68–70). However, the role of Dex in the progression of ALI is not fully understood. The current results suggested that Dex could inhibit ALI by suppressing p38 activation and activating the HO-1 signaling pathway to inhibit the LPS-induced inflammatory response.

In conclusion, the present study investigated the effect of Dex on decreasing lung inflammation in the neonatal rat LPS-induced ALI model, which may provide a theory for the pathogenesis of septic lung injury in infants and young pediatric patients. Furthermore, the results indicated that Dex functions via the p38/HO-1 and NLRP3/IL-1β signaling pathways, which may be a possible mechanism of Dex intervention in ALI. Thus, the current study provides a theoretical basis for the use of Dex in clinical patients with ALI, providing novel evidence for the discovery of new targets for clinical treatment of ALI.