Literature DB >> 32705162

Knockdown of SNHG16 suppresses the proliferation and induces the apoptosis of leukemia cells via miR‑193a‑5p/CDK8.

Meihua Piao1, Li Zhang2.   

Abstract

Although small nucleolar RNA host gene 16 (SNHG16) is known to exhibit auxo‑action in certain types of tumor, its role in leukemia remains unclear. The present study analyzed the role and mechanisms of action of SNHG16 in leukemia cells in order to identify therapeutic targets for this disease. Reverse transcription‑quantitative polymerase chain reaction (RT‑qPCR) was performed to determine SNHG16 expression in human leukemia cell lines. Using TargetScan 7.2 and dual‑luciferase reporter assay, the target genes of SNHG16 were verified. Following the downregulation of the expression of SNHG16 or its target genes, Cell Counting kit‑8 (CCK‑8) assay was performed to examine the viability of the leukemia cells. In addition, flow cytometry was performed to analyze the cell apoptotic rates, and colony formation assays were used to determine the cell proliferative ability. RT‑qPCR and western blot analysis were used to determine the association between SNHG16 and its target genes. SNHG16 was found to be abnormally highly expressed in acute myeloblastic leukemia cell lines, the knockdown of which weakened the viability of the leukemia cells, suppressed cell proliferation and promoted cell apoptosis. miR‑193a‑5p could bind to SNHG16, and its target gene was CDK8. Moreover, the expression of miR‑193a‑5p increased with the decrease in SNHG16 expression, while the inhibition of miR‑193a‑5p promoted the expression of CDK8. The downregulation of miR‑193a‑5p enhanced the viability of the leukemia cells, accelerated cell cloning and reduced cell apoptosis, which was completely opposite to the effects observed with the silencing of CDK8. The knockdown of SNHG16 suppressed the viability of the leukemia cells, suppressed cell proliferation, and induced cell apoptosis by regulating miR‑193a‑5p/CDK8. Thus, SNHG16 may prove to be a potential therapeutic target for the treatment of leukemia.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 32705162      PMCID: PMC7387099          DOI: 10.3892/ijmm.2020.4671

Source DB:  PubMed          Journal:  Int J Mol Med        ISSN: 1107-3756            Impact factor:   4.101


Introduction

Leukemia, a malignant clonal disease of hematopoietic stem cells, is caused by the enhancement of self-renewal, uncontrolled proliferation, dysdifferentiation and the blocked apoptosis of leukemia cells, resulting in cell developmental stagnation at different stages (1). Although the prognosis of patients with leukemia has improved in the pediatric field, the general 5-year survival rate of patients with leukemia in the disparate age groups remains 40% (2). To date, the specific mechanisms giving rise to the occurrence and development of leukemia have not yet been fully clarified. The disease may be related to genetic, radiation, chemical substances, viral infection and other factors, which can lead to molecular alterations, such as gene mutation and chromosome rearrangements in the body (3,4). Accordingly, previous studies have revealed that the condition of leukemia may be associated with the high heterogeneity of cellular and molecular genetics; thus, chromosomal abnormalities and gene mutations are important prognostic indicators for patients with leukemia (5,6). In recent years, a number of studies have discovered that multiple long-chain non-coding RNAs (lncRNAs) are associated with the occurrence and development of leukemia, which may provide novel markers and targets for the diagnosis and therapy of leukemia (7-9). lncRNAs, which are non-coding RNAs with a length of >200 nucleotides, are located in the nucleus or cytoplasm and lack an open reading frame and thus have no protein coding function (10). Compared with microRNAs (miRNAs or miRs), lncRNAs are still a relatively unknown field in clinical practice. In the past, it was considered that lncRNAs only act as a structure without obvious biological function. Recently, lncRNAs have gradually become one of the research hotspots in leukemia, and have been found to play a crucial role in the process of gene transcription and assist in gene regulation via protein-coding genes (11,12). Although lncRNAs cannot encode proteins, they are involved in gene expression through epigenetics, transcriptional timing and the post-transcriptional regulation of genes, so as to regulate the growth of organisms, the directional differentiation of cells, subcellular structure and distribution, as well as human diseases (13). In disease applications, lncRNAs are associated with the occurrence, development and prognosis of various types of tumors, such as colorectal cancer, breast cancer, hepatocellular carcinoma and lung cancer (14). In addition, lncRNAs are also involved in the proliferation, differentiation and apoptosis of red blood cells, lymphocytes and myelocytes, the abnormal expression of which may lead to the occurrence of a variety of malignant blood diseases, including lymphoma and multiple myeloma (15,16). As a member of the lncRNA family, small nucleolar RNA host gene 16 (SNHG16) has been shown to exert cancer-promoting effects in several types of tumors, such as cervical cancer (17) and bladder cancer (18), whereas its role in leukemia has rarely been reported. Therefore, the present study further explored the expression of SNHG16 in human leukemia cell lines, observed its effects on cell viability, proliferation and apoptosis, and analyzed its possible target genes and regulatory mechanisms. The primary purpose of the present study was to identify possible therapeutic targets for leukemia in order to improve the survival rate of patients.

Materials and methods

Cell lines and cell culture

Human leukemia cell lines (Kasumi-1, KG-1, MV-4-11, THP-1, K-562, HL-60) and normal blood cell line (RPMI-1788) were all purchased from the American Type Culture Collection (ATCC). These cells were cultivated in Roswell Park Memorial Institute (RPMI)-1640 (Gibco; Thermo Fisher Scientific, Inc.) medium supplemented with 10% fetal bovine serum (FBS, Gibco; Thermo Fisher Scientific, Inc.) in an incubator at 37°C with 5% CO2.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

The relative mRNA expression levels in the cells were determined by RT-qPCR. In brief, total RNA was extracted from the cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.). A NanoDrop-2000c spectrophotometer (Thermo Fisher Scientific, Inc.) was used to detect the quality of RNA, and 1% agarose modified gel electrophoresis was applied for the detection of the integrity. Total RNA (1 µg) was subjected to reverse transcription to synthesize cDNA using the PrimeScript RT Master Mix Perfect Real Time (Takara Bio, Inc.) in line with the manufacturer's instructions. qPCR assay was performed using the ABI PRISM 7500 Fast Real-time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.), and the reaction conditions were conducted as follows: 10 min at 95°C, followed by 40 cycles for 15 sec at 95°C, 1 min at 60°C. The sequences of the primers are presented in Table I and were synthesized by GenePharma. The relative mRNA expression levels were normalized to GAPDH or U6, and the data were assessed using the comparative 2−ΔΔCq method (19).
Table I

Primer base sequences.

GeneForward (5′-3′)Reverse (5′-3′)
SNHG16GCAGAATGCCATGGTTTCCCGGACAGCTGGCAAGAGACTT
miR-193a-5pCTTACTTGGGTCTTTGCGGGTGGTGTCGTGGAGTCG
CDK8ATGCACTGTTGCGAATGCTGAATGCTTGCCCCTAGCACAT
GAPDHAGAAGGCTGG GGCTCATTTGAGGGGCCATC CACAGTCT TC
U6CTCGCTTCGGCAGCACAAACGCTTCACGAATTTGCGT

Cell grouping and transfection

The Kasumi-1 and THP-1 cells were used in the subsequent experiments (as shown below in the Results, these 2 cell lines exhibited the highest expression of SNHG16). First, these 2 cell lines were severally divided into 3 groups: The control, the silencing (si)-control and si-SNHG16. The cells were then distributed into 5 groups: Control, inhibitor control, miR-193a-5p inhibitor (inhibitor), inhibitor + si-SNHG16 and si-SNHG16, mimic control, miR-193a-5p mimic. Similarly, the Kasumi-1 and THP-1 cells were eventually divided into 5 groups: The control, negative control (NC), siCDK8, siCDK8 + inhibitor and inhibitor. The cells in each group were transfected with 2 µg si-SNHG16, inhibitor and control, respectively accordingly using Lipofectamine™ 2000 transfection reagent (Invitrogen; Thermo Fisher Scientific, Inc.) following manufacturer's instructions. Cells in the control group were maintained in medium as blank controls. Following 48 h of transfection, the transfected cells were used in the subsequent experiments. The sequences of relevant RNAs were designed and synthesized by GenePharma according to the requirements of the present study (Table II).
Table II

Sequences of the RNA oligonucleotides.

RNASequence
si-SNHG165′-AGCUGUCCUGUGAAGACCCC-3′
miR-193a-5p mimic5′-AGUAGAGCGGGCGUUUCUGGGU-3′
miR-193a-5p mimic control5′-UUCUCCGAACGUGUCACGUTT-3′
miR-193a-5p inhibitor5′-ACCCAGAAACGCCCGCUCUACU-3′
Inhibitor control5′-AAACGUGACACGUUCGGAGAA-3′
siCDK8Sense: 5′-UGGAUUUGUACCAUUCUUCUG-3′;
Antisense: 5′-GAAGAAUGGUACAAAUCCAAG-3′
Negative controlSense: 5′-UUCUCCGAACGUGUCACGUTT-3′;
Antisense: 5′-ACGUGACACGUUCGGAGAATT-3′

Cell viability assay

The viability of the cells was evaluated by the Cell Counting kit-8 (CCK-8; Beyotime Institute of Biotechnology, Inc.). In brief, the cells in each group were seeded onto 96-well plates at a density of 2×103 cells/well. Following transfection for 24, 48 and 72 h, 10 µl of CCK-8 regent were instilled into the cells for a further 2 h at 37°C with 5% CO2. The optical density (OD) value of the plates was read using a microplate reader (ELX800, BioTek Instruments, Inc.) at a wavelength of 450 nm.

Colony formation assay

The cell proliferative ability was detected by colony formation assay. For the assay, transfected cells were shifted to 6-well plates (1×103 cells/well) supplemented with RPMI-1640 medium containing 10% FBS at 37°C. After 14 days, the cells were fixed with formaldehyde and stained with 0.1% crystal violet solution (Sigma-Aldrich; Merck KGaA) for 15 min at 25°C. The number of cloned cells was observed and counted using an Olympus CKX41 microscope (Olympus Corp.).

Cell apoptosis

Flow cytometry was used to confirm the apoptotic rate of the cells. Following 48 h of transfection, the transfected cells were harvested and stained with 10 µl Annexin V and 5 µl propidium iodide (BD Biosciences) for 15 min. A BD FACSCalibur™ Flow Cytometer (BD Biosciences) was utilized for quantitative analysis on the basis of the manufacturer's instructions.

Dual-luciferase reporter assays

The predicted results from TargetScan 7.2 (http://www.targetscan.org/) revealed that miR-193a-5p could bind to SNHG16, the target gene of which was CDK8. Dual-luciferase reporter assays were applied to verify this prediction. The 3′UTR of the SNHG16 sequence containing the binding sites of miR-193a-5p was as follows: 5′-TCG AGA GCT GTC CCT GTG AA GAC CCC GAG CT-3′; and the 3′UTR of CDK8 was as follows: 5′-TCG AGC CTA TTT CTT AGA AGA CCC AGA GCT-3′. Furthermore, the 3′-UTR sequence was inserted into the pmirGLO Vector (Promega Corp.) with XhoI and Sacl double digestion to construct the recombinant dual-luciferase reporter vector, pmirGLO. The plasmid containing the mutant SNHG16-3′UTR and CDK8-3′UTR were then generated by mutating the core sequence of the miR-193a-5p binding sites through DNA synthesis (Sangon Biotech Co., Ltd.); the sequence of mutant SNHG16-3′UTR was as follows: 5′-TCG AGA CCG TTC ATT ATG AAG ACC CCG AGCT-3′; and the sequence of mutant CDK8-3′UTR was as follows: 5′-TCG AGC CTA TTT CTT AGT TGA AGT AGA GCT-3. For the assays, the wild-type and mutant pmirGLO plasmids were co-transfected with mimic control or miR-193a-5p mimic into the cells using Lipofectamine™ 2000. Following transfection for 48 h, the relative luciferase activities were analyzed using the dual Glo™ Luciferase Assay System (Promega Corp.) following the manufacturer's instructions. Finally, the cell luciferase activity was detected using a SpectraMax reader (Molecular Devices).

Western blot analysis

The expression levels of related proteins in the cells were detected by western blot analysis. For the detection, RIPA buffer (Beijing Solarbio Science & Technology Co., Ltd.) was used to separate the total proteins from the cells, and the concentrations of separated proteins were determined using the Bicinchoninic Protein Assay kit (BCA, Pierce; Thermo Fisher Scientific, Inc.). A total of 50 µg of the total proteins were isolated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE, Beyotime Institute of Biotechnology, Inc.) and then transferred to polyvinylidene fluoride (PVDF) membranes. Subsequently, the membranes were blocked with 5% non-fat dried milk for 2 h. The primary antibodies, CDK8 (1:1,000, ab229192, Abcam), GAPDH (1:1,000, ab8245, Abcam), were then incubated with the membranes overnight at 4°C. The corresponding secondary antibodies, goat anti-rabbit IgG H&L (HRP; 1:7,000, ab97051, Abcam) and goat anti-mouse IgG H&L (HRP; 1:1,000, ab150113, Abcam), were then added for 1 h at room temperature. The blots signals were developed by an enhanced chemiluminescence-detecting kit (Thermo Fisher Scientific, Inc.), and the results were normalized to GAPDH. Labworks 4.6 (UVP) was used to analyze the optical density value of the bands.

Statistical analysis

The Statistical Package of the Social Sciences 20.0 software (SPSS, Inc.) was used for data analysis. The measurement data are presented as the means ± standard deviation (SD). Comparisons between ≥3 groups were analyzed using one-way analysis of variance (ANOVA) with Tukey's post hoc test. All experiments were carried out in triplicate. P<0.05 was considered to indicate a statistically significant difference.

Results

Downregulation of SNHG16 suppresses the viability and proliferation of leukemia cells, and promotes cell apoptosis

The results of RT-qPCR revealed that the expression of SNHG16 markedly increased in the leukemia cell lines in comparison with the RPMI-1788 cell line (P<0.001; Fig. 1A). Comparatively, SNHG16 was more highly expressed in the Kasumi-1 and THP-1 cells; thus, these 2 cell lines were selected for use in subsequent experiments. Following transfection, the SNHG16 expression levels in the Kasumi-1 and THP-1 cells were significantly decreased in the si-SNHG16 group (P<0.001; Fig. 1B and C). Moreover, compared to the control group, the viability of the Kasumi-1 and THP-1 cells was evidently decreased following transfection with si-SNHG16 (P<0.05; Fig. 1D and E). According to the colony formation assays, the colony numbers of the Kasumi-1 and THP-1 cells in the si-SNHG16 group were significantly decreased (P<0.001; Fig. 2A and B). Accordingly, the outcomes of flow cytometry revealed that the apoptotic rates of the Kasumi-1 and THP-1 cells in the si-SNHG16 group were significantly increased (P<0.001; Fig. 2C and D).
Figure 1

Downregulation of SNHG16 suppresses the viability of leukemia cell lines. (A) RT-qPCR was used to measure the expression of SNHG16 in human leukemia cell lines (Kasumi-1, KG-1, MV-4-11, THP-1, K-562 and HL-60) and normal blood cell line (RPMI-1788). The expression of SNHG16 in (B) Kasumi-1 and (C) THP-1 cells were also determined by RT-qPCR following transfection with the blank Control, silencing (si)-control or si-SNHG16. Cell Counting kit-8 (CCK-8) assay was used to examine cell viablity with the optical density (OD) value of (D) Kasumi-1 and (E) THP-1 cells at 24, 48 and 72 h following transfection. *P<0.05, **P<0.001, vs. RPMI-1788, or Control; ns, no significant difference; n=3. SNHG16, small nucleolar RNA host gene 16.

Figure 2

Downregulation of SNHG16 suppresses the proliferation of leukemia cell lines and promotes cell apoptosis. Image and count of (A) Kasumi-1 and (B) THP-1 cells following transfection with the blank Control, silencing (si)-control and si-SNHG16 via colony formation assay under a microscope. Flow cytometry was used to analyze the apoptotic rates of (C) Kasumi-1 and (D) THP-1 cells following transfection. **P<0.001, vs. RPMI-1788, or Control; ns, no significant difference; n=3. SNHG16, small nucleolar RNA host gene 16.

miR-193a-5p can bind to SNHG16

TargetScan 7.2 predicted that miR-193a-5p could bind to SNHG16 (Fig. 3A). For verification, dual-luciferase reporter assays demonstrated that the luciferase activities were markedly suppressed in the leukemia cell lines that were co-transfected with miR-193a-5p and wild-type SNHG16 (P<0.001; Fig. 3B and C). CCK-8 assay revealed that the viability of the Kasumi-1 and THP-1 cells in the miR-193a-5p inhibitor group was significantly increased at 48 and 72 h following transfection; these effects were reversed in the inhibitor + si-SNHG16 group (P<0.05; Fig. 3D and E). In the colony formation assays, the colony numbers of the Kasumi-1 and THP-1 cells in the inhibitor group were markedly increased, which were relatively lower in the inhibitor + si-SNHG16 group (P<0.05; Fig. 4A-C). In the flow cytometric analysis, compared with the inhibitor group, the apoptotic rates of the Kasumi-1 and THP-1 cells in the inhibitor + si-SNHG16 group were significantly elevated, and the apoptotic rates of the Kasumi-1 and THP-1 cells were promoted in the group in which SNHG16 was silenced (P<0.05; Fig. 4D-F). Furthermore, miR-193a-5p expression in the Kasumi-1 and THP-1 cells was visibly inhibited in the inhibitor group; the expression was promoted in the si-SNHG16 group (P<0.001; Fig. 5).
Figure 3

miR-193a-5p binds to SNHG16. (A) TargetScan 7.2 predicted that miR-193a-5p could bind to SNHG16. Dual-luciferase reporter demonstrated the luciferase activities of (B) Kasumi-1 and (C) THP-1 cells following co-transfection with Control + SNHG16, miR-193a-5p + mutant SNHG16 (SNHG16-mut), or miR-193a-5p + SNHG16. Cell Counting kit-8 (CCK-8) assay was used to determine cell viability with the optical density (OD) value of (D) Kasumi-1 and (E) THP-1 cells at 24, 48 and 72 h following transfection with the blank Control, inhibitor control, miR-193a-5p inhibitor (inhibitor), inhibitor + silencing (si)-SNHG16, or si-SNHG16. *P<0.05, **P<0.001, vs. Control + SNHG16, or Control; #P<0.05, ##P<0.001, vs. inhibitor; ^P<0.05, ^^P<0.001, vs. si-SNHG16; ns, no significant difference. n=3. SNHG16, small nucleolar RNA host gene 16.

Figure 4

Silencing of SNHG16 reverses the effects of miR-193a-5p inhibitor on leukemia cell lines. Colony formation assays revealed the (A) image and (B and C) count of Kasumi-1 and THP-1 cells following transfection with the blank Control, inhibitor control, miR-193a-5p inhibitor (inhibitor), inhibitor + silencing (si)-SNHG16, or si-SNHG16. Flow cytometry was used to analyze the apoptotic rates of (D and E) Kasumi-1 and (D and F) THP-1 cells following transfection. *P<0.05, **P<0.001, vs. Control; #P<0.05, ##P<0.001, vs. inhibitor; ^P<0.05, ^^P<0.001, vs. si-SNHG16; ns, no significant difference; n=3. SNHG16, small nucleolar RNA host gene 16.

Figure 5

Silencing of SNHG16 increases the expression of miR-193a-5p in leukemia cell lines. RT-qPCR was used to measure the expression of miR-193a-5p in (A) Kasumi-1 and (B) THP-1 cells following transfection with blank Control, inhibitor control, miR-193a-5p inhibitor (inhibitor), inhibitor + silencing (si)-SNHG16, or si-SNHG16. **P<0.001, vs. Control; #P<0.05, vs. inhibitor; ^^P<0.001, vs. si-SNHG16; ns, no significant difference; n=3. SNHG16, small nucleolar RNA host gene 16.

CDK8 is the target gene of miR-193a-5p

Through TargetScan 7.2, it was found that the position 457-464 of the CDK8 3′UTR was paired with miR-193a-5p (Fig. 6A). Dual-luciferase reporter assays reflected that the luciferase activities of the Kasumi-1 and THP-1 cells were markedly decreased following co-transfection with miR-193a-5p and CDK8 (P<0.001; Fig. 6B and C). At 48 and 72 h following transfection, the viability of the Kasumi-1 and THP-1 cells in the siCDK8 group was evidently downregulated, and that in the siCDK8 + inhibitor group was lower compared with that in the inhibitor group (P<0.05; Fig. 6D and E). Analogously, it could be viewed from the colony formation assays that the colony numbers of Kasumi-1 and THP-1 cells were visibly decreased in the siCDK8 + inhibitor group in contrast to the inhibitor group (P<0.001; Fig. 7A-C). Correspondingly, compared with the inhibitor group, the apoptotic rates of the Kasumi-1 and THP-1 cells in the siCDK8 + inhibitor group were evidently higher (P<0.05; Fig. 7D-F). In addition, the results of RT-qPCR and western blot analysis revealed that the relative mRNA and protein expression levels of CDK8 were markedly increased in the inhibitor group; these effects were reversed in the siCDK8 + inhibitor group (P<0.05; Fig. 8).
Figure 6

CDK8 is the target gene of miR-193a-5p. (A) TargetScan 7.2 predicted that the position 457-464 of CDK8 3′UTR was paired with miR-193a-5p. Dual-luciferase reporter verified the luciferase activities of (B) Kasumi-1 and (C) THP-1 cells following co-transfection with Control + CDK8, miR-193a-5p + mutant CDK8 (CDK8-mut), or miR-193a-5p + CDK8. Cell Counting kit-8 (CCK-8) assay was used to measure cell viability with the optical density (OD) value of (D) Kasumi-1 and (E) THP-1 cells at 24, 48 and 72 h following transfection with blank Control, negative control (NC), silencing (si)-CDK8, siCDK8 + miR-193a-5p inhibitor (inhibitor), or inhibitor. *P<0.05, **P<0.001, vs. Control + CDK8, or Control; #P<0.05, ##P<0.001, vs. siCDK8; ^P<0.05, ^^P<0.001, vs. inhibitor; ns, no significant difference; n=3.

Figure 7

Suppression of miR-193a-5p reverses the effects of CDK8 on leukemia cell lines. Colony formation assays revealed the (A) image and (B and C) count of Kasumi-1 and THP-1 cells following transfection with Control + CDK8, miR-193a-5p + mutant CDK8 (CDK8-mut), or miR-193a-5p + CDK8. (D-F) Flow cytometry was used to analyzed the apoptotic rates of Kasumi-1 and THP-1 cells following transfection. *P<0.05, **P<0.001, vs. Control; ##P<0.001, vs. siCDK8; ^P<0.05, ^^P<0.001, vs. inhibitor; ns, no significant difference; n=3.

Figure 8

Downregulation of miR-193a-5p promotes the expression of CDK8 in leukemia cell lines. RT-qPCR and western blot analysis were used to measure the relative mRNA and protein expression levels of CDK8 in (A-C) Kasumi-1 and (D-F) THP-1 cells following transfection with Control + CDK8, miR-193a-5p + mutant CDK8 (CDK8-mut), or miR-193a-5p + CDK8. *P<0.05, **P<0.001, vs. Control; #P<0.05, vs. siCDK8; ^^P<0.001, vs. inhibitor; ns, no significant difference; n=3.

Discussion

The human genome is mainly composed of DNA sequences, only 2% of which can encode proteins, and the remaining 98% can be transcribed into RNA without protein-coding function, including lncRNAs and short non-coding RNAs (20). Previous studies have confirmed that lncRNAs play a pivotal role in certain biological processes of cancer cells, such as cell proliferation, development and metastasis (21). As one of the lncRNAs, SNHG16 was originally found in neuroblastoma at the early stage, and its increased level was associated with an unfavorable prognosis of such patients (22). With the deepening of SNHG16 research, an increasing number of studies have indicated that SNHG16 is closely related to the outcomes of several malignant diseases. For instance, Christensen et al (23) found that SNHG16 was abnormally highly expressed in colorectal cancer, the interference of which suppressed cell activity, induced apoptosis and inhibited cell migration. Cai et al (24) pointed out that the expression level of SNHG16 was also upregulated in breast cancer, and it induced the migration of cancer cells by competitively binding miR-98/E2F5. Nevertheless, the exploration of the role of SNHG16 in hematological malignancies is limited. Herein, it was found that SNHG16 expression was increased in leukemia cell lines, the silencing of which suppressed the viability of leukemia cells, suppressed cell proliferation and promoted cell apoptosis. These findings suggest that SNHG16 functions as a tumor promoter in leukemia, and its downregulation may control the deterioration of the disease. In the regulatory mechanisms of lncRNAs, it is considered that lncRNAs can intensify or promote cancer progression by competing with mRNAs to sponge common miRNAs (25). miRNAs, a class of non-coding RNAs approximately 22 nucleotides in length, can match and bind to the 3′UTRs of target molecule mRNAs, thereby disrupting the translation or stability of the target genes. Moreover, it has been demonstrated that miRNAs play an important role in the normal hematopoietic process, which can be expressed in specific types of hematopoietic cells, and act as a regulator in the early hematopoietic cell proliferation, differentiation and development (26). Thus, the abnormal expression of miRNAs can lead to the occurrence of malignant blood diseases through the regulation of certain oncogenes or tumor suppressor genes. In the study by Lu et al (27), through bioinformatics and luciferase reporter assays, it was demonstrated that SNHG16 functioned as an oncogene in glioma by sponging miR-4518. In the present study, bioinformatics we used to predict that SNHG16 contained a binding site of miR-193a-5p, which was verified by dual-luciferase reporter gene analysis. Furthermore, with the decrease in SNHG16, the expression level of miR-193a-5p presented an increasing trend. As for the biological effects of miR-193a-5p on leukemia cells, the present study disclosed that the downregulation of miR-193a-5p enhanced the viability of leukemia cells, promoted cell proliferation and reduced cell apoptosis. Therefore, it was suggested that the deletion of miR-193a-5p exerted a pro-tumor effect in leukemia. Of note, the silencing of SNHG16 had the function of reversing the pro-leukemic effects of the downregulation of miR-193a-5p. Similarly, a previous study revealed that the expression level of miR-193a-5p in gastric cancer was observably reduced, and its ectopic expression suppressed the growth of gastric cancer cells, suggesting that the knockdown of miR-193a-5p functioned as an oncogene in gastric cancer (28). Zhang et al (29) also found that miR-193a-5p was singularly downregulated in colorectal cancer, which was associated with lymph node metastasis and a poor prognosis of patients with the disease. In contrast to these studies, Wang and Wang (30) considered that miR-193a-5p was specifically upregulated in hepatocellular carcinoma tissues and cell lines, which could be used as an oncogene to promote the proliferation of cancer cells and inhibit cell apoptosis. Based on the above-mentioned findings, it was hypothesized that miR-193a-5p played disparate roles in different diseases, including roles as a tumor promoter and suppressor, which may be due to the different target genes of miR-193a-5p in distinct diseases. Among known targets, studies have found that phos-phoinositide-3-kinase, regulatory subunit 3 (PIK3R3) and mammalian target of rapamycin (mTOR) can directly bind to miR-193a-5p, and play a pivotal role in non-small cell carcinoma (31). In the field of leukemia, Witalisz-Siepracka et al (32) considered that miR-193a could regulate the occurrence of leukemia through Wilms tumor-1 (WT1). In the present study, the biological prediction website predicted that the 3′UTR of CDK8 could bind to miR-193a-5p, and the union of the mutant CDK8 with miR-193a-5p had no effect on luciferase activity, which further verified that CDK8 was the target gene of miR-193a-5p. CDK8, a cell cycle regulator protein, functions as a transcriptional inhibitor or co-activator, which is associated with tumor staging and progression (33). Witalisz-Siepracka et al (32) indicated that the loss of CDK8 enhanced the cytotoxicity of natural killer (NK) cells, and exerted anti-proliferative and pro-apoptotic effects on leukemia cells. In contrast to the effects of miR-193a-5p inhibitor, the viability and proliferation of leukemia cells were markedly suppressed with the knockdown of CDK8, while the cell apoptotic rates were increased, suggesting that CDK8 knockdown inhibited the progression of leukemia. Accordingly, the experimental results from the present disclosed that the inhibition of miR-193a-5p promoted the expression of CDK8 in leukemia cells, which suggested that miR-193a-5p regulated leukemia cells through CDK8. In conclusion, the present study demonstrated that SNHG16 was abnormally highly expressed in acute myeloblastic leukemia cell lines. The knockdown of SNHG16 suppressed the viability of leukemia cells, suppressed cell proliferation and promoted cell apoptosis by regulating miR-193a-5p/CDK8, which may be a potential target for the treatment of leukemia in the future.
  33 in total

1.  SNHG16 is regulated by the Wnt pathway in colorectal cancer and affects genes involved in lipid metabolism.

Authors:  Lise Lotte Christensen; Kirsten True; Mark P Hamilton; Morten M Nielsen; Nkerorema D Damas; Christian K Damgaard; Halit Ongen; Emmanouil Dermitzakis; Jesper B Bramsen; Jakob S Pedersen; Anders H Lund; Søren Vang; Katrine Stribolt; Mogens R Madsen; Søren Laurberg; Sean E McGuire; Torben F Ørntoft; Claus L Andersen
Journal:  Mol Oncol       Date:  2016-06-26       Impact factor: 6.603

Review 2.  Epigenetic regulation by long noncoding RNAs.

Authors:  Jeannie T Lee
Journal:  Science       Date:  2012-12-14       Impact factor: 47.728

3.  Background radiation and childhood leukemia: A nationwide register-based case-control study.

Authors:  Atte Nikkilä; Sini Erme; Hannu Arvela; Olli Holmgren; Jani Raitanen; Olli Lohi; Anssi Auvinen
Journal:  Int J Cancer       Date:  2016-07-22       Impact factor: 7.396

4.  LncRNA Expression Discriminates Karyotype and Predicts Survival in B-Lymphoblastic Leukemia.

Authors:  Thilini R Fernando; Norma I Rodriguez-Malave; Ella V Waters; Weihong Yan; David Casero; Giuseppe Basso; Martina Pigazzi; Dinesh S Rao
Journal:  Mol Cancer Res       Date:  2015-02-13       Impact factor: 5.852

Review 5.  Long Noncoding RNA: Genome Organization and Mechanism of Action.

Authors:  Vijay Suresh Akhade; Debosree Pal; Chandrasekhar Kanduri
Journal:  Adv Exp Med Biol       Date:  2017       Impact factor: 2.622

6.  MiR-193a-5p and -3p Play a Distinct Role in Gastric Cancer: miR-193a-3p Suppresses Gastric Cancer Cell Growth by Targeting ETS1 and CCND1.

Authors:  Nan-Hua Chou; Yi-Hao Lo; Kuo-Chiang Wang; Chi-Hsiang Kang; Chung-Yu Tsai; Kuo-Wang Tsai
Journal:  Anticancer Res       Date:  2018-06       Impact factor: 2.480

7.  Downregulation of miR-193a-5p correlates with lymph node metastasis and poor prognosis in colorectal cancer.

Authors:  Peng Zhang; Deng-Bo Ji; Hai-Bo Han; Yun-Fei Shi; Chang-Zheng Du; Jin Gu
Journal:  World J Gastroenterol       Date:  2014-09-14       Impact factor: 5.742

8.  Influence of radiation quality on mouse chromosome 2 deletions in radiation-induced acute myeloid leukaemia.

Authors:  Natalie Brown; Rosemary Finnon; Grainne Manning; Simon Bouffler; Christophe Badie
Journal:  Mutat Res Genet Toxicol Environ Mutagen       Date:  2015-07-28       Impact factor: 2.873

Review 9.  Aberrant lncRNA Expression in Multiple Myeloma.

Authors:  Hui Meng; Lei Han; Chun Hong; Jinya Ding; Qianchuan Huang
Journal:  Oncol Res       Date:  2017-12-04       Impact factor: 5.574

10.  Landscape of transcription in human cells.

Authors:  Sarah Djebali; Carrie A Davis; Angelika Merkel; Alex Dobin; Timo Lassmann; Ali Mortazavi; Andrea Tanzer; Julien Lagarde; Wei Lin; Felix Schlesinger; Chenghai Xue; Georgi K Marinov; Jainab Khatun; Brian A Williams; Chris Zaleski; Joel Rozowsky; Maik Röder; Felix Kokocinski; Rehab F Abdelhamid; Tyler Alioto; Igor Antoshechkin; Michael T Baer; Nadav S Bar; Philippe Batut; Kimberly Bell; Ian Bell; Sudipto Chakrabortty; Xian Chen; Jacqueline Chrast; Joao Curado; Thomas Derrien; Jorg Drenkow; Erica Dumais; Jacqueline Dumais; Radha Duttagupta; Emilie Falconnet; Meagan Fastuca; Kata Fejes-Toth; Pedro Ferreira; Sylvain Foissac; Melissa J Fullwood; Hui Gao; David Gonzalez; Assaf Gordon; Harsha Gunawardena; Cedric Howald; Sonali Jha; Rory Johnson; Philipp Kapranov; Brandon King; Colin Kingswood; Oscar J Luo; Eddie Park; Kimberly Persaud; Jonathan B Preall; Paolo Ribeca; Brian Risk; Daniel Robyr; Michael Sammeth; Lorian Schaffer; Lei-Hoon See; Atif Shahab; Jorgen Skancke; Ana Maria Suzuki; Hazuki Takahashi; Hagen Tilgner; Diane Trout; Nathalie Walters; Huaien Wang; John Wrobel; Yanbao Yu; Xiaoan Ruan; Yoshihide Hayashizaki; Jennifer Harrow; Mark Gerstein; Tim Hubbard; Alexandre Reymond; Stylianos E Antonarakis; Gregory Hannon; Morgan C Giddings; Yijun Ruan; Barbara Wold; Piero Carninci; Roderic Guigó; Thomas R Gingeras
Journal:  Nature       Date:  2012-09-06       Impact factor: 49.962

View more
  1 in total

1.  Long non-coding RNA SNHG16 as a potential biomarker in hepatocellular carcinoma: A meta-analysis.

Authors:  Qiuli Liu; Po Gao; Qingling Li; Chao Xu; Kai Qu; Jie Zhang
Journal:  Medicine (Baltimore)       Date:  2021-09-10       Impact factor: 1.817

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.