Literature DB >> 32698757

Long noncoding RNA CASC2 inhibits ox-LDL-mediated vascular smooth muscle cells proliferation and migration via the regulation of miR-532-3p/PAPD5.

Chenjing Wang1, Jin Zhao2, Xiaodong Nan3, Zhong Guo2, Shuangsheng Huang2, Xiaokun Wang2, Feng Sun2, Shijie Ma2.   

Abstract

BACKGROUND: Studies have demonstrated that long noncoding RNAs (lncRNAs) have essential impacts on the development of atherosclerosis (AS). This study aimed to identify the role and functional mechanism of lncRNA CASC2 in the development and migration of vascular smooth muscle cells (VSMCs).
METHOD: The serum of 40 pairs of AS patients and healthy volunteers were collected and the expression of CASC2 was evaluated. qRT-PCR and western blotting were carried out to examine the expression levels of at mRNA and protein level, repectively. Cell proliferation assay, colony formation assay, transwell migration assay, dual-luciferase reporter assay, and wound healing assay were conducted to evaluate cell proliferation, colony formation, migration, transcription, targeting, and self-restoration.
RESULTS: The expression levels of CASC2 were decreased, while the expression levels of miR-532-3p were elevated in AS patient samples and VSMCs. Overexpression of CASC2 inhibited the proliferation and migration of VSMCs and enhanced cell apoptosis. CASC2 inhibited the expression of miR-532-3p, and inversely upregulated the expression of PAPD5, which was a target of miR-532-3p. In addition, knockdown of miR-532-3p-mimic and PAPD5 could attenuate the impact of overexpression of CASC2 on proliferation, migration, and apoptosis in ox-LDL-VSMCs.
CONCLUSION: CASC2 suppressed cell reproduction and promoted cell apoptosis by regulating the miR-532-3p/PAPD5 axis in ox-LDL-mediated VSMCs. This might be important for AS therapeutics.

Entities:  

Keywords:  Atherosclerosis; CASC2; PAPD5; miR-532-3p

Year:  2020        PMID: 32698757      PMCID: PMC7374889          DOI: 10.1186/s10020-020-00200-3

Source DB:  PubMed          Journal:  Mol Med        ISSN: 1076-1551            Impact factor:   6.354


Background

Atherosclerosis (AS), a high-risk factor for cardiovascular diseases (Libby et al., 2002), is one of the top causes of heart disease-related morbidities and mortalities all over the world (Hansson, 2005). The development of atherosclerosis is related with multiple processes, including the production of pro-inflammatory factors (Ross, 1999), dysfunction of vascular smooth muscle cells (VSMCs) (Bennett et al., 2016), and dysregulation of specific RNAs and proteins (Burd et al., 2010). The abnormal proliferation, migration, apoptosis, and irregular expression of involved proteins in VSMCs contribute to the formation of atherosclerosis (Dzau et al., 2002; Robbins et al., 2013). Even with advancement and development in the understanding of atherosclerosis, the prediction and treatment still face enormous challenges, which make atherosclerosis-induced cardiovascular diseases significant health concerns for many people. Long non-coding RNAs (lncRNAs, > 200 nt) are demonstrated to participate in a wide variety of biological and pathological processes (Wapinski & Chang, 2011), such as carcinogenesis (Shao et al., 2016) and chronic diseases (Chen et al., 2012). LncRNAs are reported to modulate gene expression epigenetically at transcriptional and post-transcriptional levels, and are involved in multiple signaling pathways (Yang et al., 2014). Growing evidence has suggested that lncRNAs play critical roles in regulating the initial and development of atherosclerosis (Aryal et al., 2014; Chen et al., 2017). For instance, one study demonstrated that lncRNA GAS5 regulated the apoptosis of macrophages and vascular endothelial cells in atherosclerosis (Chen et al., 2017). LncRNA CASC2 is widely reported in the regulation of different human cancers (Liao et al., 2017; Cao et al., 2016). Up-regulated expression of lncRNA CASC2 was reported to inhibit the development of malignant melanoma through regulating miR-18a-5p/RUNX1 (Zhang et al., 2019). In this study, we aimed to explore the roles of CASC2 in the proliferation of vascular smooth muscle cells and the underlying mechanisms in atherosclerosis. MicroRNAs (miRNAs, 20–22 nt) are identified as crucial regulators of human diseases by binding to 3′-untranslated region (3′-UTR) of target messenger RNAs (mRNAs) to negatively modulate genes expression (Croce & Calin, 2005; Khvorova et al., 2003). MiR-532-3p is a highly conserved miRNA that plays essential roles in cell development, differentiation, and proliferation (Wang et al., 2015; Han et al., 2019). For example, one study reported that miR-532-3p regulated KIFC1 and promoted epithelial-to-mesenchymal transition and metastasis of hepatocellular carcinoma via the gankyrin/AKT signaling pathway (Han et al., 2019). In addition to its roles in tumors, miR-532-3p was also found to be involved in cardiac physiology. It was resported that miR-532-3p regulated mitochondrial fissions via targeting apoptosis-repressor with caspase domain in doxorubicin cardiotoxicities (Wang et al., 2015). PAPD5, a noncanonical poly (A) polymerase (Rammelt et al., 2011), is reported to interact with several miRNAs, such as miR-21 in HER2-positive metastatic gastric cancer (Boele et al., 2014) and miR-4728 cancer and other proliferative diseases (Newie et al., 2016). Oxidized low-density lipoprotein (ox-LDL) has been widely reported in the pathological phenotype transformation of VSMCs in AS (Gao & Liu, 2017). Recent studies showed that low concentrations of ox-LDL (0–100 μg/ml) promote the lipid uptake by macrophage and increase the proliferation and migration of VSMCs. Considering the importance of ox-LDL in inducing atheroma (Ding et al., 2012; Tian et al., 2015), we aimed to investigate the roles of lncRNA CASC2, miR-532-3p and PAPD5 in the ox-LDL induced phenotypic and functional changes of VSMCs, and further demonstrate the molecular mechanisms in the development of atherosclerosis.

Methods

Clinical samples

Forty AS patients and forty healthy volunteers (age range 50 to 70 years old and 30% females) were recruited in this study. All of the participants signed the informed consent. This study was approved by the Ethical Committee in Medical College of Northwest Minzu University Health Science Center. Blood sample (10 ml) from each participant was collected and maintained at 25 °C for 1 h. Serum samples were collected and total RNAs were extracted by TRIzol reagent (Invitrogen, US).

Cell culture

Human aortic-VSMCs (HA-VSMCs) were provided by American Type Culture Collection (US) and kept in F-12 K medium with 10% FBS (Invitrogen, US), 0.05 mg/ml ascorbic acid (Sigma, US), 10 μg/ml insulin (Sigma, US), 10 μg/ml transferrin (Sigma, US), 30 μg/ml endothelial cell growth supplement (Cell application, US), 0.01 μg/ml sodium selenite (Sigma, US), 10 mM HEPES (Sigma, US), and 10 mM TES (Sigma, US), the culture conditions were 95% humidity and 5% CO2 at 37 °C.

Cell transfection and treatment

LncRNA CASC2 was amplified and then cloned into pcDNA3.1 vector (Invitrogen, US) to construct pcDNA-CASC2 overexpression plasmids. CASC2 siRNA (Si-CASC2), siRNA negative control (si-NC), PAPD5 siRNA (si-PAPD5) and PAPD5 si-NC, miR-532-3p mimic and miRNA mimic negative control (miR-NC) were purchased from GenePharma (Shanghai, China). The transfection was carried out by lipofectamine 2000 (Invitrogen, US). For observation of the effect of oxLDL (Biosynthesis, China) on the expression of CASC2 and miR-532-3p, VSMCs were cultured with 50 μg/ml ox-LDL for two d.

qRT-PCR

Total RNA samples (1 μg) were reverse-transcribed into cDNAs using PrimeScript™ RT reagent Kit with gDNA Eraser (Cat# RR047A, Takara). SYBR Master (TOYOBO, Japan) was used to measure the expression of CASC2, GAPDH, miR-532-3p and U6. MiR-532-3p and U6 primers were provided by Ribobio (Guangzhou, China). The primer sequences used were: CASC2 (divergent primer): 5′- GTTGGGCCTGTCAATCCTA − 3′ (forward); CASC2 (divergent primer): 5′- GGTAGGCCCGCACGGTA-3′ (reverse); ITCH (convergent primer): forward: 5′-GGTGTGGAAGTGCCGTTG-3′ (forward); ITCH (convergent primer) reverse 5′-TGGAGGTCAATCATTCGTT-3′ (reverse). miR-532-3p: 5′- CGTTTCCAACTGTATG-3′ (forward); miR-532-3p: reverse: 5′-CAACGGCGGATGGCC-3′ (reverse); PAPD5: 5′- AAAGCTATGCTATGGCTCGA − 3′ (forward); PAPD5: reverse: 5′- GCGACTAAGTGCCAATCAC-3′ (reverse); GAPDH: 5′-CGGAGCGATCAGAAGACCT-3′ (forward); GAPDH: reverse: 5′-GTTGCTCATAGTACGGGAAC-3′ (reverse); U6: 5′-ATGATGGCACTGTACTGGGCC-3′ (forward); U6: 5′-GATTGGCAGCGATTATACACC-3′ (reverse).

Cell proliferation and colony formation

The transfected cells were seeded into 96-well plates (2000 cells/well) for CCK-8 assay. At 0, 1, 2, 3 and 4 d after seeding, each well was supplied with 10 μl CCK-8 solution (Dojindo, Japan) and cultured for another 1 h at 37 °C in dark. A microplate reader (Tecan, Switzerland) was used to detect the signal at 450 nm. For BrdU incorporation, cells were seeded in 96-well plates (2000 cells/well). After 2 d of transfection, cell proliferation was detected by BrdU cell proliferation assay kit (Cat#5213S, Cell Signaling). For colony formation, cells were seeded into 6-well plates (4000 cells/well). After 14 d, cells were fixed and stained using 0.1% crystal violet. The colonies were recorded.

Cell apoptosis

Cells (1 × 106) were harvested and washed with cold PBS, then stained by 5 μL FITC Annexin V (BD, US) and 5 μL Propidium Iodide (PI) for 10 min at 25 °C in dark. Then, 400 μL 1× binding buffer (Cat# CA1020, Solarbio, Beijing, China) was added to each tube. The apoptotic cells were measured by fluorescence-activated cell-sorting flow cytometer (BD, US).

Transwell assay

The 24-well transwell chambers with Matrigel (BD, USA) were used to determine VSMCs cell migrations. Briefly, after transfection with CASC2, miR-532-3p, PAPD5 and the relative siRNA, the VSMCs were resuspended in 200 μl serum-free medium, and 40,000 cells were loaded into the upper chambers, and the lower chambers were filled with 500 μl medium with or without 10 μg/ml ox-LDL. After 1 d of incubation, the migrated cells were fixed with 4% paraformaldehyde for 15–20 min, then stained with DAPI (1:2000, Sigma-Aldrich, USA) for 10 min at room temperature, and finally analyzed by a microscope (Olympus) in three random fields for each well.

Dual-luciferase assay

CASC2-WT (wild-type) or CASC2-MUT (mutant) and PAPD5 were cloned into pmirGLO Dual-Luciferase miRNA Target Expression vectors. VSMCs were co-transfected with these plasmids and miR-532-3p inhibitor or mimic. Luciferase activities were detected after 2 d using a dual-luciferase system (Promega, USA). The expression of a luciferase reporter is quantitated by the ratio of Firefly and Renilla Luciferase signals. Each experiment was repeated for three times.

Wound healing assay

Wound-healing assay was also used to assess the cell migration of VSMCs. Cells were inoculated to generate a confluent monolayer in 6-well plate. By a 200 uL sterile pipette tip, a scratch was made to the confluent cells, causing a wound. After 2 d of culture, a microscope was used to assess the scratch-induced wound. The results were recorded by Image J through the proportion of wound closure, with the primitive width of the scratch at 100%. The image was represented one from at least 3 repetitive experiments.

Western blot

Proteins were isolated by RIPA lysis buffer (Beyotime) and measured by BCA kit (Thermo Fisher Scientific, US). Protein samples (50 μg) were separated by SDS-PAGE and transferred to PVDF membrane (Millipore, US). After blocking by 5% skim milk for 1 h, the membrane was incubated with anti-PCNA (1:500; Santa Cruz Biotechnology, USA), MMP-2 (1:500; SCB), MMP-9 (1:500; SCB), PAPD5 (1:1000; CST) and GAPDH (1:1000; CST). After being washed with PBS, the membrane was treated with horseradish peroxidase linked secondary antibody. Clarity Max™ Western ECL Substrate was used to quantify the signal (BR). SCB stands for Santa Cruz Biotechnology (US); CST stands for Cell Signaling Technology (US) and BR stands for Bio-Rad (US).

Statistical analysis

All results were expressed as mean ± SD of more than three independent experiments. Differences between two groups and among multiple groups were explored by t-test and one-way ANOVA, respectively. P < 0.05 represented statistically significant differences.

Results

LncRNA CASC2 was down-regulated in AS samples and HA-VSMCs

The expression of lncRNA CASC2 was detected by qRT-PCR assay. It showed that the expression levels of CASC2 were significantly inhibited in AS patient serum compared to that in healthy samples (Fig. 1a). In addition, in vitro experiment also demonstrated that ox-LDL stimulation results in the decreased expression levels of CASC2 in HA-VSMCs in a dose-dependent (Fig. 1b) and time-dependent (Fig. 1c) manner. The data suggested that CASC2 might be an essential mediator in AS progression.
Fig. 1

LncRNA CASC2 was downregulated in AS patient serum and ox-LDL-stimulated VSMCs. a The expression of CASC2 in serum of AS patients and healthy people through qRT-PCR. b The expression of CASC2 after treatment with 0, 25, 50, 75 μg/ml ox-LDL for 1 d. c The expression of CASC2 after treatment with 50 μg/ml ox-LDL for 0, 1, 2, and 3 d through qRT-PCR. **P < 0.01; ***P < 0.001

LncRNA CASC2 was downregulated in AS patient serum and ox-LDL-stimulated VSMCs. a The expression of CASC2 in serum of AS patients and healthy people through qRT-PCR. b The expression of CASC2 after treatment with 0, 25, 50, 75 μg/ml ox-LDL for 1 d. c The expression of CASC2 after treatment with 50 μg/ml ox-LDL for 0, 1, 2, and 3 d through qRT-PCR. **P < 0.01; ***P < 0.001

CASC2 sponged miR-532-3p in AS patients

Through bioinformatics analysis, we found that CASC2 shared binding sequences with miR-532-3p (Fig. 2a), which is predicted by Starbase, and RegRNA or PITA database. As shown in Fig. 2b, overexpression of miR-532-3p greatly reduced the luciferase activities of CASC2-WT but has no effect on CASC2-MUT. Figure 2c demonstrated that CASC2 greatly elevated the luciferase activities of CAS2 but significantly inhibited the luciferase activities of miR-532-3p. In addition, knockdown of CASC2 elevated the expression of miR-532-3p, but overexpression of CASC2 inhibited the expression of miR-532-3p in VSMCs (Fig. 2c). Furthermore, the expression levels of miR-532-3p were dramatically elevated in the serum of AS patients than that in healthy ones (Fig. 2d). As shown in Fig. 3e, a negative relationship was observed between the expression of CASC2 and miR-532-3p in the serum of AS patients (r = − 0.533, P < 0.001). These data indicated that CASC2 exerted its functions through the sponge with miR-532-3p.
Fig. 2

CASC2 sponged miR-532-3p in AS patients. a The common binding sequences between CASC2 and miR-532-3p by Starbase and RegRNA or PITA database. b The luciferase activities in VSMCs co-transfected with miR-532-3p mimic and CASC2-WT or CASC2-MUT vector. c qRT-PCR for miR-532-3p expression in VSMCs with si-CASC2 or CASC2. d qRT-PCR for miR-532-3p expression in serum of AS patients and healthy people. e Pearson’s correlation between CASC2 and miR-532-3p in the serum of AS patients (r = − 0.533, P < 0.001). **P < 0.01; ***P < 0.001

Fig. 3

CASC2 sponged and sequestered miR-532-3p to up-regulate the expression of PAPD5. a The common binding sequences of miR-532-3p and PAPD5 by Targetscan analysis. b The luciferase activities of VSMCs co-transfected with miR-532-3p mimic and PAPD5-WT or PAPD5-MUT. c qRT-PCR for the expression of PAPD5 in VSMCs co-transfected with miR-532-3p mimic or miR-NC, and CASC2 or control. d Western blotting for the expression of PAPD5 protein in VSMCs co-transfected with miR-532-3p mimic or miR-NC, and CASC2 or control. e qRT-PCR for the expression of PAPD5 in serum of AS patients and healthy volunteers. f Pearson’s analysis of CASC2 and PAPD5 in serum of AS patients (r = 0.460, P < 0.001). * vs. control group, # vs. miR-532-3p mimics group. **P < 0.01, ##P < 0.01

CASC2 sponged miR-532-3p in AS patients. a The common binding sequences between CASC2 and miR-532-3p by Starbase and RegRNA or PITA database. b The luciferase activities in VSMCs co-transfected with miR-532-3p mimic and CASC2-WT or CASC2-MUT vector. c qRT-PCR for miR-532-3p expression in VSMCs with si-CASC2 or CASC2. d qRT-PCR for miR-532-3p expression in serum of AS patients and healthy people. e Pearson’s correlation between CASC2 and miR-532-3p in the serum of AS patients (r = − 0.533, P < 0.001). **P < 0.01; ***P < 0.001 CASC2 sponged and sequestered miR-532-3p to up-regulate the expression of PAPD5. a The common binding sequences of miR-532-3p and PAPD5 by Targetscan analysis. b The luciferase activities of VSMCs co-transfected with miR-532-3p mimic and PAPD5-WT or PAPD5-MUT. c qRT-PCR for the expression of PAPD5 in VSMCs co-transfected with miR-532-3p mimic or miR-NC, and CASC2 or control. d Western blotting for the expression of PAPD5 protein in VSMCs co-transfected with miR-532-3p mimic or miR-NC, and CASC2 or control. e qRT-PCR for the expression of PAPD5 in serum of AS patients and healthy volunteers. f Pearson’s analysis of CASC2 and PAPD5 in serum of AS patients (r = 0.460, P < 0.001). * vs. control group, # vs. miR-532-3p mimics group. **P < 0.01, ##P < 0.01

CASC2 sponged and sequestered miR-532-3p to up-regulate the expression of PAPD5

To further evaluate the functional genes downstream of miR-532-3p. Targetscan was used and it predicted that PAPD5 might be a target gene of miR-532-3p (Fig. 3a). In addition, overexpression of miR-532-3p inhibited the luciferase activities of PAPD5-WT, but had no effect on PAPD5-MUT through the dual-luciferase reporter assay (Fig. 3b). As shown in Fig. 3c and d, the expression of PAPD5 was inhibited in miR-532-3p transfected VSMCs, but upregulated by CASC2 at both mRNA and protein levels. Figure 3e showed that the expression levels of PAPD5 were significantly decreased in the serum of AS patients in contrast to that in healthy people. As shown in Fig. 3f, the expression of CASC2 was positively related to the expression of PAPD5 in AS serum (r = 0.460, P < 0.001). These results demonstrated that CASC2 elevated the expression of PAPD5 by sponging miR-532-3p in AS.

CASC2 suppressed the proliferation of VSMCs through modulating miR-532-3p/PAPD5

To further explore the role of CASC2 on the proliferation, apoptosis and migration of VSMCs. CASC2 significantly inhibited the viabilities, proliferation, and colony formation of VSMCs, but these effects were abrogated by miR-532-3p overexpression (Fig. 4a-c). Similarly, CASC2 overexpression increased the cell apoptosis and it could be reversed by upregulation of miR-532-3p (Fig. 4d). However, co-transfection of CASC2 with si-PAPD5 has the same effect with co-transfection of CASC2 with miR-532-3p mimic on VSMCs, which partly attenuated the effect of CASC2.
Fig. 4

Over-expression of miR-532-3p or silencing of PAPD5 on the lncCASC2-induced proliferation of VSMCs. a CCK-8 assay of VSMCs co-transfected with CASC2 or control, and miR-532-3p mimic or si-PAPD5. b BrdU incorporation assay of VSMCs co-transfected with CASC2 or control, and miR-532-3p mimic or si-PAPD5. c Colony formation assay of VSMCs co-transfected with CASC2 or control, and miR-532-3p mimic or si-PAPD5. d Cell apoptosis assay of VSMCs co-transfected with CASC2 or control, and miR-532-3p mimic or si-PAPD5. * vs. NC group or NC + ox-LDL group, # vs. CASC2 group. ***P < 0.001, **P < 0.01, #P < 0.05

Over-expression of miR-532-3p or silencing of PAPD5 on the lncCASC2-induced proliferation of VSMCs. a CCK-8 assay of VSMCs co-transfected with CASC2 or control, and miR-532-3p mimic or si-PAPD5. b BrdU incorporation assay of VSMCs co-transfected with CASC2 or control, and miR-532-3p mimic or si-PAPD5. c Colony formation assay of VSMCs co-transfected with CASC2 or control, and miR-532-3p mimic or si-PAPD5. d Cell apoptosis assay of VSMCs co-transfected with CASC2 or control, and miR-532-3p mimic or si-PAPD5. * vs. NC group or NC + ox-LDL group, # vs. CASC2 group. ***P < 0.001, **P < 0.01, #P < 0.05

CASC2 suppressed the migration of VSMCs through modulating miR-532-3p/PAPD5

We next performed transwell assay and wound-healing assay to detect whether CASC2 had effect on VSMCs cell invasion and migration. The results illustrated that overexpression of miR-532-3p greatly reverses the CASC2-induced cell migration (Fig. 5a). Meanwhile, the wound healing assay also showed similar results (Fig. 5b). Moreover, to explore the signaling pathways involved in cell proliferation and migration, the expression of proliferation- and migration-related proteins, including PCNA, a-SMA, MMP-2, and MMP-9, were detected. As shown in Fig. 5c, overexpression of CASC2 suppressed the expression of PCNA, a-SMA, MMP-2, and MMP-9. Besides, CASC2 co-transfection with si-PAPD5 exhibited the same effects as co-transfection with miR-532-3p mimics on VSMCs. As a result, overexpression of miR-532-3p or silencing of PAPD5 could reverse CASC2-induced inhibition of growth and migration in VSMCs.
Fig. 5

Effects of over-expression of miR-532-3p or silencing of PAPD5 on CASC2-induced migration of VSMCs. a Transwell assay of VSMCs co-transfected with CASC2 or control, and miR-532-3p mimic or si-PAPD5. b Wound healing assay of VSMCs co-transfected with CASC2 or control, and miR-532-3p mimics or si-PAPD5. c Western blotting for proliferation and migration related proteins expression in VSMCs co-transfected with CASC2 or control, and miR-532-3p mimic or si-PAPD5. * vs. NC group or NC + ox-LDL group, # vs. lncCASC2 group. ***P < 0.001, **P < 0.01, #P < 0.05

Effects of over-expression of miR-532-3p or silencing of PAPD5 on CASC2-induced migration of VSMCs. a Transwell assay of VSMCs co-transfected with CASC2 or control, and miR-532-3p mimic or si-PAPD5. b Wound healing assay of VSMCs co-transfected with CASC2 or control, and miR-532-3p mimics or si-PAPD5. c Western blotting for proliferation and migration related proteins expression in VSMCs co-transfected with CASC2 or control, and miR-532-3p mimic or si-PAPD5. * vs. NC group or NC + ox-LDL group, # vs. lncCASC2 group. ***P < 0.001, **P < 0.01, #P < 0.05

Discussions

Studies have proved that dysregulation of certain lncRNAs is closely related to human disease. For atherosclerosis, lncRNAs have also been discovered to exert promotive roles in the proliferation of VSMCs. For example, lncRNA H19 was reported to promote atherosclerosis by regulating the MAPK and NF-kB signaling (Pan, 2017). In their study, H19 was considerably up-regulated in AS patients and VSMCs (Pan, 2017). From the qRT-PCR results in our experiments, we found that CASC2 was significantly downregulated in human AS samples compared to that in healthy samples and normal cells. As a new indictor for AS, CASC2 could be an important mediator in AS progression. Previous studies indicate that lncRNAs can sponge their corresponding miRANs, and exert their biological functions to regulate specific cells (Cao et al., 2016). For example, CASC2 was found to sponge miR-181a to modulate glioma growth and resistance to temozolomide (TMZ) through the PTEN pathway (Liao et al., 2017). Another study reported that down-regulation of CASC2 by miRNA-21 could increase the proliferation and migration of renal carcinoma cells. In our experiments, Starbase and dual-luciferase assay confirmed that CASC2 could target to miR-532-3p. Moreover, the expression of miR-532-3p was significantly upregulated in the serum of AS patients than that in healthy controls. It demonstrated that CASC2 exerted its functions through the sponging of miR-532-3p. Non-canonical poly(A) polymerase PAPD5 can adenylate the post-transcription of miR-21, and affect the proliferation of corresponding cells in cancer (Boele et al., 2014). Targetscan predicts that PAPD5 might be a target of miR-532-3p. In the luciferase reporter assay, we noticed that overexpression of miR-532-3p inhibited the luciferase activities of PAPD5-WT. The expression of PAPD5 was relieved in miR-532-3p transfected VSMCs but were attenuated by CASC2 at both mRNA and protein levels. Moreover, the expression levels of PAPD5 were significantly decreased in the serum of AS patients in contrast to that in healthy people. PAPD5-mediated adenylation of miRNA-21 is disrupted in cancer (Koppers-Lalic et al., 2016). Here, we found that CASC2 elevated the expression levels of PAPD5 by sponging miR-532-3p in AS, which might inhibit the cell proliferation of VSMCs. LncRNA UCA1 was shown to sponge miR-26a to regulate the migration and proliferation of vascular smooth muscle cells (Tian et al., 2018). Similarly, the expression of miR-26a was up-regulated in ox-LDL (50 mg/l) induced VSMCs, and UCA1 antagonized the effect of miR-26a on the downregulation of its target PETN and contraction phenotype (Tian et al., 2018). In our experiments, CASC2 significantly inhibited the viabilities, cell proliferation, and colony formation of VSMCs, but this effect was abrogated by overexpression of miR-532-3p. Overexpression of miR-532-3p greatly reversed the CASC2-induced cell apoptosis, migration, and cell restoration from wound. In addition, overexpression of CASC2 suppressed the expression of proliferation-related proteins and migration-related proteins, including PCNA, a-SMA, MMP-2, and MMP-9. CASC2 co-transfection with si-PAPD5 had the effects as co-transfection with miR-532-3p mimics on VSMCs. In consistence with previous report, overexpression of miR-532-3p or silencing of PAPD5 could reverse CASC2-induced growth and migration inhibition of VSMCs. CASC2 could suppress cell proliferation and cell migration in VSMCs through modulating miR-532-3p/PAPD5. The schematic model of our research hypothesis was represented in Fig. 6.
Fig. 6

The schematic model of relationships between CASC2 regulating miR-532-3p/PAPD5 in the pathogenesis of atherosclerosis (AS). In the model of VSMC treated with ox-LDL, lncRNA CASC2 could compete with miR-532-3p by regulating PAPD5 participate in the proliferation and migration of VSMC, which suggest its critical roles in the pathogenesis of AS

The schematic model of relationships between CASC2 regulating miR-532-3p/PAPD5 in the pathogenesis of atherosclerosis (AS). In the model of VSMC treated with ox-LDL, lncRNA CASC2 could compete with miR-532-3p by regulating PAPD5 participate in the proliferation and migration of VSMC, which suggest its critical roles in the pathogenesis of AS

Conclusions

CASC2 suppressed cell reproduction and promoted cell apoptosis via regulating the miR-532-3p/PAPD5 axis in AS serum. This might be essential for AS therapeutics.
  29 in total

1.  PAPD5-mediated 3' adenylation and subsequent degradation of miR-21 is disrupted in proliferative disease.

Authors:  Joost Boele; Helena Persson; Jay W Shin; Yuri Ishizu; Inga S Newie; Rolf Søkilde; Shannon M Hawkins; Cristian Coarfa; Kazuhiro Ikeda; Ken-ichi Takayama; Kuniko Horie-Inoue; Yoshinari Ando; A Maxwell Burroughs; Chihiro Sasaki; Chizuru Suzuki; Mizuho Sakai; Shintaro Aoki; Ayumi Ogawa; Akira Hasegawa; Marina Lizio; Kaoru Kaida; Bas Teusink; Piero Carninci; Harukazu Suzuki; Satoshi Inoue; Preethi H Gunaratne; Carlos Rovira; Yoshihide Hayashizaki; Michiel J L de Hoon
Journal:  Proc Natl Acad Sci U S A       Date:  2014-07-21       Impact factor: 11.205

Review 2.  Vascular Smooth Muscle Cells in Atherosclerosis.

Authors:  Martin R Bennett; Sanjay Sinha; Gary K Owens
Journal:  Circ Res       Date:  2016-02-19       Impact factor: 17.367

3.  LncRNA H19 promotes atherosclerosis by regulating MAPK and NF-kB signaling pathway.

Authors:  J-X Pan
Journal:  Eur Rev Med Pharmacol Sci       Date:  2017-01       Impact factor: 3.507

4.  Expression of linear and novel circular forms of an INK4/ARF-associated non-coding RNA correlates with atherosclerosis risk.

Authors:  Christin E Burd; William R Jeck; Yan Liu; Hanna K Sanoff; Zefeng Wang; Norman E Sharpless
Journal:  PLoS Genet       Date:  2010-12-02       Impact factor: 5.917

5.  Downregulation of lncRNA CASC2 by microRNA-21 increases the proliferation and migration of renal cell carcinoma cells.

Authors:  Yunjie Cao; Renfang Xu; Xianlin Xu; Yaojun Zhou; Li Cui; Xiaozhou He
Journal:  Mol Med Rep       Date:  2016-05-24       Impact factor: 2.952

6.  Local proliferation dominates lesional macrophage accumulation in atherosclerosis.

Authors:  Clinton S Robbins; Ingo Hilgendorf; Georg F Weber; Igor Theurl; Yoshiko Iwamoto; Jose-Luiz Figueiredo; Rostic Gorbatov; Galina K Sukhova; Louisa M S Gerhardt; David Smyth; Caleb C J Zavitz; Eric A Shikatani; Michael Parsons; Nico van Rooijen; Herbert Y Lin; Mansoor Husain; Peter Libby; Matthias Nahrendorf; Ralph Weissleder; Filip K Swirski
Journal:  Nat Med       Date:  2013-08-11       Impact factor: 53.440

7.  MicroRNA-532-3p regulates mitochondrial fission through targeting apoptosis repressor with caspase recruitment domain in doxorubicin cardiotoxicity.

Authors:  J-X Wang; X-J Zhang; C Feng; T Sun; K Wang; Y Wang; L-Y Zhou; P-F Li
Journal:  Cell Death Dis       Date:  2015-03-12       Impact factor: 8.469

8.  HER2-encoded mir-4728 forms a receptor-independent circuit with miR-21-5p through the non-canonical poly(A) polymerase PAPD5.

Authors:  Inga Newie; Rolf Søkilde; Helena Persson; Thiago Jacomasso; Andrej Gorbatenko; Åke Borg; Michiel de Hoon; Stine F Pedersen; Carlos Rovira
Journal:  Sci Rep       Date:  2016-10-18       Impact factor: 4.379

9.  LncRNA-RMRP promotes carcinogenesis by acting as a miR-206 sponge and is used as a novel biomarker for gastric cancer.

Authors:  Yongfu Shao; Meng Ye; Qier Li; Weiliang Sun; Guoliang Ye; Xinjun Zhang; Yunben Yang; Bingxiu Xiao; Junming Guo
Journal:  Oncotarget       Date:  2016-06-21

Review 10.  Association between circulating oxidized low-density lipoprotein and atherosclerotic cardiovascular disease.

Authors:  Shen Gao; Jing Liu
Journal:  Chronic Dis Transl Med       Date:  2017-05-25
View more
  4 in total

1.  Contribution of FBLN5 to Unstable Plaques in Carotid Atherosclerosis via mir128 and mir532-3p Based on Bioinformatics Prediction and Validation.

Authors:  Lin Zheng; Xinyang Yue; Minhui Li; Jie Hu; Bojin Zhang; Ruijing Zhang; Guoping Zheng; Ruihan Chen; Honglin Dong
Journal:  Front Genet       Date:  2022-03-09       Impact factor: 4.599

2.  Circ_0000064 promotes high glucose-induced renal tubular epithelial cells injury to facilitate diabetic nephropathy progression through miR-532-3p/ROCK1 axis.

Authors:  Huanlan Wang; Shenghua Huang; Taotao Hu; Shizhi Fei; Huanqiao Zhang
Journal:  BMC Endocr Disord       Date:  2022-03-15       Impact factor: 2.763

Review 3.  Long non-coding RNAs: Modulators of phenotypic transformation in vascular smooth muscle cells.

Authors:  Bing-Han Lu; Hui-Bing Liu; Shu-Xun Guo; Jie Zhang; Dong-Xu Li; Zhi-Gang Chen; Fei Lin; Guo-An Zhao
Journal:  Front Cardiovasc Med       Date:  2022-08-26

4.  LncRNA BANCR induced vascular smooth muscle cell proliferation by downregulating miR-34c methylation in atherosclerosis.

Authors:  Xiao Jiang; Zhijun Liu; Xijuan Qi
Journal:  J Thromb Thrombolysis       Date:  2020-11-05       Impact factor: 2.300

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.