Literature DB >> 32686982

LncRNA DLX6-AS1 Contributes to Epithelial-Mesenchymal Transition and Cisplatin Resistance in Triple-negative Breast Cancer via Modulating Mir-199b-5p/Paxillin Axis.

Chuang Du1, Yan Wang1, Yingying Zhang1, Jianhua Zhang1, Linfeng Zhang1, Jingruo Li1.   

Abstract

Triple-negative breast cancer (TNBC) is one of the most aggressive cancer types with high recurrence, metastasis, and drug resistance. Recent studies report that long noncoding RNAs (lncRNAs)-mediated competing endogenous RNAs (ceRNA) play an important role in tumorigenesis and drug resistance of TNBC. Although elevated lncRNA DLX6 antisense RNA 1 (DLX6-AS1) has been observed to promote carcinogenesis in various cancers, the role in TNBC remained unclear. In this study, expression levels of DLX6-AS1 were increased in TNBC tissues and cell lines when compared with normal tissues or breast fibroblast cells which were determined by quantitative real-time PCR (RT-qPCR). Then, CCK-8 assay, cell colony formation assay and western blot were performed in CAL-51 cells transfected with siRNAs of DLX6-AS1 or MDA-MB-231 cells transfected with DLX6-AS1 over expression plasmids. Knock down of DLX6-AS1 inhibited cell proliferation, epithelial-mesenchymal transition (EMT), decreased expression levels of BCL2 apoptosis regulator (Bcl-2), Snail family transcriptional repressor 1 (Snail) as well as N-cadherin and decreased expression levels of cleaved caspase-3, γ-catenin as well as E-cadherin, while up regulation of DLX6-AS1 had the opposite effect. Besides, knockdown of DLX6-AS1 in CAL-51 cells or up regulation of DLX6-AS1 in MDA-MB-231 cells also decreased or increased cisplatin resistance of those cells analyzed by MTT assay. Moreover, by using dual luciferase reporter assay, RNA immunoprecipitation and RNA pull down assay, a ceRNA which was consisted by lncRNA DLX6-AS1, microRNA-199b-5p (miR-199b-5p) and paxillin (PXN) was identified. And DLX6-AS1 function through miR-199b-5p/PXN in TNBC cells. Finally, results of xenograft experiments using nude mice showed that DLX6-AS1 regulated cell proliferation, EMT and cisplatin resistance by miR-199b-5p/PXN axis in vivo. In brief, DLX6-AS1 promoted cell proliferation, EMT, and cisplatin resistance through miR-199b-5p/PXN signaling in TNBC in vitro and in vivo.

Entities:  

Keywords:  DLX6-AS1; ceRNA; miR-199b-5p; paxillin; triple-negative breast cancer

Mesh:

Substances:

Year:  2020        PMID: 32686982      PMCID: PMC7563824          DOI: 10.1177/0963689720929983

Source DB:  PubMed          Journal:  Cell Transplant        ISSN: 0963-6897            Impact factor:   4.064


Introduction

Breast cancer is the most common cancer type with the highest mortality and morbidity worldwide for women, with an estimated 2.1 million diagnoses in 2018 alone[1]. The risks of developing breast cancer are growing due to the increased exposure to the radiation and various chemicals in the environment, such as foods and personal care products containing hormones or endocrine-disrupting compounds[2]. As the most aggressive form of breast cancer[3], triple-negative breast cancer (TNBC) is characterized by a lack of expression of estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2. Due to the poor response to endocrine and targeted therapies, the recurrence and metastasis of TNBC is incredibly higher than other types of breast cancer[4]. Although chemotherapy using platinum drugs is a common option for TNBC patients, especially for those who are diagnosed at early stages[5,6], platinum drug resistance is intrinsic or triggered after several cycles of therapy[7]. Thus, it is urgent to clarify the mechanisms underlying TNBS tumorigenesis as well as platinum drug resistance with the aim to develop a new therapy strategy. Long noncoding RNAs (lncRNAs) are a type of noncoding RNAs (ncRNAs) longer than 200 bp[8]. In spite of lncRNAs containing no open reading frames, they could regulate gene expressions at transcriptional and post-transcriptional levels by regulating chromatin remodeling or interaction with other RNA species[8]. Competing endogenous RNA (ceRNA) is one important mechanism of lncRNA-mediated regulation[9]. In this hypothesis, lncRNAs could function as sponges for microRNAs (miRNAs) to decrease the expression levels of miRNAs, leading to elevated translational activity of miRNAs’ targets[10]. Accumulating studies show that lncRNAs are involved in tumorigenesis, tumor development, and drug resistance of tumors through ceRNAs[11]. lncRNA DLX6 antisense RNA 1 (DLX6-AS1) was first identified as an in-trans regulator that increases the transcriptional activity of the distal-less homeobox 5/6 (Dlx-5/6) enhancer[12]. Upregulated DLX6-AS1 level could promote carcinogenesis, progression, and stemness in glioma, renal cell carcinoma, liver cancer, and osteosarcoma via different targets[13-16]. However, its role in TNBC or breast cancer requires further investigation. In this study, we measured DLX6-AS1 expressions in TNBC patients, and animal and cell models. We found that DLX6-AS1 in TNBC promoted cell proliferation, epithelial–mesenchymal transition (EMT), and cisplatin resistance via miR-199b-5p/paxillin (PXN) axis. These results deepen our understanding on TNBC tumorigenesis and chemotherapy drug resistance, shedding lights on the development of novel strategies for TNBC treatment.

Materials and Methods

Specimen Collection, Cell Culture, and Transfection

The project was approved by the Ethics Committee of the First Affiliated Hospital of Zhengzhou University (Approval No. 2019-KY-288) and following the World Medical Association Declaration of Helsinki. Written informed consent was obtained from all patients. Forty seven tumor tissues and 28 adjacent normal tissues were collected from July 2015 to September 2017 from TNBC patients who had not received chemotherapy or radiotherapy before surgery. The collected tissues were stored immediately in liquid nitrogen until use. Human breast fibroblast cell line CCD-1095Sk and human TNBC cell lines HCC1599, MDA-MB-231, HCC1806, and HS578 T were purchased from American Type Culture Collection (ATCC, Manassas, VA, USA) and human TNBC cell line CAL-51 was ordered from Cobioer Co., Ltd (Nanjing, Jiangsu, China). Cells were cultured in Dulbecco’s modified Eagle’s medium (Gibco, Thermo Fisher Scientific [China] Co., Ltd, Shanghai, China) with 10% fetal bovine serum (Gibco, Thermo Fisher Scientific Co., Ltd, Shanghai, China), 100 units of penicillin/ml, and 100 ng of streptomycin/ml at 37°C in a 5% CO2 incubator.

Mimics and Inhibitor of miR-199b-5p, siRNA, Plasmids, and Adenovirus

Plasmids expressing DLX6-AS1, relevant siRNAs, mimics, and inhibitor of miR-199b-5p were ordered from Ribobio (Guangzhou RiboBio Co., Ltd, Guangzhou, China). Adenovirus expressing shRNA of DLX6-AS1 was produced by Hanbio Co., Ltd (Shanghai, China).

Quantitative Real-time Polymerase Chain Reaction (qRT-PCR)

Total RNAs were isolated from tissues or cells with TRIzol™ reagent (15596026, Invitrogen™, Thermo Fisher Scientific Co., Ltd, Shanghai, China) according to the manufacturer’s protocol. For miR-199b-5p, cDNA synthesis and qRT-PCR were performed with Mir-X™ miRNA qRT-PCR TB Green® Kit (638314, Takara Bio USA, Inc., CA, USA) according to the manufacturer’s protocol. For lncRNA DLX6-AS1 and PXN, RNA was reverse transcripted into cDNA. qRT-PCR was performed using TB Green® Premix Ex Taq™ II (RR820A, Takara, Takara Biomedical Technology Co., Ltd, Beijing, China). Primer sequences are listed in Table 1. Relative gene expression levels were calculated using the 2−ΔΔCt methods.
Table 1.

Primers.

PrimersSequences (5′ to 3′)
miR-199b-5p-FCCCAGTGTTTAGACTATCTGTTC
miRNA-reverseProvided by the manufacturer
PXN-FGCACAATCCTTGACCCCTTA
PXN-RAACACTGTCCTGAGGGTTGG
DLX6-AS1-FAATTGGATGGCACTGCAGC
DLX6-AS1-RAAGACTGGACAGCCATCACG[17]

DLX6-AS1: DLX6 antisense RNA 1; PXN: paxillin.

Primers. DLX6-AS1: DLX6 antisense RNA 1; PXN: paxillin.

Western Blot

Total proteins were isolated from cells or tissues using RIPA buffer (CST, Danvers, MA, USA) with 1% protease inhibitor cocktails (Pierce, Rockford, IL, USA). Concentrations of isolated proteins were measured with BCA assay kit (Thermo Fisher Scientific, Waltham, MA, USA). Ten micrograms of total proteins were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred onto polyvinylidene difluoride membranes. After blocking in 5% skimmed milk and TBST wash, membranes were incubated with primary antibodies overnight at 4°C. After washed with TBST for three times, membranes were then incubated with corresponding horseradish peroxidase-conjugated secondary antibodies at room temperature for 1 h. Bands were visualized using electrochemiluminescence (Thermo Fisher Scientific, Waltham, MA, USA) and semi-quantified with Image J (National Institutes of Health, Bethesda, MD, USA). β-Actin was used as an internal control. Primary antibodies used in this study were purchased from CST Technology, Inc.: anti-Bcl-2 (1:1,000, 15071 S); anti-cleaved caspase-3 (1:1,000, 9661 S); anti-γ-catenin (1:1,000, 75550 S); anti-Snail (1:1,000, 3879); anti-E-cadherin (1:500,14472); anti-N-cadherin (1:500, 13116); anti-PXN(1:500, 2542); and β-actin (1:2,000, 3700).

CCK-8 Assay

Cells were seeded into 96-well plates and transfection was performed 24 h post-seeding. At indicated times, 10 µl of CCK-8 reagent was added into each well and further cultured at 37°C for 2 h. Then, OD450 was measured. Samples were assessed in sextuplicate and data were obtained from three independent experiments.

Cell Viability Assay

Cell viability was assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay in 96-well plates. Indicated concentrations of cisplatin were added in the culture medium. Forty-eight hours post-seeding, 10 µl of MTT reagent was added into each well and cultured at 37°C for another 4 h. Culture medium was carefully removed, 150 µl dimethyl sulfoxide was added into each well, and plate was shaked for 10 min. Then, OD490 was measured and cell viability was calculated. Each sample was assessed in sextuplicate and data were obtained from three independent experiments.

Luciferase Reporter assay

Wild type and mutation of lncRNA DLX6-AS1 and 3′ untranslated region (UTR) of PXN with the predicted binding sites of miR-199b-5p were synthesized onto pmirGLO plasmids by Riobobio (Guangzhou RiboBio Co., Ltd). 293t cells were transfected with reporter vectors with mimics of miRNAs. Forty-eight hours post-transfection, cells were collected and lysed, and the activities of firefly and renilla luciferases were determined using the dual-luciferase reporter assay system (Promega, Madison, WI, USA). Each sample was assessed in quadruple and data were obtained from three independent experiments.

Annexin V-Fluorescein Isothiocyanate (FITC)/Propidium Iodide (PI) Staining Assay

The Annexin V-FITC/PI Apoptosis Detection Kit (Keygen Biotech, Nanjing, Jiangsu, China) was used to perform the cell apoptosis assay. Forty-eight hours after cisplatin treatment, cells were collected by centrifugation and resuspended at 5 × 105 in binding buffer. Then, 5 µl of Annexin V-FITC and 5 µl of PI were added and samples were kept at room temperature for 15 min in the dark. Finally, the staining cells were subjected to a flow cytometer (BD Accuri Cytometers, Ann Arbor, MI, USA). The experiments were performed three times.

RNA Immunoprecipitation and RNA Pull-down Assay

To perform RNA immunoprecipitation assay, anti-Ago2 (ab32381, Abcam, Cambridge, UK) and anti-IgG (ab2410, Abcam) primary antibodies were used. Experiments were performed following Abcam protocol (https://www.abcam.com/epigenetics/rna-immunoprecipitation-rip-protocol). In brief, cells were collected, and nuclei were isolated. Then, nuclei were lysed and primary antibodies were added and incubated at 4°C overnight on a rotator. Protein A agarose (ab193255, Abcam) and protein G agarose (ab193258, Abcam) were added in order to isolate the RNA immunoprecipitated with RBP. After washing, RNA was purified and reversely transcripted into cDNA, and expression levels of targets were measured by RT-qPCR as described above. To perform RNA pull-down assay, biotin-labeled wild type and mutants (MUTs) of DLX6-AS1 probes were in vitro generated using MEGAscript™ T7 Transcription Kit (Thermo Fisher Scientific, Waltham, MA, USA) and Biotin RNA Labeling Mix (Merck KGaA, Darmstadt, Germany). Probes were added into nuclei lysate and pulled down by Streptavidin Agarose (Thermo Fisher Scientific, Waltham, MA, USA). Expression levels of miR-199-5b in the pull-down complexes were determined by RT-qPCR.

Tumorigenicity Assay

All experiments using mice were in full compliance with the Guide for the Care and Use of Laboratory Animals and approved by the Ethics Committee for Scientific Research and Clinical Trials of The First Affiliated Hospital of Zhengzhou University (Approval No. 2017-KY-063). Four- to six-week-old specific pathogen-free BALB/c nude mice were purchased from Shanghai SLAC Laboratory Animal Co., Ltd (Shanghai, China). CAL-51 cells were injected subcutaneously into the flank of nude mice. Adenovirus expressing shRNA of DLX6-AS1 or scramble were intratumorally injected. Next day, cisplatin was applied once a week at 5 mg/kg. Tumor diameters were measured and volume was calculated according to lw2/2 (tumor dimensions length [l] and width [w], l > w). Finally, mice were sacrificed and tumor specimens were subjected for RT-qPCR, western blot, and ki67 immunohistochemistry analysis.

Statistical Analysis

The statistical analyses were performed using SPSS 20.0 software (SPSS, Inc., Chicago, IL, USA). Data were shown as means ± SD. Differences between groups were calculated using Student’s t-test for two groups or Tukey’s multiple comparisons test after analysis-of-variance test for three or more groups. P < 0.05 was considered statistically significant in this study.

Results

DLX6-AS1 Level Was Increased in TNBC Patients’ Tissues and Cell Models

To explore the role of DLX6-AS1 in TNBC, expression levels of DLX6-AS1 were first assessed in TNBC tissues by RT-qPCR. We observed that DLX6-AS1 was significantly upregulated in patients’ tissues (Fig. 1A) as well as in TNBC cell lines (Fig. 1B).
Fig. 1.

Expression levels of DLX6-AS1 are increased in TNBC tissues and cells. (A) Expression levels of DLX6-AS1 in 47 TNBC tissues (tumor) and 28 adjacent normal tissues (normal) were determined by RT-qPCR. (B) Expression levels of DLX6-AS1 in different cell lines were determined by RT-qPCR (*, P < 0.05; **, P < 0.01). DLX6-AS1: DLX6 antisense RNA 1; RT-qPCR: quantitative real-time polymerase chain reaction; TNBC: triple-negative breast cancer.

Expression levels of DLX6-AS1 are increased in TNBC tissues and cells. (A) Expression levels of DLX6-AS1 in 47 TNBC tissues (tumor) and 28 adjacent normal tissues (normal) were determined by RT-qPCR. (B) Expression levels of DLX6-AS1 in different cell lines were determined by RT-qPCR (*, P < 0.05; **, P < 0.01). DLX6-AS1: DLX6 antisense RNA 1; RT-qPCR: quantitative real-time polymerase chain reaction; TNBC: triple-negative breast cancer.

lncRNA DLX6-AS1 Regulated Cell Growth and EMT in TNBC Cells

Plasmids expressing DLX6-AS1 or relevant siRNA were constructed to increase or knock down expression of DLX6-AS1 in TNBC cells. Given MDA-MB-231 cells showed the lowest increase of DLX6-AS1 in our tested cell lines, whereas CAL-51 cells had the highest, and those two cell lines were chosen for further experiments. RT-qPCR showed that siRNAs significantly decreased DLX6-AS1 expression level in CAL-51 cells, whereas plasmids expressing DLX6-AS1 increased DLX6-AS1 expression levels in MDA-MB-231 cells (Fig. 2A). To assess the effects of DLX6-AS1 on cell growth ability, CCK-8 assay and colony formation assay were performed. CCK-8 assay demonstrated that DLX6-AS1 silence in CAL-51 cells by siRNAs markedly inhibited cell growth, whereas elevated DLX6-AS1 in MDA-MB-231 cells significantly promoted cell proliferation (Fig. 2B). Colony formation assay showed the similar results, and the relative colony numbers were reduced in siRNA-transfected CAL-51 cells, which were increased in MDA-MB-231 cells transiently overexpressing DLX6-AS1 (Fig. 2C), indicating that lncRNA DLX6-AS1 altered EMT of TNBC cells. Therefore, the key proteins involved in cell apoptosis and EMT were investigated through western blot. Cleaved caspase-3 is the key executioner of cell apoptosis, while Bcl-2 was the inhibitor of apoptosis. E-cadherin and γ-catenin were considered as inhibitors of EMT, whereas N-cadherin and Snail promoted EMT. DLX6-AS1 knockdown decreased protein levels of Bcl-2, Snail, and N-cadherin, whereas cleaved caspase-3, γ-catenin, and E-cadherin expressions were increased. In addition, lncRNA DLX6-AS1 overexpression exhibited opposite effect (Fig. 2D). Collectively, these results illustrated that elevated DLX6-AS1 enhanced cell growth and EMT and inhibited apoptosis of TNBC cells, whereas DLX6-AS1 silence suppressed cell growth and EMT and promoted apoptosis.
Fig. 2.

Long noncoding RNA DLX6-AS1 regulates cell proliferation, epithelial–mesenchymal transition, and cell apoptosis in TNBC cells. (A) Expression levels of DLX6-AS1 in TNBC cells transfected with siRNAs or overexpression plasmids of DLX6-AS1 were determined by RT-qPCR. (B) Cell growth of CAL-51 cells transfected with siRNA (siDLX6-AS1) or control of siRNA (siNC) and MDA-MB-231 cells transfected with DLX6-AS1 overexpression plasmids (pcDNA3.1-DLX6-AS1) or control (pcDNA3.1-NC) were determined by Cell Counting Kit-8 assay. (C) Cell colony formation was performed. Representative pictures of cell colony are shown. Numbers of cell colony were counted. (D) Protein levels of Bcl-2, cleaved caspase-3, γ-catenin, Snail, E-cadherin, and N-cadherin in cells transfected with siRNA or overexpression plasmids of DLX6-AS1 were determined by western blot. Gray values of bands were analyzed by Image J and normalized to β-actin. (**, P < 0.01). DLX6-AS1: DLX6 antisense RNA 1; RT-qPCR: quantitative real-time polymerase chain reaction; TNBC: triple-negative breast cancer.

Long noncoding RNA DLX6-AS1 regulates cell proliferation, epithelial–mesenchymal transition, and cell apoptosis in TNBC cells. (A) Expression levels of DLX6-AS1 in TNBC cells transfected with siRNAs or overexpression plasmids of DLX6-AS1 were determined by RT-qPCR. (B) Cell growth of CAL-51 cells transfected with siRNA (siDLX6-AS1) or control of siRNA (siNC) and MDA-MB-231 cells transfected with DLX6-AS1 overexpression plasmids (pcDNA3.1-DLX6-AS1) or control (pcDNA3.1-NC) were determined by Cell Counting Kit-8 assay. (C) Cell colony formation was performed. Representative pictures of cell colony are shown. Numbers of cell colony were counted. (D) Protein levels of Bcl-2, cleaved caspase-3, γ-catenin, Snail, E-cadherin, and N-cadherin in cells transfected with siRNA or overexpression plasmids of DLX6-AS1 were determined by western blot. Gray values of bands were analyzed by Image J and normalized to β-actin. (**, P < 0.01). DLX6-AS1: DLX6 antisense RNA 1; RT-qPCR: quantitative real-time polymerase chain reaction; TNBC: triple-negative breast cancer.

lncRNA DLX6-AS1 Regulated Cisplatin Resistance of TNBC Cells

To determine the effect of lncRNA DLX6-AS1 on cisplatin resistance in TNBC cells, the half-maximal inhibitory concentrations (IC50) of CAL-51 and MDA-MB-231 cells under cisplatin treatment were measured by MTT assay. As shown in Fig. 3, DLX6-AS1 silence in CAL-51 cells shifted IC50 of cisplatin from 8.192 to 3.335 μM, whereas DLX6-AS1 overexpression in MDA-MB-231 cells increased IC50 of cisplatin from 18.420 to 48.260 μM, suggesting that DLX6-AS1 contributed to the cisplatin resistance in TNBC cells and DLX6-AS1 knockdown increased the cisplatin sensitivity in TNBC cells.
Fig. 3.

Long noncoding RNA DLX6-AS1 regulates cisplatin resistance of triple-negative breast cancer cells. (A) IC50 of CAL-51 cells transfected with siDLX6-AS1 to cisplatin were determined by MTT assay. (B) Half-maximal inhibitory concentration (IC50) of MDA-MB-231 cells transfected with DLX6-AS1 overexpression plasmids to cisplatin were determined by MTT assay. DLX6-AS1: DLX6 antisense RNA 1; IC50: half-maximal inhibitory concentration; MTT: 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide.

Long noncoding RNA DLX6-AS1 regulates cisplatin resistance of triple-negative breast cancer cells. (A) IC50 of CAL-51 cells transfected with siDLX6-AS1 to cisplatin were determined by MTT assay. (B) Half-maximal inhibitory concentration (IC50) of MDA-MB-231 cells transfected with DLX6-AS1 overexpression plasmids to cisplatin were determined by MTT assay. DLX6-AS1: DLX6 antisense RNA 1; IC50: half-maximal inhibitory concentration; MTT: 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide.

lncRNA DLX6-AS1 Binds with miR-199b-5p in TNBC Cells

Through Mircode website (http://mircode.org/index.php), we predicted that miR-199b-5p might be one of the miRNAs that bind to lncRNA DLX6-AS1 (Fig. 4A). We constructed relevant plasmids, and co-transfected miR-199b-5p with pmirGLO plasmids containing wild type (WT) or MUT of lncRNA DLX6-AS1. Combination of miR-199b-5p and WT indeed decreased the relative luciferase activity in dual luciferase reporter assay (Fig. 4B). Moreover, RNA immunoprecipitation assay was performed with anti-ago2 primary antibody. Expressions of lncRNA DLX6-AS1 and miR-199b-5p were highly enriched in the Ago2 group (Fig. 4C). Meanwhile, biotin-labeled lncRNA DLX6-AS1 probe was utilized to perform RNA pull-down assay, miR-199b-5p was highly enriched in lncRNA DLX6-AS1 WT probe group, whereas miR-199b-5p level in DLX6-AS1 MUT group was similar to that in the negative control (Fig. 4D). These results indicated that lncRNA DLX6-AS1 binds to miR-199b-5p, and miR-199b-5p level was increased upon lncRNA DLX6-AS1 knockdown (Fig. 4E). We speculated that DLX6-AS1 negatively regulated the expression of miR-199b-5p by direct binding.
Fig. 4.

ncRNA DLX6-AS1 binds with miR-199b-5p and regulates expression levels of miR-199-5p. (A) Predicted binding sites of miR-199b-5p on lncRNA DLX6-AS1 are shown. (B) Dual luciferase reporter assay was performed. Relative luciferase activities of the cells transfected with indicated lncRNA and mimics of miRNA were measured. (C) RNA immunoprecipitation was performed using anti-ago2 or anti-IgG primary antibodies. Relative expression levels of miR-199b-5p or lncRNA DLX6-AS1 in the immunoprecipitated complex were determined by RT-qPCR. (D) Expression levels of miR-199b-5p were determined by RT-qPCR in the complex pulled down by the biotin-labeled DLX6-AS1 probes. (E) Expression levels of miR-199b-5p were determined by RT-qPCR in the cells transfected with siDLX6-AS1 or siNC (**, P < 0.01). DLX6-AS1: DLX6 antisense RNA 1; IgG: immunoglobulin G; lncRNA: long noncoding RNA; miRNA: microRNA; MUT: mutated; RT-qPCR: quantitative real-time polymerase chain reaction; WT: wild type.

ncRNA DLX6-AS1 binds with miR-199b-5p and regulates expression levels of miR-199-5p. (A) Predicted binding sites of miR-199b-5p on lncRNA DLX6-AS1 are shown. (B) Dual luciferase reporter assay was performed. Relative luciferase activities of the cells transfected with indicated lncRNA and mimics of miRNA were measured. (C) RNA immunoprecipitation was performed using anti-ago2 or anti-IgG primary antibodies. Relative expression levels of miR-199b-5p or lncRNA DLX6-AS1 in the immunoprecipitated complex were determined by RT-qPCR. (D) Expression levels of miR-199b-5p were determined by RT-qPCR in the complex pulled down by the biotin-labeled DLX6-AS1 probes. (E) Expression levels of miR-199b-5p were determined by RT-qPCR in the cells transfected with siDLX6-AS1 or siNC (**, P < 0.01). DLX6-AS1: DLX6 antisense RNA 1; IgG: immunoglobulin G; lncRNA: long noncoding RNA; miRNA: microRNA; MUT: mutated; RT-qPCR: quantitative real-time polymerase chain reaction; WT: wild type.

PXN Was a Target of miR-199b-5p in TNBC Cells

It is reported that miRNAs regulate the expression levels of genes by directly targeting with their 3′ UTR. By using the Targetscan website (http://www.targetscan.org/vert_71/), PXN was predicted as one potential target of miR-199b-3p (Fig. 5A). Combination expression of mimics of miR-199b-5p and pmirGLO plasmids containing WT 3′ UTR of PXN showed a decreased luciferase activity (Fig. 5B). To further investigate the effect of miR-199b-5p on PXN expression, CAL-51 cells were transfected with mimics of miR-199-5p to enforce miR-199-5b level (Fig. 5C). We observed that mRNA and protein levels of PXN were significantly decreased in response to mimics of miR-199-5p (Fig. 5D, E). These results demonstrated that miR-199b-5p binds to PXN to negatively regulate PXN expression in TNBC cells.
Fig. 5.

miR-199b-5p binds to 3′ UTR of PXN and regulated expression levels of PXN. (A) Predicted binding sites of miR-199b-5p on 3′ UTR of PXN were shown. (B) Dual luciferase reporter assay. Relative luciferase activities of the cells transfected with indicated plasmids and mimics of miRNA were measured. (C) Expression levels of miR-199b-5p were determined by RT-qPCR in CAL-51 cells transfected with mimics of miR-199b-5p or control (miR-NC). (D) mRNA levels of PXN were determined by RT-qPCR in the CAL-51 cells transfected with mimics of miR-199b-5p or miR-NC. (E) Protein levels of PXN were determined by western blot in the CAL-51 cells transfected with mimics of miR-199b-5p or miR-NC. Gray values of bands were analyzed by Image J and normalized to β-actin (**, P < 0.01). miRNA: microRNA; PXN: paxillin; RT-qPCR: quantitative real-time polymerase chain reaction; UTR: untranslated region; WT: wild type.

miR-199b-5p binds to 3′ UTR of PXN and regulated expression levels of PXN. (A) Predicted binding sites of miR-199b-5p on 3′ UTR of PXN were shown. (B) Dual luciferase reporter assay. Relative luciferase activities of the cells transfected with indicated plasmids and mimics of miRNA were measured. (C) Expression levels of miR-199b-5p were determined by RT-qPCR in CAL-51 cells transfected with mimics of miR-199b-5p or control (miR-NC). (D) mRNA levels of PXN were determined by RT-qPCR in the CAL-51 cells transfected with mimics of miR-199b-5p or miR-NC. (E) Protein levels of PXN were determined by western blot in the CAL-51 cells transfected with mimics of miR-199b-5p or miR-NC. Gray values of bands were analyzed by Image J and normalized to β-actin (**, P < 0.01). miRNA: microRNA; PXN: paxillin; RT-qPCR: quantitative real-time polymerase chain reaction; UTR: untranslated region; WT: wild type.

DLX6-AS1 Regulated Cell Proliferation, EMT, and Cisplatin Resistance Through miR-199b-5p/PXN Axis

To determine whether lncRNA DLX6-AS1 functions through miR-199b-5p/PXN axis, inhibitor of miR-199b-5p was employed. miR-199b-5p inhibitor not only promoted cell proliferation, but also abolished the siDLX6-AS1-mediated effects (Fig. 6A, B). miR-199b-5p inhibitor could significantly increase PXN, Bcl-2, Snail, and N-cadherin expressions and decrease cleaved caspase-3, γ-catenin, and E-cadherin levels (Fig. 6C). As stated previously, siDLX6-AS1 mediated reduction of Bcl-2, Snail, as well as N-cadherin levels, and elevation of cleaved caspase-3, γ-catenin, as well as E-cadherin. Interestingly, miR-199b-5p inhibitor remitted siDLX6-AS1-induced changes in co-transfection with siDLX6-AS1 (Fig. 6C). Under cisplatin treatment, miR-199b-5p inhibitor increased cisplatin tolerance and abolished siDLX6-AS1-mediated cisplatin sensitivity (Fig. 6D). Taken together, lncRNA DLX6-AS1 regulates cell proliferation, EMT, and cisplatin resistance via miR-199b-5p/PXN axis in vitro.
Fig. 6.

Long noncoding RNA DLX6-AS1 regulated cell proliferation, epithelial–mesenchymal transition, and cisplatin resistance through miR-199b-5p/PXN axis. (A) Cell growth was determined by Cell Counting Kit-8 assay. (B) Cell colony formation was performed. Representative pictures of cell colony are shown. Numbers of cell colony were counted. (C) Protein levels of PXN, Bcl-2, cleaved caspase-3, γ-catenin, Snail, E-cadherin, and N-cadherin in cells transfected with siRNA or inhibitor of miR-199b-5p were determined by western blot. Gray values of bands were analyzed by Image J and normalized to β-actin. (D) Transfection siRNAs or inhibitor of miR-199b-5p into cells affected cell viability in response to cisplatin (*, P < 0.05; **, P < 0.01). DLX6-AS1: DLX6 antisense RNA 1; PXN: paxillin; siRNA: .

Long noncoding RNA DLX6-AS1 regulated cell proliferation, epithelial–mesenchymal transition, and cisplatin resistance through miR-199b-5p/PXN axis. (A) Cell growth was determined by Cell Counting Kit-8 assay. (B) Cell colony formation was performed. Representative pictures of cell colony are shown. Numbers of cell colony were counted. (C) Protein levels of PXN, Bcl-2, cleaved caspase-3, γ-catenin, Snail, E-cadherin, and N-cadherin in cells transfected with siRNA or inhibitor of miR-199b-5p were determined by western blot. Gray values of bands were analyzed by Image J and normalized to β-actin. (D) Transfection siRNAs or inhibitor of miR-199b-5p into cells affected cell viability in response to cisplatin (*, P < 0.05; **, P < 0.01). DLX6-AS1: DLX6 antisense RNA 1; PXN: paxillin; siRNA: .

lncRNA DLX6-AS1 Promoted Tumorigenesis Through miR-199b-5p/PXN Axis In Vivo

Role of DLX6-AS1 in vivo was further verified in vivo. Xenograft mice models were generated as previously described. Results showed that tumor size in xenografts received combined treatments of lncRNA DLX6-AS1 siRNA and cisplatin was smaller than those in the lncRNA DLX6-AS1 siRNA and cisplatin groups (Fig. 7A). Furthermore, we assessed PXN level in tumors using western blot. Results showed that DLX6-AS1 silence indeed decreased PXN expression in tumors and cisplatin treatment alone did not alter PXN level (Fig. 7B). We also assessed the expression of Ki67, a valuable marker of proliferation in tumors. Results showed that either DLX6-AS1 knockdown or cisplatin treatment could significantly suppress Ki67 level compared with negative control. And co-treatment of DLX6-AS1 siRNA and cisplatin injection inhibited Ki67 much more than two single treatments (Fig. 7C). To sum up, these results revealed that DLX6-AS1 knockdown inhibited tumor growth and increased cisplatin sensitivity in vivo.
Fig. 7.

Long noncoding RNA DLX6-AS1 regulated xenografted tumor growth in vivo. (A) Representative images of tumor xenografts and tumor growth curves are shown. Ad-shNC+PBS: negative control; Ad-shDLX6-AS1: tumors injected with adenovirus expressing shRNA of DLX6-AS1; Ad-shNC+DPP: applying with cisplatin; Ad-shDLX6-AS1+DPP: injected with adenovirus expressing shRNA of DLX6-AS1 combined with applying with cisplatin. (B) Protein levels of paxillin in xenografts were determined by western blot. Gray values of bands were analyzed by Image J and normalized to β-actin. (C) Representative images of ki67 immunohistochemical staining of xenografts are shown (magnification, 100× or 400×) (**, P < 0.01). DLX6-AS1: DLX6 antisense RNA 1; PBS: phosphate-buffered saline; shRNA: .

Long noncoding RNA DLX6-AS1 regulated xenografted tumor growth in vivo. (A) Representative images of tumor xenografts and tumor growth curves are shown. Ad-shNC+PBS: negative control; Ad-shDLX6-AS1: tumors injected with adenovirus expressing shRNA of DLX6-AS1; Ad-shNC+DPP: applying with cisplatin; Ad-shDLX6-AS1+DPP: injected with adenovirus expressing shRNA of DLX6-AS1 combined with applying with cisplatin. (B) Protein levels of paxillin in xenografts were determined by western blot. Gray values of bands were analyzed by Image J and normalized to β-actin. (C) Representative images of ki67 immunohistochemical staining of xenografts are shown (magnification, 100× or 400×) (**, P < 0.01). DLX6-AS1: DLX6 antisense RNA 1; PBS: phosphate-buffered saline; shRNA: .

Discussion

Although various lncRNAs have been identified in TNBC through lncRNA arrays, the precise functions and underlying mechanisms of these lncRNAs in TNBC development and progression remain largely unclear[18]. In this study, we observed that lncRNA DLX6-AS1 expression levels were significantly upregulated in TNBC tissues and cell lines. Such increased lncRNA DLX6-AS1 promoted cell proliferation, EMT, and cisplatin resistance in vitro and in vivo via miR-199b-5p/PXN axis. So far, only a few lncRNAs in TNBC have been studied in detail, indicating that lncRNAs could not only function as biomarkers for diagnosis or prognosis, but also serve as regulators in tumorigenesis, progression, and drug resistance in TNBC[19]. The aggressiveness, frequent distant metastasis, lack of targeted therapies, poor understanding of mechanism, and low response to chemotherapy of TNBC resulted in high mortality rate[20]. Thus, investigation of underlying mechanisms of lncRNAs regarding tumorigenesis and chemotherapy drug resistance of TNBC might shed lights on development of new and effective therapy strategies. Previous studies have reported that several lncRNAs, such as pvt1 oncogene (PVT1)[21], imprinted maternally expressed transcript (H19)[22], as well as long intergenic noncoding RNA for kinase activation (LINK-A)[23] were aberrantly expressed in TNBC, which regulated tumor growth, metastasis, and chemosensitivity. Upregulation of H19 in TNBC increased paclitaxel resistance via AKT serine/threonine kinase pathway[22]. LINK-A in TNBC promoted breast cancer glycolysis reprogramming and tumorigenesis through hypoxia inducible factor 1 subunit alpha signaling[23]. Here, we found that DLX6-AS1 level was significantly increased in TNBC tissues and cell lines compared to adjacent normal tissues and breast fibroblast cells. CCK-8 assay and cell colony formation assay revealed that elevated DLX6-AS1 promoted cell growth in TNBC cells. Decreased cleaved caspase-3 as well as increased Bcl-2 confirmed that cell apoptosis was inhibited by DLX6-AS1. Similar function of DLX6-AS1 was observed in glioma, renal cell carcinoma, esophageal squamous cell carcinoma, osteosarcoma, and lung adenocarcinoma[15,24-27]. In conclusion, these results demonstrated that DLX6-AS1 played a key role in TNBC progression, functioning as an oncogene in cancer. Colony formation assay also indicated that DLX6-AS1 promoted EMT, a premetastatic process. Recently illustrated lncRNAs rapidly emerged as key regulators of EMT in various types of cancers as reviewed by Heery et al.[28]. And Fu et al.[29] found that DLX6-AS1 promoted EMT in gastric cancer. Further analysis of biomarkers of EMT by western blot showed that Snail and N-cadherin expressions were increased, whereas γ-Catenin and E-cadherin levels were decreased in TNBC cells overexpressing DLX6-AS1. These results suggested that DLX6-AS1 resulted in loss of epithelial phenotype and acquisition of mesenchymal properties, which were crucial for metastasis[30]. As inhibition of metastasis could improve the outcome of TNBC, novel drugs and therapy strategies based on the inhibition of metastasis are developing[31]. We discovered that DLX6-AS1 might be considered as a potential target for inhibition of metastasis of TNBC. More importantly, we found that elevated DLX6-AS1 increased cisplatin resistance in TNBC in vitro and in vivo. Clinical trials that included platinum-based regimens into neoadjuvant chemotherapy showed that platinum salts supplement might be beneficial for TNBC patients[32]. However, the intrinsic or acquired platinum resistance made the outcome uncertain[33]. Thus, considerable efforts have been made to find out the biomarkers for diagnosis and the mechanisms of drug resistance to enhance the drug efficacy for TNBC[34]. Recent studies suggested lncRNA might mediate drug resistance[35]. For instance, lncRNA urothelial carcinoma associated 1 was related with drug resistance in bladder cancer, breast cancer, lung cancer, gastric cancer, hepatocellular carcinoma, as well as ovarian cancer[36]. Our findings that DLX6-AS1 might function as a biomarker for cisplatin resistance might provide a target for overcoming drug resistance. Besides, we also found that DLX6-AS1 functions through miR-199b-5p/PXN axis in TNBC. However, the importance of this ceRNA pathway in TNBC needs further investigations, as both the lncRNAs and miRNAs could have multiple targets. Previous studies showed that DLX6-AS1 could bind to miR-613, miR-197-5p, miR-26a, and miR-129-5p, while miR-199b-5p could directly target with discoidin domain receptor 1 (DDR1)[37], regulator of G protein signaling 17 (RGS17)[38], kallikrein-related peptidase 10 (KLK10)[39], and so on. Although we also found corresponding changes in the expression levels of miR-199b-5p/PXN in xenografts, the precise functions of DLX6-AS1 through miR-199b-5p/PXN or other signal pathways mentioned above need careful assessment. In conclusion, this study reported that lncRNA DLX6-AS1 was upregulated in TNBC patients and cell models, serving an oncogenic role and enhancing cisplatin resistance of TNBC in vitro and in vivo, providing insights into DLX6-AS1 as a novel therapeutic target for TNBC treatment from bench to clinic.
  35 in total

Review 1.  State of the evidence 2017: an update on the connection between breast cancer and the environment.

Authors:  Janet M Gray; Sharima Rasanayagam; Connie Engel; Jeanne Rizzo
Journal:  Environ Health       Date:  2017-09-02       Impact factor: 5.984

2.  LncRNA DLX6-AS1/miR-129-5p/DLK1 axis aggravates stemness of osteosarcoma through Wnt signaling.

Authors:  Rong-Mou Zhang; Ting Tang; Hai-Ming Yu; Xue-Dong Yao
Journal:  Biochem Biophys Res Commun       Date:  2018-11-13       Impact factor: 3.575

Review 3.  Long noncoding RNAs (lncRNAs) in triple negative breast cancer.

Authors:  Qiuhong Wang; Sheng Gao; Haibo Li; Mingming Lv; Cheng Lu
Journal:  J Cell Physiol       Date:  2017-02-21       Impact factor: 6.384

Review 4.  Role of long non-coding RNA in tumor drug resistance.

Authors:  Heng Deng; Jun Zhang; JinJun Shi; ZhengDong Guo; ChunRong He; Li Ding; Jin Hai Tang; Yong Hou
Journal:  Tumour Biol       Date:  2016-07-05

5.  The LINK-A lncRNA activates normoxic HIF1α signalling in triple-negative breast cancer.

Authors:  Aifu Lin; Chunlai Li; Zhen Xing; Qingsong Hu; Ke Liang; Leng Han; Cheng Wang; David H Hawke; Shouyu Wang; Yanyan Zhang; Yongkun Wei; Guolin Ma; Peter K Park; Jianwei Zhou; Yan Zhou; Zhibin Hu; Yubin Zhou; Jeffery R Marks; Han Liang; Mien-Chie Hung; Chunru Lin; Liuqing Yang
Journal:  Nat Cell Biol       Date:  2016-01-11       Impact factor: 28.824

6.  STAT3 as a potential therapeutic target in triple negative breast cancer: a systematic review.

Authors:  Jiang-Jiang Qin; Li Yan; Jia Zhang; Wei-Dong Zhang
Journal:  J Exp Clin Cancer Res       Date:  2019-05-14

7.  Long noncoding RNA DLX6-AS1 promotes liver cancer by increasing the expression of WEE1 via targeting miR-424-5p.

Authors:  Dan Li; Xianbin Tang; Man Li; Yi Zheng
Journal:  J Cell Biochem       Date:  2019-02-25       Impact factor: 4.429

Review 8.  Breast Cancer Treatment: A Review.

Authors:  Adrienne G Waks; Eric P Winer
Journal:  JAMA       Date:  2019-01-22       Impact factor: 56.272

Review 9.  The fate of chemoresistance in triple negative breast cancer (TNBC).

Authors:  Elma A O'Reilly; Luke Gubbins; Shiva Sharma; Riona Tully; Matthew Ho Zhing Guang; Karolina Weiner-Gorzel; John McCaffrey; Michele Harrison; Fiona Furlong; Malcolm Kell; Amanda McCann
Journal:  BBA Clin       Date:  2015-03-12

Review 10.  Long Non-Coding RNAs: Key Regulators of Epithelial-Mesenchymal Transition, Tumour Drug Resistance and Cancer Stem Cells.

Authors:  Richard Heery; Stephen P Finn; Sinead Cuffe; Steven G Gray
Journal:  Cancers (Basel)       Date:  2017-04-21       Impact factor: 6.639

View more
  17 in total

Review 1.  Promising long noncoding RNA DLX6-AS1 in malignant tumors.

Authors:  Chen Xue; Longxian Lv; Jiangwen Jiang; Lanjuan Li
Journal:  Am J Transl Res       Date:  2020-12-15       Impact factor: 4.060

2.  Yin Yang 1-induced activation of LINC01133 facilitates the progression of pancreatic cancer by sponging miR-199b-5p to upregulate myelin regulatory factor expression.

Authors:  Xi Yang; Leiming Wang; Fei Zhou; Song Ye; Qianghu Sun
Journal:  Bioengineered       Date:  2022-05       Impact factor: 6.832

Review 3.  Strategies of LncRNA DLX6-AS1 on Study and Therapeutics.

Authors:  Yanyan Zhao; Pei Li
Journal:  Front Genet       Date:  2022-06-01       Impact factor: 4.772

4.  The Curcumin Analog EF24 Inhibits Proliferation and Invasion of Triple-Negative Breast Cancer Cells by Targeting the Long Noncoding RNA HCG11/Sp1 Axis.

Authors:  Yin Duan; Hui-Ling Chen; Min Ling; Shuo Zhang; Fei-Xia Ma; Hong-Chen Zhang; Xiao-Ai Lv
Journal:  Mol Cell Biol       Date:  2021-11-15       Impact factor: 5.069

Review 5.  Research progress of DLX6-AS1 in human cancers.

Authors:  Yalan Luo; Peng Ge; Mengfei Wang; Haiyang Chen; Jiayue Liu; Tianfu Wei; Yuankuan Jiang; Jialin Qu; Hailong Chen
Journal:  Hum Cell       Date:  2021-09-11       Impact factor: 4.374

Review 6.  The Biological Roles of Exosomal Long Non-Coding RNAs in Cancers.

Authors:  Miao Da; Hao Jiang; Yangyang Xie; Weili Jin; Shuwen Han
Journal:  Onco Targets Ther       Date:  2021-01-12       Impact factor: 4.147

7.  LINC00665 Stimulates Breast Cancer Progression via Regulating miR-551b-5p.

Authors:  Liqiang Qi; Bo Sun; Beibei Yang; Su Lu
Journal:  Cancer Manag Res       Date:  2021-02-05       Impact factor: 3.989

Review 8.  Epigenetic Alterations in Triple-Negative Breast Cancer-The Critical Role of Extracellular Matrix.

Authors:  Vasiliki Zolota; Vasiliki Tzelepi; Zoi Piperigkou; Helen Kourea; Efthymia Papakonstantinou; Μaria-Ioanna Argentou; Nikos K Karamanos
Journal:  Cancers (Basel)       Date:  2021-02-09       Impact factor: 6.639

9.  Regulation of Oncogenic Targets by the Tumor-Suppressive miR-139 Duplex (miR-139-5p and miR-139-3p) in Renal Cell Carcinoma.

Authors:  Reona Okada; Yusuke Goto; Yasutaka Yamada; Mayuko Kato; Shunichi Asai; Shogo Moriya; Tomohiko Ichikawa; Naohiko Seki
Journal:  Biomedicines       Date:  2020-12-12

10.  Pan-cancer analysis reveals an immunological role and prognostic potential of PXN in human cancer.

Authors:  Yun Chen; Han Zhao; Yan Xiao; Peijun Shen; Li Tan; Shaohui Zhang; Qiong Liu; Zhengrong Gao; Jie Zhao; Yaqiong Zhao; Yue Guo; Yunzhi Feng
Journal:  Aging (Albany NY)       Date:  2021-06-16       Impact factor: 5.682

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.