Zeyad D Nassar1,2, Chui Yan Mah1,2, Jonas Dehairs3, Ingrid Jg Burvenich4, Swati Irani1,2, Margaret M Centenera1,2, Madison Helm1,2, Raj K Shrestha5, Max Moldovan2, Anthony S Don6, Jeff Holst7, Andrew M Scott4, Lisa G Horvath8, David J Lynn2,9, Luke A Selth1,5,9, Andrew J Hoy10, Johannes V Swinnen3, Lisa M Butler1,2. 1. University of Adelaide Medical School and Freemasons Foundation Centre for Men's Health, University of Adelaide, Adelaide, Australia. 2. South Australian Health and Medical Research Institute, Adelaide, Australia. 3. KU Leuven- University of Leuven, LKI- Leuven Cancer Institute, Department of Oncology, Laboratory of Lipid Metabolism and Cancer, Leuven, Belgium. 4. Tumour Targeting Laboratory, Olivia Newton-John Cancer Research Institute, and School of Cancer Medicine, La Trobe University, Melbourne, Australia. 5. Dame Roma Mitchell Cancer Research Laboratories, University of Adelaide, Adelaide, Australia. 6. NHMRC Clinical Trials Centre, and Centenary Institute, The University of Sydney, Camperdown, Australia. 7. Translational Cancer Metabolism Laboratory, School of Medical Sciences and Prince of Wales Clinical School, UNSW Sydney, Sydney, Australia. 8. Garvan Institute of Medical Research, NSW 2010; University of Sydney, NSW 2006; and University of New South Wales, Darlinghurst, Australia. 9. College of Medicine and Public Health, Flinders University, Bedford Park, Australia. 10. Discipline of Physiology, School of Medical Sciences, Charles Perkins Centre, Faculty of Medicine and Health, The University of Sydney, Camperdown, Australia.
Abstract
Fatty acid β-oxidation (FAO) is the main bioenergetic pathway in human prostate cancer (PCa) and a promising novel therapeutic vulnerability. Here we demonstrate therapeutic efficacy of targeting FAO in clinical prostate tumors cultured ex vivo, and identify DECR1, encoding the rate-limiting enzyme for oxidation of polyunsaturated fatty acids (PUFAs), as robustly overexpressed in PCa tissues and associated with shorter relapse-free survival. DECR1 is a negatively-regulated androgen receptor (AR) target gene and, therefore, may promote PCa cell survival and resistance to AR targeting therapeutics. DECR1 knockdown selectively inhibited β-oxidation of PUFAs, inhibited proliferation and migration of PCa cells, including treatment resistant lines, and suppressed tumor cell proliferation and metastasis in mouse xenograft models. Mechanistically, targeting of DECR1 caused cellular accumulation of PUFAs, enhanced mitochondrial oxidative stress and lipid peroxidation, and induced ferroptosis. These findings implicate PUFA oxidation via DECR1 as an unexplored facet of FAO that promotes survival of PCa cells.
Fatty acid β-oxidation (FAO) is the main bioenergetic pathway in human prostate cancer (PCa) and a promising novel therapeutic vulnerability. Here we demonstrate therapeutic efficacy of targeting FAO in clinical prostate tumors cultured ex vivo, and identify DECR1, encoding the rate-limiting enzyme for oxidation of polyunsaturated fatty acids (PUFAs), as robustly overexpressed in PCa tissues and associated with shorter relapse-free survival. DECR1 is a negatively-regulated androgen receptor (AR) target gene and, therefore, may promote PCa cell survival and resistance to AR targeting therapeutics. DECR1 knockdown selectively inhibited β-oxidation of PUFAs, inhibited proliferation and migration of PCa cells, including treatment resistant lines, and suppressed tumor cell proliferation and metastasis in mouse xenograft models. Mechanistically, targeting of DECR1 caused cellular accumulation of PUFAs, enhanced mitochondrial oxidative stress and lipidperoxidation, and induced ferroptosis. These findings implicate PUFA oxidation viaDECR1 as an unexplored facet of FAO that promotes survival of PCa cells.
Prostate cancer (PCa) is the most prevalent male cancer and the second leading cause of cancer deaths in men in Western societies (Bray et al., 2018). For patients with locally-recurrent and/or metastatic disease, androgen deprivation therapy (ADT) has remained the frontline strategy for clinical management since the 1940s (Huggins and Hodges, 1941), due to the dependence of PCa cells on androgens for growth and survival. Although ADT is initially effective in most patients, ultimately all will relapse with castration resistant prostate cancer (CRPC), which remains incurable. The failure of ADT is attributed to the emergence of adaptive survival pathways that reprogram androgen signaling and/or activate alternative tumor survival pathways. Consequently, the development and FDA approval of agents that more effectively target androgen signaling, includingenzalutamide (ENZ, Xtandi; an AR antagonist) (Tran et al., 2009; Cai and Balk, 2011; Rodrigues et al., 2014), has expanded the therapeutic options for CRPC. Nevertheless, even these approaches cannot durably control tumor growth and there is considerable variability in the nature and duration of responses between different patients (Tran et al., 2009; Scher et al., 2012; Davis et al., 2019). Thus, alternative therapeutic strategies that enhance response to ADT, and thereby prevent or delay PCa progression to CRPC, are essential.Increasingly, targeting cancer cell metabolism is a focus of research efforts (Hanahan and Weinberg, 2011). While fundamental differences in cellular metabolism pathways between normal and malignant cells were detected by Warburg in the 1920s (Warburg et al., 1927), clinical targeting of cancer metabolism has not kept pace with the research advances in understanding metabolic features of cancer cells. PCa is mainly dependent on lipid metabolism for energy production (Liu, 2006). The overexpression of genes involved in lipid metabolism is characteristic of PCa at both early and advanced stages (Wu et al., 2014; Chen et al., 2018; Swinnen et al., 2002; Zadra et al., 2013; Zadra and Loda, 2018; Ettinger et al., 2004; Nomura et al., 2011), while recent proteomic analyses of primary PCa and bone metastases have shown clear associations between levels of lipid metabolic enzymes, PCa initiation and progression (Iglesias-Gato et al., 2016; Iglesias-Gato et al., 2018). These observations suggest that PCa may be particularly amenable to metabolic targeting strategies. Despite this, the role and complexity of lipid/fatty acid (FA) metabolism in PCa and its potential as a target for therapy remains underexplored, particularly in the context of a more complex tumor microenvironment.Until recently, most attention has focused on the therapeutic targeting of de novo FA synthesis and, most recently, uptake of FAs in PCa to limit their availability as a source of energy and cell membrane phospholipids (Zadra et al., 2013; Zadra and Loda, 2018; Watt et al., 2019). However, it has become evident in work from our group and others that β-oxidation of FAs, as the ultimate fate of FAs in the energy production cycle, is upregulated in PCa cells, stimulated by a lipid-rich extracellular environment and critical for viability (Liu, 2006; Schlaepfer et al., 2014; Balaban et al., 2019). In this study, we evaluated the targeting of FA β-oxidation (FAO) in patient-derived prostate tumor explants (PDE) to provide the first clinically-relevant evidence that targeting this pathway is efficacious. We subsequently identify DECR1, a rate-limiting enzyme in an auxiliary pathway for polyunsaturated fatty acid (PUFA) β-oxidation, as a promising novel therapeutic vulnerability for PCa. Importantly, we show that DECR1 is an androgen-repressed gene induced in PCa cells in response to ADT and/or AR-targeted therapies, implicating PUFA oxidation as an adaptive survival response that may contribute to emergence of CRPC and treatment resistance.
Results
Targeting FA oxidation is efficacious in patient-derived PCa explants
In addition to our recent report of enhanced FAO in PCa cells (Balaban et al., 2019), an accumulating body of evidence supports the efficacy of targeting key enzymes involved in FAO using in vitro and in vivo models of PCa (Itkonen et al., 2017; Schlaepfer et al., 2014; Flaig et al., 2017). However, to date there is limited evidence that targeting this pathway would be clinically efficacious, which prompted us to target this pathway in clinical tumors. Using our well-defined patient derived explant (PDE) model that recapitulates the complexity of the clinical tissue microenvironment (Centenera et al., 2012), we targeted the rate-limiting enzyme in mitochondrial FAO, carnitine palmitoyltransferase-1 (CPT-1), in cultured PDEs using the chemical inhibitor etomoxir. Consistent with literature reports, etomoxir had weak activity against the LNCaP PCa cell line in vitro, with an IC50 of 170 µM (Figure 1—figure supplement 1A), but was considerably potent in the PDEs, in which a dose of 100 µM inhibited cell proliferation by an average of 48.4 ± 16.6% (n = 13 patients; p<0.05) (Figure 1A). Etomoxir effectively inhibited FAO in the tissues, evidenced by a significant decrease in multiple acylcarnitines in the conditioned medium (Figure 1B).
Figure 1—figure supplement 1.
Fatty acid metabolism is consistently altered in clinical prostate tumors.
(A) Cell viability of LNCaP cells treated with indicated concentrations of etomoxir for 72 hr. Cell viability was determined using CyQUANT Cell Assay. (B) A meta-analysis of 735 lipid metabolism genes using four clinical datasets with malignant and matched normal RNA-sequencing data (n = 122). Genes were rank-ordered on the basis of their meta effect size scores in PCa malignant tissues versus matched normal. (C) Fold change of DECR1 mRNA expression in malignant tissues compared to benign/normal tissues. Data were obtained from Oncomine.
Figure 1.
Fatty acid β-oxidation genes are overexpressed in prostate cancer and targeting this process is effective in patient-derived human prostatic ex vivo tumor explants.
(A) Etomoxir reduced cell proliferation in patient-derived human prostatic ex vivo tumor explants. Tissues were treated with 100 µM etomoxir for 72 hr, sections were fixed in formalin, paraffin embedded and stained against the proliferative marker Ki67 (n = 13) (scale bar = 50 µm). (B) Etomoxir (100 µM) decreased acylcarnitine species, the products of CPT1 activity. Acylcarnitines secreted to the conditioned medium were measured after 72 hr treatment of PDEs (n = 9). (C) A meta-analysis of fatty acid oxidation genes using four clinical datasets with malignant and matched normal RNA-sequencing data (n = 122). Genes were rank-ordered on the basis of their meta effect size scores in PCa malignant tissues versus matched normal tissues. (D) Violin plots demonstrate DECR1 mRNA overexpression in PCa primary/malignant tissues compared to normal/benign tissues in three independent datasets. (E) DECR1 mRNA expression is associated with PCa primary Gleason score, total Gleason score (>7) and diseases stage (T-stage). Data were extracted from TCGA PCa dataset. (F) Histogram displaying DECR1 mutation and copy-number amplification frequency across 13 PCa genomic datasets, and (G) across 28 tumor types. Histograms were obtained from CbioPortal platform. (H) DECR1 mRNA expression is associated with shorter relapse-free survival in TCGA PCa, Glinsky et al., 2005 and GSE21032 datasets, and shorter overall survival rates in GSE16560 dataset. (I) DECR1 copy number amplification frequency is associated with shorter relapse-free survival in TCGA PCa dataset. Data in (A) are represented as as the mean ± s.e.m and were statistically analysed using a Wilcoxon matched-pairs signed rank test. Data in (B) are represented as the mean ± s.e.m and were statistically analysed using two-tailed Student’s t-test. Data in (D) and (E) are represented as violin plots in GraphPad prism: the horizontal line within the violin represents the median, and were statistically analysed using a Mann-Whitney two-tailed t-test. Data in (H) and (I) were statistically analysed using a two-sided log-rank test. *p<0.05, **p<0.01, ***p<0.001 and ****p<0.0001.
(A) Cell viability of LNCaP cells treated with indicated concentrations of etomoxir for 72 hr. Cell viability was determined using CyQUANT Cell Assay. (B) A meta-analysis of 735 lipid metabolism genes using four clinical datasets with malignant and matched normal RNA-sequencing data (n = 122). Genes were rank-ordered on the basis of their meta effect size scores in PCa malignant tissues versus matched normal. (C) Fold change of DECR1 mRNA expression in malignant tissues compared to benign/normal tissues. Data were obtained from Oncomine.
Fatty acid β-oxidation genes are overexpressed in prostate cancer and targeting this process is effective in patient-derived human prostatic ex vivo tumor explants.
(A) Etomoxir reduced cell proliferation in patient-derived humanprostatic ex vivo tumor explants. Tissues were treated with 100 µM etomoxir for 72 hr, sections were fixed in formalin, paraffin embedded and stained against the proliferative marker Ki67 (n = 13) (scale bar = 50 µm). (B) Etomoxir (100 µM) decreased acylcarnitine species, the products of CPT1 activity. Acylcarnitines secreted to the conditioned medium were measured after 72 hr treatment of PDEs (n = 9). (C) A meta-analysis of fatty acid oxidation genes using four clinical datasets with malignant and matched normal RNA-sequencing data (n = 122). Genes were rank-ordered on the basis of their meta effect size scores in PCa malignant tissues versus matched normal tissues. (D) Violin plots demonstrate DECR1 mRNA overexpression in PCa primary/malignant tissues compared to normal/benign tissues in three independent datasets. (E) DECR1 mRNA expression is associated with PCa primary Gleason score, total Gleason score (>7) and diseases stage (T-stage). Data were extracted from TCGA PCa dataset. (F) Histogram displaying DECR1 mutation and copy-number amplification frequency across 13 PCa genomic datasets, and (G) across 28 tumor types. Histograms were obtained from CbioPortal platform. (H) DECR1 mRNA expression is associated with shorter relapse-free survival in TCGA PCa, Glinsky et al., 2005 and GSE21032 datasets, and shorter overall survival rates in GSE16560 dataset. (I) DECR1 copy number amplification frequency is associated with shorter relapse-free survival in TCGA PCa dataset. Data in (A) are represented as as the mean ± s.e.m and were statistically analysed using a Wilcoxon matched-pairs signed rank test. Data in (B) are represented as the mean ± s.e.m and were statistically analysed using two-tailed Student’s t-test. Data in (D) and (E) are represented as violin plots in GraphPad prism: the horizontal line within the violin represents the median, and were statistically analysed using a Mann-Whitney two-tailed t-test. Data in (H) and (I) were statistically analysed using a two-sided log-rank test. *p<0.05, **p<0.01, ***p<0.001 and ****p<0.0001.
Fatty acid metabolism is consistently altered in clinical prostate tumors.
(A) Cell viability of LNCaP cells treated with indicated concentrations of etomoxir for 72 hr. Cell viability was determined using CyQUANT Cell Assay. (B) A meta-analysis of 735 lipid metabolism genes using four clinical datasets with malignant and matched normal RNA-sequencing data (n = 122). Genes were rank-ordered on the basis of their meta effect size scores in PCa malignant tissues versus matched normal. (C) Fold change of DECR1 mRNA expression in malignant tissues compared to benign/normal tissues. Data were obtained from Oncomine.In order to prioritize key functional genes involved in PCa progression, we conducted a meta-analysis of the expression of 735 genes involved in lipid metabolism (as identified from REACTOME) in four clinical datasets with malignant and matched normal RNA sequencing data (Nikitina et al., 2017; Ren et al., 2012; Ding et al., 2016). Genes were rank-ordered on the basis of their meta effect size scores in PCa malignant versus matched normal tissues (Figure 1—figure supplement 1B). The meta-analysis revealed a strikingly consistent deregulation of lipid metabolism genes, including genes involved in FAO (Figure 1C), despite the predicted high inter-individual heterogeneity of patientPCa tissues. We conducted disease-relapse survival analysis using TCGA data for each of the top 20 genes from the meta-analysis. This identified DECR1, a rate-limiting enzyme in the mitochondrial β-oxidation of polyunsaturated fatty acids, as a robustly overexpressed gene in PCa tissues that is associated with shorter relapse-free survival rates.
DECR1 is upregulated in clinical prostate tumors
Consistently, DECR1 mRNA expression was significantly higher in malignant compared to benign prostate tissues in ten independent expression datasets of PCa tissues versus non-malignant tissues (Figure 1D, Figure 1—figure supplement 1C). Further analysis of the TCGA data revealed increased DECR1 expression with increased Gleason score or in with advanced disease stage (Figure 1E). Consistent with our observation of increased DECR1 mRNA expression in PCa, DECR1 gene copy gain was evident in several clinical datasets accessed via cBioPortal (Cerami et al., 2012; Figure 1F). Interestingly, the top three cancer types exhibiting increased DECR1 copy gain were hormone-dependent tumors (uterine, breast and prostate), suggestive of a relationship between DECR1 expression and hormone signaling (Figure 1G). DECR1 mRNA expression was associated with shorter relapse-free survival rates and overall survival rates (Figure 1H), and in the TCGA dataset, DECR1 amplification was significantly associated with shorter recurrence-free survival rates (Figure 1I).We confirmed overexpression of DECR1 protein in clinical PCa using two independent proteomic datasets (Figure 2A). We observed overexpression of DECR1 in PCa tissues (n = 8) compared with benign tissues (n = 3) (Figure 2B), and increased expression was evident in high grade versus low grade cancer tissue. Quantitative IHC staining analysis revealed a significant increase of DECR1 expression in malignant vs benign tissues. Furthermore, intra-tissue analysis exposed a significant increase of DECR1 expression in malignant regions vs benign ones within the same core (Figure 2C). DECR1 expression was markedly increased in a panel of hormone-dependent and -independent cancer cell lines compared with non-malignant PNT1 and PNT2 prostate cell lines (Figure 2D). Consistent with its function, DECR1 localises to the mitochondria, confirmed using immunocytochemistry and Western blot of nuclear, cytoplasmic and mitochondrial cell fractions (Figure 2E). Together, the mRNA and protein findings suggest that expression of DECR1 is closely linked to PCa progression and patient outcomes, and therefore might represent an unexplored therapeutic target.
Figure 2.
DECR1 protein in overexpressed in malignant prostate cells/tissues.
(A) Violin plots of DECR1 protein overexpression in primary PCa tissues compared to benign prostate tissues in two independent datasets. (B) Representative DECR1 IHC staining of benign prostate tissues and PCa tissues (negative control stain included in bottom right box). Scale bar, 50 µm. (C) Violin plot of DECR1 protein expression in a validation cohort consisting of benign prostate tissues (n = 3) and PCa tissues (n = 8) (top panel). Intra-tissue IHC analysis of DECR1 expression in PCa tissues (n = 8) (bottom panel). (D) DECR1 protein expression in non-malignant prostate cell lines (PNT1 and PNT2) and PCa cell lines (LNCaP, VCaP, 22RV1, C42B and PC3). (E) Immunocytochemistry staining of LNCaP cells to determine the subcellular localization of DECR1: nuclei were labelled using DAPI; mitochondria were labelled using MitoTracker Red; and DECR1 proteins were labelled using Alexa Fluor 488 secondary antibody, (Scale bar = 10 μm). Immunoblot of PNT1 and LNCaP cells separated into cytosolic, mitochondrial and nuclear fractions and incubated with poly (ADP-ribose) polymerase (PARP) and cytochrome-C antibodies to mark nuclear and mitochondrial fractions. Data are represented as violin plots in GraphPad prism: the horizontal line within the violin represents the median. Statistical analysis was performed using a Mann-Whitney two-tailed t-test (A and C top panel), or two-tailed paired t-test (C bottom panel): *p<0.05, **p<0.01 and ***p<0.001.
DECR1 protein in overexpressed in malignant prostate cells/tissues.
(A) Violin plots of DECR1 protein overexpression in primary PCa tissues compared to benign prostate tissues in two independent datasets. (B) Representative DECR1 IHC staining of benign prostate tissues and PCa tissues (negative control stain included in bottom right box). Scale bar, 50 µm. (C) Violin plot of DECR1 protein expression in a validation cohort consisting of benign prostate tissues (n = 3) and PCa tissues (n = 8) (top panel). Intra-tissue IHC analysis of DECR1 expression in PCa tissues (n = 8) (bottom panel). (D) DECR1 protein expression in non-malignant prostate cell lines (PNT1 and PNT2) and PCa cell lines (LNCaP, VCaP, 22RV1, C42B and PC3). (E) Immunocytochemistry staining of LNCaP cells to determine the subcellular localization of DECR1: nuclei were labelled using DAPI; mitochondria were labelled using MitoTracker Red; and DECR1 proteins were labelled using Alexa Fluor 488 secondary antibody, (Scale bar = 10 μm). Immunoblot of PNT1 and LNCaP cells separated into cytosolic, mitochondrial and nuclear fractions and incubated with poly (ADP-ribose) polymerase (PARP) and cytochrome-C antibodies to mark nuclear and mitochondrial fractions. Data are represented as violin plots in GraphPad prism: the horizontal line within the violin represents the median. Statistical analysis was performed using a Mann-Whitney two-tailed t-test (A and C top panel), or two-tailed paired t-test (C bottom panel): *p<0.05, **p<0.01 and ***p<0.001.
DECR1 is a directly androgen-repressed gene in PCa
The relationship between androgen receptor (AR) signaling and lipid metabolic genes is well established. Many studies have reported a marked stimulatory effect of AR on key lipid metabolism pathways either directly or indirectly through activation of a family of transcription factors called sterol regulatory element-binding proteins (SREBPs) (Butler et al., 2016). We therefore investigated the relationship between AR and DECR1 using a panel of in vitro, ex vivo and in vivo models. DECR1 expression is notably more abundant in AR-negative cells (PC3) than in AR-expressing cells (Figure 2D), consistent with negative regulation of DECR1 expression by AR. We confirmed that androgen (5α-dihydrotestosterone) significantly decreased DECR1 expression in androgen-dependent LNCaP and VCaP cell lines at both mRNA and protein levels (Figure 3A). Data mining of publicly available microarray datasets also revealed downregulation of DECR1 in LNCaP cells after treatment with DHT or the synthetic androgen R1881 (Figure 3—figure supplement 1A); GSE7868, GSE22606). In contrast to the effect of androgens, AR-targeted therapies increase DECR1 expression. LNCaP and VCaP cell treatment with the androgen antagonist enzalutamide (ENZ) significantly increased DECR1 expression at both mRNA and protein levels (Figure 3B). In vivo, LNCaP tumors exhibited increased DECR1 expression in mice treated with ENZ (10 mg/kg) or castration, which was enhanced further in mice treated with both ENZ and castration (Figure 3C). Our observations were supported by published microarray datasets which showed that treatment of LNCaP or VCaP cells with ENZ increases DECR1 mRNA expression (Figure 3—figure supplement 1B; GSE69249). In vivo, castration of mice increased DECR1 expression in prostate (Figure 3—figure supplement 1C; GSE5901), while in LNCaP/AR xenografts treatment with the AR antagonist ARN-509 (apalutamide) for 4 days significantly increased DECR1 expression (Figure 3—figure supplement 1D; GSE52169). To confirm androgenic regulation of DECR1 in a clinical context, we validated these data using PDEs. ENZ treatment of PDEs significantly increased DECR1 expression whereas, as expected, mRNA levels of the well-characterized AR target genes KLK3 and KLK2 were decreased (Figure 3D,E). To determine whether AR directly represses DECR1, we interrogated published chromatin immunoprecipitation (ChIP) sequencing data. In VCaP cells, AR bound strongly to the DECR1 promoter in response to DHT treatment, but not when co-treated with AR antagonists (Figure 3F; GSE55064). Moreover, AR binding was enriched at the DECR1 promoter in benign and malignant prostate tissues (Figure 3—figure supplement 1E; GSE56288). A site-specific ChIP-qPCR assay revealed DHT-stimulated AR occupancy at this region in LNCaP cells (Figure 3G). Collectively, these data reveal DECR1 as a novel AR-repressed gene.
Figure 3.
DECR1 is an androgen-repressed gene.
(A) DECR1 mRNA and protein was measured by qRT-PCR and western blot analysis after PCa cell treatment with dihydrotestosterone (DHT), or (B) enzalutamide (ENZ). Relative mRNA expression of DECR1 was calculated using comparative CT method, where the cells treated with vehicle (control) were set to one and normalised to the geometric mean CT value of GUSB and L19 (housekeeping genes). Densitometry quantification of relative DECR1 protein expression was normalized to the HSP90 internal control. n = 3 independent experiments. (C) qRT-PCR analysis of DECR1 mRNA expression in LNCaP-derived tumors treated with enzalutamide (ENZ) and/or castration (Castr). (D) qRT-PCR analysis of DECR1 and androgen regulated genes KLK2 and KLK3 mRNA expression in a cohort of 10 patient-derived human prostatic ex vivo tumor explants treated with enzalutamide (ENZ, 10 µM). Relative mRNA expression was calculated using comparative CT method, where the matched untreated tissue from the same patient was set to one and normalized to the geometric mean CT value of TUBA1B, PPIA and GAPDH. (E) Representative DECR1 IHC staining of patient-derived human prostatic ex vivo tumor explants treated with enzalutamide (ENZ, 10 µM). Scale bar, 100 µm. (F) AR ChIP-sequencing data from VCaP cells (top panel), normal human prostate and primary human prostate tumor specimens (bottom panel). Data from GSE55064 and GSE56288. (G) ChIP-qPCR analysis demonstrates AR binding at DECR1 locus in LNCaP cells after treatment with DHT. Data in bar graphs (A, B and G) are represented as the mean ± s.e.m. Data in (C) are represented as box plots using the Tukey method in GraphPad prism. Statistical analysis was performed using two-tailed Student’s t-test (A, C, D and G) or one-way ANOVA, followed by Dunnett's multiple comparisons test (B): *p<0.05, **p<0.01, ***p<0.001 and ****p<0.0001.
(A) Bar graphs of DECR1 mRNA expression in two publically available datasets shows DECR1 mRNA expression decreased after LNCaP treatment with DHT (GSE7868) or R1881 (GSE22606). (B) DECR1 expression increased in LNCaP and VCaP upon treatment with Enzalutamide (GSE69249). (C) DECR1 mRNA expression increased in mouse prostate gland after castration but decreased after testosterone administration. (D) ARN-509 (Apalutamide) treatment of LNCaP/AR xenograft increased DECR1 mRNA expression (GSE52169). (E) AR ChIP-sequencing data from normal human prostate and primary human prostate tumor specimens (normal, n = 7; tumor, n = 13). Data from GSE56288. Statistical analysis was performed using two-tailed Student’s t-test: *p<0.05, **p<0.01 and ****p<0.0001.
Figure 3—figure supplement 1.
Androgenic regulation of DECR1 expression.
(A) Bar graphs of DECR1 mRNA expression in two publically available datasets shows DECR1 mRNA expression decreased after LNCaP treatment with DHT (GSE7868) or R1881 (GSE22606). (B) DECR1 expression increased in LNCaP and VCaP upon treatment with Enzalutamide (GSE69249). (C) DECR1 mRNA expression increased in mouse prostate gland after castration but decreased after testosterone administration. (D) ARN-509 (Apalutamide) treatment of LNCaP/AR xenograft increased DECR1 mRNA expression (GSE52169). (E) AR ChIP-sequencing data from normal human prostate and primary human prostate tumor specimens (normal, n = 7; tumor, n = 13). Data from GSE56288. Statistical analysis was performed using two-tailed Student’s t-test: *p<0.05, **p<0.01 and ****p<0.0001.
DECR1 is an androgen-repressed gene.
(A) DECR1 mRNA and protein was measured by qRT-PCR and western blot analysis after PCa cell treatment with dihydrotestosterone (DHT), or (B) enzalutamide (ENZ). Relative mRNA expression of DECR1 was calculated using comparative CT method, where the cells treated with vehicle (control) were set to one and normalised to the geometric mean CT value of GUSB and L19 (housekeeping genes). Densitometry quantification of relative DECR1 protein expression was normalized to the HSP90 internal control. n = 3 independent experiments. (C) qRT-PCR analysis of DECR1 mRNA expression in LNCaP-derived tumors treated with enzalutamide (ENZ) and/or castration (Castr). (D) qRT-PCR analysis of DECR1 and androgen regulated genes KLK2 and KLK3 mRNA expression in a cohort of 10 patient-derived humanprostatic ex vivo tumor explants treated with enzalutamide (ENZ, 10 µM). Relative mRNA expression was calculated using comparative CT method, where the matched untreated tissue from the same patient was set to one and normalized to the geometric mean CT value of TUBA1B, PPIA and GAPDH. (E) Representative DECR1 IHC staining of patient-derived humanprostatic ex vivo tumor explants treated with enzalutamide (ENZ, 10 µM). Scale bar, 100 µm. (F) AR ChIP-sequencing data from VCaP cells (top panel), normal human prostate and primary humanprostate tumor specimens (bottom panel). Data from GSE55064 and GSE56288. (G) ChIP-qPCR analysis demonstrates AR binding at DECR1 locus in LNCaP cells after treatment with DHT. Data in bar graphs (A, B and G) are represented as the mean ± s.e.m. Data in (C) are represented as box plots using the Tukey method in GraphPad prism. Statistical analysis was performed using two-tailed Student’s t-test (A, C, D and G) or one-way ANOVA, followed by Dunnett's multiple comparisons test (B): *p<0.05, **p<0.01, ***p<0.001 and ****p<0.0001.
Androgenic regulation of DECR1 expression.
(A) Bar graphs of DECR1 mRNA expression in two publically available datasets shows DECR1 mRNA expression decreased after LNCaP treatment with DHT (GSE7868) or R1881 (GSE22606). (B) DECR1 expression increased in LNCaP and VCaP upon treatment with Enzalutamide (GSE69249). (C) DECR1 mRNA expression increased in mouse prostate gland after castration but decreased after testosterone administration. (D) ARN-509 (Apalutamide) treatment of LNCaP/AR xenograft increased DECR1 mRNA expression (GSE52169). (E) AR ChIP-sequencing data from normal human prostate and primary humanprostate tumor specimens (normal, n = 7; tumor, n = 13). Data from GSE56288. Statistical analysis was performed using two-tailed Student’s t-test: *p<0.05, **p<0.01 and ****p<0.0001.
Targeting DECR1 disrupts PUFA oxidation in PCa cells
FAs are metabolized mainly in mitochondria through the β-oxidation process to generate acetyl-CoA, which enters the tricarboxylic acid cycle (TCA) and produces ATP and NADH as energy for the cell. Unlike saturated FAs, all unsaturated FAs with double bonds originating at even-numbered positions, and some unsaturated FAs with double bonds originating at odd-numbered positions, require three auxiliary enzymes to generate intermediates that are harmonious with the standard β-oxidation pathway (Hiltunen and Qin, 2000; Shoukry and Schulz, 1998): Enoyl CoA isomerase (ECI1), 2,4 Dienoyl-CoA reductase (DECR1) and Dienoyl CoA isomerase (ECH1) (Figure 4A). DECR1 catalyses the rate limiting step in this pathway (Alphey et al., 2005). Given the critical role of DECR1 in PUFA metabolism, we studied the consequences of DECR1 downregulation on β-oxidation of PUFAs in PCa cells. DECR1 knockdown was achieved successfully (>80% downregulation) using two different siRNAs (Figure 4B). DECR1 knockdown resulted in an increase in linoleic acid (Figure 4C) as well as an accumulation of 2-trans,4-cis-decadienoylcarnitine (acylcarnitine 10:2; Figure 4D), an intermediate of linoleic acid metabolism, indicating incomplete PUFA β-oxidation. Mitochondrial β-oxidation provides reducing equivalents that drive ATP production. LNCaP cells increased ATP levels in response to exogenous linoleic acid supplementation when cultured in glucose-free media containing the lipase inhibitor diethylumbelliferyl phosphate (DEUP), to prevent the cells from using intracellular FAs (Figure 4E). However, cells transfected with DECR1-targeting siRNAs failed to increase ATP levels with linoleic acid supplementation (Figure 4E), indicating impaired capacity to metabolize PUFAs.
Figure 4.
DECR1 knockdown interrupts PUFA β-oxidation in PCa cells.
(A) Schematic of DECR1 function in fatty acid (FA) β-oxidation. In order to translocate FAs into the mitochondria, CPT1 converts long-chain acyl-CoA species to their corresponding long-chain acylcarnitine species. This is followed by a dehydrogenation step mediated by acyl CoA dehydrogenase (ACAD) to generate trans-2-enoyl-CoA, the only intermediate that can be processed by downstream enzymes in the β-oxidation process. Many FAs have unsaturated bonds either on an odd-numbered carbon or in the cis-configuration, resulting in the generation of enoyl-CoA intermediates that cannot be directly processed via the downstream β-oxidation enzymes. These FAs require the activity of 3 auxiliary enzymes, ECI1, ECH1 and DECR1 in order to form trans-2-enoyl-CoA before undergoing β-oxidation. DECR1 catalyzes the conversion of either 2-trans,4-cis-dienoyl or 2-trans,4-trans-dienoyl-CoA to 3-trans-enoyl-CoA. A complete cycle of β-oxidation results in the release of the first two carbon units as acetyl-CoA, and a fatty-acyl-CoA minus two carbons. The acetyl-CoA enters the TCA cycle to produce energy (ATP). The shortened fatty-acyl-CoA is processed again starting with the ACADs to form trans-2-enoyl-CoA either directly or with the aid of the auxiliary enzymes depending on the presence of double bonds. This process continues until all carbons in the fatty acid chain are turned into acetyl-CoA. (B) DECR1 protein expression after 72 hr or 96 hr siRNA transfection. Densitometry quantification of relative DECR1 protein expression was normalized to the HSP90 internal control. (C) Linoleic acid level in LNCaP cells quantified in following 96 hr DECR1 knockdown using GC QQQ targeted metabolomics. (D) Relative quantities of the C10:2 acylcarnitine species in LNCaP cell conditioned medium (left) or cell lysates (right) (n = 3). (E) Quantification of ATP levels in LNCaP cell lysates. LNCaP cells were transfected with DECR1 siRNAs for 48 hr and then starved in no-glucose medium and treated with the lipolysis inhibitor DEUP (100 µM) in the presence (BSA-LA) or absence (BSA) of the PUFA linoleic acid for 48 hr before measuring ATP levels. (F) Oxygen consumption rate (OCR) was assessed in LNCaP cells supplemented with the PUFA linoleic acid (LA) or (G) the saturated fatty acid palmitic acid (PA). Each data point represents an OCR measurement. ATP production, maximal mitochondrial respiration and mitochondrial spare capacity were assessed. (H) Extracellular acidification rate (ECAR) was assessed in LNCaP cells. Each data point represents an ECAR measurement. For experiments (F-H) LNCaP cells were transfected with DECR1 siRNAs for 72 hr, then starved in substrate limited medium for 24 hr; the assay was run in FAO assay medium. (I and J) Metabolites were quantified in LNCaP cells following 96 hr DECR1 knockdown using GC QQQ targeted metabolomics. Data in bar graphs are represented as the mean ± s.e.m (n = 3). Statistical analysis was performed using two-tailed Student’s t-test: *p<0.05, **p<0.01 and ****p<0.0001.
(A) Oxygen consumption rate (OCR) was assessed in LNCaP cells supplemented with the PUFA linoleic acid (LA). Each data point represents an OCR measurement. ATP production, maximal mitochondrial respiration and mitochondrial spare capacity were assessed. (B) Extracellular acidification rate (ECAR) was assessed in LNCaP cells. Each data point represents an ECAR measurement. (C) OCR of LNCaP cells supplemented with PUFA LA (top) or palmitic acid (PA, bottom) treated with etomoxir (ETX, 100 µM). Each data point represents an OCR measurement. (D) DECR1 protein expression after 48 hr treatment with varying concentrations of etomoxir. Statistical analysis was performed using two-tailed Student’s t-test: *p<0.05, **p<0.01 and ****p<0.0001.
DECR1 knockdown interrupts PUFA β-oxidation in PCa cells.
(A) Schematic of DECR1 function in fatty acid (FA) β-oxidation. In order to translocate FAs into the mitochondria, CPT1 converts long-chain acyl-CoA species to their corresponding long-chain acylcarnitine species. This is followed by a dehydrogenation step mediated by acyl CoA dehydrogenase (ACAD) to generate trans-2-enoyl-CoA, the only intermediate that can be processed by downstream enzymes in the β-oxidation process. Many FAs have unsaturated bonds either on an odd-numbered carbon or in the cis-configuration, resulting in the generation of enoyl-CoA intermediates that cannot be directly processed via the downstream β-oxidation enzymes. These FAs require the activity of 3 auxiliary enzymes, ECI1, ECH1 and DECR1 in order to form trans-2-enoyl-CoA before undergoing β-oxidation. DECR1 catalyzes the conversion of either 2-trans,4-cis-dienoyl or 2-trans,4-trans-dienoyl-CoA to 3-trans-enoyl-CoA. A complete cycle of β-oxidation results in the release of the first two carbon units as acetyl-CoA, and a fatty-acyl-CoA minus two carbons. The acetyl-CoA enters the TCA cycle to produce energy (ATP). The shortened fatty-acyl-CoA is processed again starting with the ACADs to form trans-2-enoyl-CoA either directly or with the aid of the auxiliary enzymes depending on the presence of double bonds. This process continues until all carbons in the fatty acid chain are turned into acetyl-CoA. (B) DECR1 protein expression after 72 hr or 96 hr siRNA transfection. Densitometry quantification of relative DECR1 protein expression was normalized to the HSP90 internal control. (C) Linoleic acid level in LNCaP cells quantified in following 96 hr DECR1 knockdown using GC QQQ targeted metabolomics. (D) Relative quantities of the C10:2 acylcarnitine species in LNCaP cell conditioned medium (left) or cell lysates (right) (n = 3). (E) Quantification of ATP levels in LNCaP cell lysates. LNCaP cells were transfected with DECR1 siRNAs for 48 hr and then starved in no-glucose medium and treated with the lipolysis inhibitor DEUP (100 µM) in the presence (BSA-LA) or absence (BSA) of the PUFA linoleic acid for 48 hr before measuring ATP levels. (F) Oxygen consumption rate (OCR) was assessed in LNCaP cells supplemented with the PUFA linoleic acid (LA) or (G) the saturated fatty acidpalmitic acid (PA). Each data point represents an OCR measurement. ATP production, maximal mitochondrial respiration and mitochondrial spare capacity were assessed. (H) Extracellular acidification rate (ECAR) was assessed in LNCaP cells. Each data point represents an ECAR measurement. For experiments (F-H) LNCaP cells were transfected with DECR1 siRNAs for 72 hr, then starved in substrate limited medium for 24 hr; the assay was run in FAO assay medium. (I and J) Metabolites were quantified in LNCaP cells following 96 hr DECR1 knockdown using GC QQQ targeted metabolomics. Data in bar graphs are represented as the mean ± s.e.m (n = 3). Statistical analysis was performed using two-tailed Student’s t-test: *p<0.05, **p<0.01 and ****p<0.0001.
Effects of DECR1 on prostate cancer cellular metabolism.
(A) Oxygen consumption rate (OCR) was assessed in LNCaP cells supplemented with the PUFA linoleic acid (LA). Each data point represents an OCR measurement. ATP production, maximal mitochondrial respiration and mitochondrial spare capacity were assessed. (B) Extracellular acidification rate (ECAR) was assessed in LNCaP cells. Each data point represents an ECAR measurement. (C) OCR of LNCaP cells supplemented with PUFA LA (top) or palmitic acid (PA, bottom) treated with etomoxir (ETX, 100 µM). Each data point represents an OCR measurement. (D) DECR1 protein expression after 48 hr treatment with varying concentrations of etomoxir. Statistical analysis was performed using two-tailed Student’s t-test: *p<0.05, **p<0.01 and ****p<0.0001.Next, we employed extracellular flux analysis to determine the intrinsic rate and capacity of PCa cells to oxidise PUFAs in conditions where other exogenous substrates were limiting. Exogenous linoleic acid stimulated basal oxygen consumption rates (OCR), as a measure of mitochondrial oxidative phosphorylation, and maximal respiration, ATP production, and mitochondrial spare capacity (Figure 4F, Figure 4—figure supplement 1A) as determined by consecutive cell exposure to respiration chain inhibitors and uncouplers. This supports the observed increased in total ATP levels in response to linoleic acid supplementation (Figure 4E). Importantly, DECR1 knockdown prevented the exogenous linoleic acid induction of basal and maximal respiration, ATP production, and mitochondrial spare capacity (Figure 4F, Figure 4—figure supplement 1A). In contrast, DECR1 knockdown has no impact on mitochondrial metabolism of the saturated FA, palmitate (Figure 4G). Further, DECR1 knockdown increased glycolysis, as determined by ECAR (Figure 4H, Figure 4—figure supplement 1B), as well as decreased glucose and fructose concentrations (Figure 4I), to sustain TCA cycle intermediate levels (Figure 4J) as a consequence of disruption of PUFA β-oxidation. While DECR1 exhibited selectivity in inhibition of PUFA metabolism, as expected, etomoxir inhibited both PUFA and saturated fatty acids (Figure 4—figure supplement 1C). There was no effect of ETX treatment on DECR1 expression (Figure 4—figure supplement 1D). Collectively, these results demonstrate that DECR1 is critical for PUFA metabolism in LNCaP PCa cells.
Figure 4—figure supplement 1.
Effects of DECR1 on prostate cancer cellular metabolism.
(A) Oxygen consumption rate (OCR) was assessed in LNCaP cells supplemented with the PUFA linoleic acid (LA). Each data point represents an OCR measurement. ATP production, maximal mitochondrial respiration and mitochondrial spare capacity were assessed. (B) Extracellular acidification rate (ECAR) was assessed in LNCaP cells. Each data point represents an ECAR measurement. (C) OCR of LNCaP cells supplemented with PUFA LA (top) or palmitic acid (PA, bottom) treated with etomoxir (ETX, 100 µM). Each data point represents an OCR measurement. (D) DECR1 protein expression after 48 hr treatment with varying concentrations of etomoxir. Statistical analysis was performed using two-tailed Student’s t-test: *p<0.05, **p<0.01 and ****p<0.0001.
Targeting DECR1 suppresses PCa oncogenesis
The consistently increased expression of DECR1 in PCa tissue and its association with shorter-relapse times and survival rates (Figure 1 and 2), taken together with its impact on PUFA metabolism (Figure 4), suggested that it may contribute to PCa cell viability and invasive behaviour. We evaluated the impact of DECR1 downregulation or overexpression on various oncogenic properties of PCa cells using a series of in vitro and in vivo experiments. While there was no effect of DECR1 downregulation on the non-malignant prostate cell line PNT1, a significant attenuation of PCa proliferation and induction of cell death was observed in a panel of PCa lines (Figure 5A), comprising androgen-dependent (VCaP and LNCaP), CRPC (22RV1 and V16D) and acquired ENZ-resistant cells (MR49F). Notably, this effect on PCa cell viability was lost when cells were cultured in lipid-depleted media (Figure 5—figure supplement 1), suggesting that the observed effect is due to interference with FA metabolism. Likewise, stable DECR1 knockdown using a short hairpin vector attenuated LNCaP cell line viability and induced cell death (Figure 5B) In contrast, stable DECR1 overexpression significantly enhanced LNCaP cell viability (Figure 5C) and colony formation ability (Figure 5D), while stable DECR1 knockdown markedly decreased colony formation (Figure 5E). DECR1 knockdown also decreased LNCaP growth in 3D spheroids (Figure 5F), which better mimic in vivo conditions than 2-dimensional cell culture (Duval et al., 2017). In addition, DECR1 knockdown reduced LNCaP, 22RV1 and MR49F cell migration by ~50% (Figure 5G) and 22RV1 invasion by ~65% (Figure 5H). In vivo, LNCaP cells stably depleted of DECR1 showed highly variable growth rates in a subcutaneous model (Figure 5—figure supplement 2A), but inspection of the resultant tumors revealed significantly reduced cellular proliferation compared to control cells, concomitant with reduced DECR1 expression (Figure 5I, Figure 5—figure supplement 2B). To study the effect of DECR1 downregulation on PCa in the prostate microenvironment, we undertook a second study using LNCaP orthotopic xenografts. DECR1 knockdown significantly retarded tumor growth (Figure 5K, (Figure 5—figure supplement 2C,D,E), and significantly inhibited lung metastasis in the orthotopic tumor model (Figure 5L).
Figure 5.
DECR1 knockdown suppresses oncogenic phenotypes of PCa cells.
(A) Cell viability after DECR1 knockdown in non-malignant PNT1 prostate cells; hormone-responsive PCa cell lines (LNCaP and VCaP); castrate-resistant V16D and 22RV1 cell lines and enzalutamide-resistant MR94F cells cultured in full serum media. (B) Cell viability and cell death of stable DECR1 knockdown LNCaP cells cultured in full serum media. (C) Cell viability of stable DECR1-overexpressed LNCaP cells cultured in full serum media. Cell viability and cell death were measured using trypan blue exclusion following 96 hr DECR1 knockdown. Percentages are represented relative to the control siRNA; n = 3 independent experiments per cell line. (D) Clonogenic cell survival of LNCaP cells was assessed using colony formation assay. Stable DECR1-overexpressed cells or (E) stable DECR1 knockdown was achieved using two different short hairpin (sh) vectors and DECR1 expression was confirmed using western blot. Cells were cultured for 2 weeks, washed with PBS, fixed with paraformaldehyde and stained with 1% crystal violet for 30 min. Colonies with more than 50 cells were counted manually; data shown is representative of n = 2 independent experiments. (F) LNCaP and 22RV1 cell growth in 3D spheres. Spheroids were prepared using the hang drop assay following 48 hr DECR1 knockdown. Spheroid volumes were determined after five days of culturing the cells in 20 µl drops; at least 25 spheres per cell line were assessed using the ReViSP software, n = 3 independent experiments per cell line. (G) LNCaP, 22RV1 and MR49F cell migration and (H) 22RV1 cell invasion were assessed using a transwell migration/invasion assay. Cells were transfected with DECR1 siRNA or control siRNA for 48 hr prior to the assay; data shown is representative of n = 3 independent experiments. (I) Violin plots of mKi67 and DECR1 mRNA expression in subcutaneous LNCaP tumors (n = 5 mice, shControl; n = 4 mice, shDECR1). (J) Representative Ki67 IHC staining of subcutaneous LNCaP tumors. Scale bar, 100 μm. Data in bar graphs are represented as the mean ± s.e.m. Statistical analysis was performed using one-way ANOVA, followed by Dunnett's multiple comparisons test: *p<0.05, **p<0.01, ***p<0.001 and ****p<0.0001. (K) Tumor growth of intraprostatically injected LNCaP cells (shControl and shDECR1). (J) Lung luminescence readings following DECR1 knockdown in mice. Data are presented as mean ± s.e.m. Statistical analysis was performed using two-way ANOVA or two-tailed student’s t-test: *p<0.05 and ***p<0.001.
(A) Cell viability and cell death after DECR1 knockdown in LNCaP and 22RV1 cultured in full serum media.
Cell viability and cell death were measured using trypan blue exclusion following 96 hr DECR1 knockdown. Percentages are represented relative to the control siRNA; n = 3 independent experiments per cell line.
(A) Individual tumor growth of shControl and shDECR1 cells in LNCaP-xenograft tumors. (B) Violin plots of mKi67 and DECR1 mRNA expression in LNCaP tumors (n = 5 mice, shControl; n = 4 mice, shDECR1). (C) Representative DECR1 and KI67 IHC staining of consecutive sections of LNCaP-xenograft tumors. (D) Individual tumor growth of shControl and shDECR1 cells in LNCaP-xenograft tumors from the second cohort of mice. (E) Tumor growth was monitored based on luciferase activity over time as indicated by IVIS imaging (n = 10 mice, shControl; n = 9 mice, shDECR1). Statistical analysis was performed using two-tailed Student’s t-test: *p<0.05 and ***p<0.001.
Figure 5—figure supplement 1.
Depletion of extracellular lipids prevents antiproliferative effects of DECR1 in prostate cancer cells.
(A) Cell viability and cell death after DECR1 knockdown in LNCaP and 22RV1 cultured in full serum media.
Cell viability and cell death were measured using trypan blue exclusion following 96 hr DECR1 knockdown. Percentages are represented relative to the control siRNA; n = 3 independent experiments per cell line.
Figure 5—figure supplement 2.
DECR1 suppresses growth of prostate tumor xenografts in mice.
(A) Individual tumor growth of shControl and shDECR1 cells in LNCaP-xenograft tumors. (B) Violin plots of mKi67 and DECR1 mRNA expression in LNCaP tumors (n = 5 mice, shControl; n = 4 mice, shDECR1). (C) Representative DECR1 and KI67 IHC staining of consecutive sections of LNCaP-xenograft tumors. (D) Individual tumor growth of shControl and shDECR1 cells in LNCaP-xenograft tumors from the second cohort of mice. (E) Tumor growth was monitored based on luciferase activity over time as indicated by IVIS imaging (n = 10 mice, shControl; n = 9 mice, shDECR1). Statistical analysis was performed using two-tailed Student’s t-test: *p<0.05 and ***p<0.001.
DECR1 knockdown suppresses oncogenic phenotypes of PCa cells.
(A) Cell viability after DECR1 knockdown in non-malignant PNT1 prostate cells; hormone-responsive PCa cell lines (LNCaP and VCaP); castrate-resistant V16D and 22RV1 cell lines and enzalutamide-resistant MR94F cells cultured in full serum media. (B) Cell viability and cell death of stable DECR1 knockdown LNCaP cells cultured in full serum media. (C) Cell viability of stable DECR1-overexpressed LNCaP cells cultured in full serum media. Cell viability and cell death were measured using trypan blue exclusion following 96 hr DECR1 knockdown. Percentages are represented relative to the control siRNA; n = 3 independent experiments per cell line. (D) Clonogenic cell survival of LNCaP cells was assessed using colony formation assay. Stable DECR1-overexpressed cells or (E) stable DECR1 knockdown was achieved using two different short hairpin (sh) vectors and DECR1 expression was confirmed using western blot. Cells were cultured for 2 weeks, washed with PBS, fixed with paraformaldehyde and stained with 1% crystal violet for 30 min. Colonies with more than 50 cells were counted manually; data shown is representative of n = 2 independent experiments. (F) LNCaP and 22RV1 cell growth in 3D spheres. Spheroids were prepared using the hang drop assay following 48 hr DECR1 knockdown. Spheroid volumes were determined after five days of culturing the cells in 20 µl drops; at least 25 spheres per cell line were assessed using the ReViSP software, n = 3 independent experiments per cell line. (G) LNCaP, 22RV1 and MR49F cell migration and (H) 22RV1 cell invasion were assessed using a transwell migration/invasion assay. Cells were transfected with DECR1 siRNA or control siRNA for 48 hr prior to the assay; data shown is representative of n = 3 independent experiments. (I) Violin plots of mKi67 and DECR1 mRNA expression in subcutaneous LNCaP tumors (n = 5 mice, shControl; n = 4 mice, shDECR1). (J) Representative Ki67 IHC staining of subcutaneous LNCaP tumors. Scale bar, 100 μm. Data in bar graphs are represented as the mean ± s.e.m. Statistical analysis was performed using one-way ANOVA, followed by Dunnett's multiple comparisons test: *p<0.05, **p<0.01, ***p<0.001 and ****p<0.0001. (K) Tumor growth of intraprostatically injected LNCaP cells (shControl and shDECR1). (J) Lung luminescence readings following DECR1 knockdown in mice. Data are presented as mean ± s.e.m. Statistical analysis was performed using two-way ANOVA or two-tailed student’s t-test: *p<0.05 and ***p<0.001.
Depletion of extracellular lipids prevents antiproliferative effects of DECR1 in prostate cancer cells.
(A) Cell viability and cell death after DECR1 knockdown in LNCaP and 22RV1 cultured in full serum media.Cell viability and cell death were measured using trypan blue exclusion following 96 hr DECR1 knockdown. Percentages are represented relative to the control siRNA; n = 3 independent experiments per cell line.
DECR1 suppresses growth of prostate tumor xenografts in mice.
(A) Individual tumor growth of shControl and shDECR1 cells in LNCaP-xenograft tumors. (B) Violin plots of mKi67 and DECR1 mRNA expression in LNCaP tumors (n = 5 mice, shControl; n = 4 mice, shDECR1). (C) Representative DECR1 and KI67 IHC staining of consecutive sections of LNCaP-xenograft tumors. (D) Individual tumor growth of shControl and shDECR1 cells in LNCaP-xenograft tumors from the second cohort of mice. (E) Tumor growth was monitored based on luciferase activity over time as indicated by IVIS imaging (n = 10 mice, shControl; n = 9 mice, shDECR1). Statistical analysis was performed using two-tailed Student’s t-test: *p<0.05 and ***p<0.001.
DECR1 targeting induces lipid peroxidation and cellular ferroptosis
DECR1 knockdown resulted in inhibition of PUFA β-oxidation and led to accumulation of PUFAs in phospholipids (Figure 6A). Inspection of the phospholipid profile revealed accumulation of PUFAs in the PC, PI and PS classes (Figure 6B) with no impact on total saturated or MUFA phospholipids (Figure 6—figure supplement 1A). PUFAare highly susceptible to peroxidation, so we next assessed the effect of DECR1 knockdown on lipidperoxidation. DECR1 knockdown increased levels of malondialdehyde, a marker of lipidperoxidation (Gaweł et al., 2004; Figure 6C). In contrast, DECR1 overexpression markedly decreased cellularmalondialdehyde levels (Figure 6C). We observed enhanced mitochondrial oxidative stress measured using MitoSOX, a mitochondrial superoxide indicator (Figure 6D), in response to DECR1 knockdown. Moreover, DECR1 knockdown resulted in significant accumulation of phospholipid hydroperoxides, a hallmark of ferroptosis (Figure 6E). In contrast, DECR1 overexpression significantly decreased mitochondrial oxidative stress under basal (Figure 6F) and linoleic acid-induced conditions (Figure 6G). Lipidperoxidation is a major driver of ferroptosis, an iron-dependent non-apoptotic form of cell death (Dixon et al., 2012). Cell treatment with the ferroptosis inhibitors, deferoxamine or ferrostatin, abolished the effect of DECR1 knockdown on PCa cell death (Figure 6H–I), while cell treatment with the ferroptosis inducers, erastin, FIN56 or ML210, enhanced the cytotoxic action of DECR1 downregulation (Figure 6J–K, Figure 6—figure supplement 1B). Supporting ferroptosis as the cell death mechanism, DECR1 knockdown did not induce apoptosis (Figure 6—figure supplement 2A), and the apoptosis inhibitor ZVAD did not rescue the cells from cell death induced by DECR1 depletion (Figure 6—figure supplement 2B). Collectively, these results suggest that DECR1 expression protect cells from oxidative stress and that DECR1 knockdown-induced cell death is primarily mediated by induction of ferroptosis.
Figure 6.
DECR1 knockdown induces PUFA accumulation, lipid peroxidation and ferroptosis.
(A) Abundance of total PUFAs and (B) total abundance of lipid species in phospholipids from control and DECR1 knockdown cells supplemented with linoleic acid (LA). (C) Malondialdehyde (MDA), an oxidative stress marker, was measured by western blot in LNCaP cells transfected with DECR1 siRNAs and in DECR1-overexpressed LNCaP cells. (D) Mitochondrial superoxide levels were quantified following 96 hr DECR1 knockdown using MitoSOX red stain. Fluorescent intensity was quantified using flow cytometry and ROS levels presented as mean fluorescent intensity. (E) Fluorescent images of BODIPY-C11 stained LNCaP cells following DECR1 knockdown (left). Fluorescent intensity was quantified using ImageJ and presented as mean fluorescent intensity (right). (F) Mitochondrial superoxide levels were quantified in stable DECR1-overexpressing LNCaP cells using MitoSOX red stain under basal or (G) linoleic acid (100 µM or 200 µM) conditions. Fluorescence intensity was quantified using flow cytometry and ROS levels were presented as mean fluorescent intensity. Cell viability of LNCaP cells after 48 hr DECR1 knockdown, treated with (H) deferoxamine (DFOA, 1.25 µM), (I) ferrostatin (Ferr-1, 1.25 µM), (J) erastin (10 µM), or (K) FIN56 (2 µM). Data in bar graphs are represented as the mean ± s.e.m. Statistical analysis was performed using two-tailed Student’s t-test (A-G) or one-way ANOVA, followed by Holm-Sidak's multiple comparisons test (H-K): ns, not significant, *p<0.05, **p<0.01, ***p<0.001 and ****p<0.0001. TAG: triacylglycerol; DAG: diacylglycerol; PC: phosphotidylcholine; PE: phosphotidylethanolamine; PI: phosphatidylinositol; PS: phosphotidylserine.
(A) Abundance of total SFA and (B) MUFA species in phospholipids from control and DECR1 knockdown cells supplemented with linoleic acid (LA). (C) Abundance of total SFAs (left) and MUFAs (right) in Control and DECR1 knockdown cells supplemented with LA. (D) IC50 values of ferroptosis inducers were determined in Control and DECR1 knockdown cells. Statistical analysis was performed using two-tailed Student’s t-test: *p<0.05, **p<0.01 and ***p<0.001.
(A) LNCaP cells were stained with AnnexinV-Phycoerythrin (PE)/7-Aminoactinomycin D (7-AAD) followed by flow cytometry analysis after 96 hr DECR1 knockdown to detect apoptotic cells. (B) Cell death after DECR1 knockdown in LNCaP cells treated with or without the caspase inhibitor (ZVAD) measured using trypan blue exclusion.
Figure 6—figure supplement 1.
Depletion of DECR1 sensitizes prostate cancer cells to ferroptosis inducing agents.
(A) Abundance of total SFA and (B) MUFA species in phospholipids from control and DECR1 knockdown cells supplemented with linoleic acid (LA). (C) Abundance of total SFAs (left) and MUFAs (right) in Control and DECR1 knockdown cells supplemented with LA. (D) IC50 values of ferroptosis inducers were determined in Control and DECR1 knockdown cells. Statistical analysis was performed using two-tailed Student’s t-test: *p<0.05, **p<0.01 and ***p<0.001.
Figure 6—figure supplement 2.
Targeting DECR1 does not induce apoptosis of prostate cancer cells.
(A) LNCaP cells were stained with AnnexinV-Phycoerythrin (PE)/7-Aminoactinomycin D (7-AAD) followed by flow cytometry analysis after 96 hr DECR1 knockdown to detect apoptotic cells. (B) Cell death after DECR1 knockdown in LNCaP cells treated with or without the caspase inhibitor (ZVAD) measured using trypan blue exclusion.
DECR1 knockdown induces PUFA accumulation, lipid peroxidation and ferroptosis.
(A) Abundance of total PUFAs and (B) total abundance of lipid species in phospholipids from control and DECR1 knockdown cells supplemented with linoleic acid (LA). (C) Malondialdehyde (MDA), an oxidative stress marker, was measured by western blot in LNCaP cells transfected with DECR1 siRNAs and in DECR1-overexpressed LNCaP cells. (D) Mitochondrial superoxide levels were quantified following 96 hr DECR1 knockdown using MitoSOX red stain. Fluorescent intensity was quantified using flow cytometry and ROS levels presented as mean fluorescent intensity. (E) Fluorescent images of BODIPY-C11 stained LNCaP cells following DECR1 knockdown (left). Fluorescent intensity was quantified using ImageJ and presented as mean fluorescent intensity (right). (F) Mitochondrial superoxide levels were quantified in stable DECR1-overexpressing LNCaP cells using MitoSOX red stain under basal or (G) linoleic acid (100 µM or 200 µM) conditions. Fluorescence intensity was quantified using flow cytometry and ROS levels were presented as mean fluorescent intensity. Cell viability of LNCaP cells after 48 hr DECR1 knockdown, treated with (H) deferoxamine (DFOA, 1.25 µM), (I) ferrostatin (Ferr-1, 1.25 µM), (J) erastin (10 µM), or (K) FIN56 (2 µM). Data in bar graphs are represented as the mean ± s.e.m. Statistical analysis was performed using two-tailed Student’s t-test (A-G) or one-way ANOVA, followed by Holm-Sidak's multiple comparisons test (H-K): ns, not significant, *p<0.05, **p<0.01, ***p<0.001 and ****p<0.0001. TAG: triacylglycerol; DAG: diacylglycerol; PC: phosphotidylcholine; PE: phosphotidylethanolamine; PI: phosphatidylinositol; PS: phosphotidylserine.
Depletion of DECR1 sensitizes prostate cancer cells to ferroptosis inducing agents.
(A) Abundance of total SFA and (B) MUFA species in phospholipids from control and DECR1 knockdown cells supplemented with linoleic acid (LA). (C) Abundance of total SFAs (left) and MUFAs (right) in Control and DECR1 knockdown cells supplemented with LA. (D) IC50 values of ferroptosis inducers were determined in Control and DECR1 knockdown cells. Statistical analysis was performed using two-tailed Student’s t-test: *p<0.05, **p<0.01 and ***p<0.001.
Targeting DECR1 does not induce apoptosis of prostate cancer cells.
(A) LNCaP cells were stained with AnnexinV-Phycoerythrin (PE)/7-Aminoactinomycin D (7-AAD) followed by flow cytometry analysis after 96 hr DECR1 knockdown to detect apoptotic cells. (B) Cell death after DECR1 knockdown in LNCaP cells treated with or without the caspase inhibitor (ZVAD) measured using trypan blue exclusion.
Discussion
Metabolic rewiring is both a hallmark feature of cancer cells and a promising therapeutic vulnerability. Several anabolic and catabolic metabolism pathways have been explored, however, few agents have been investigated clinically. This can at least partly be explained by the relatively recent appreciation of cancer metabolism as a target, the high toxicity, particularly hepatotoxicity, expected to be associated with targeting certain metabolic pathways, the predictable metabolic heterogeneity within and between patients and the lack of intermediate pre-clinical models that can predict clinically efficacious outcomes. Previous research has largely focused on studying and targeting FA synthetic pathways in PCa. Major lipogenic enzymes such as ATP citrate lyase (ACLY), acetyl-CoA carboxylase (ACC) and fatty acid synthase (FASN) are all overexpressed in PCa compared to benign tissue (Wu et al., 2014; Rossi et al., 2003; Shurbaji et al., 1996). While many first-generation FA synthesis inhibitors (e.g. FASN inhibitors) showed promising preclinical efficacy against PCa, unfavorable drug solubility and pharmacokinetics profiles, off-target effects and side effects includingweight loss have hindered clinical development of this agent class (Zadra et al., 2013). In addition to de novo synthesis of FAs, PCa cells depend on lipid uptake from the circulation, and from stromal adipocytes (Watt et al., 2019; Kuemmerle et al., 2011; Gazi et al., 2007). We showed previously that extracellular FAs are the major contributor to lipidsynthesis in PCa (Balaban et al., 2019). Moreover, targeting FA uptake using an antibody against CD36, a major transporter for exogenous FAs into the cells, reduced cancer severity in patient-derived xenografts, and CD36 deletion slowed cancer progression in prostate-specific PTENmice. However, it is increasingly evident that PCa exhibits plasticity in attaining FAs and that crosstalk between de novo synthesis and FA uptake requires dual targeting of the two pathways to achieve maximal efficacy (Watt et al., 2019), an approach that would likely be associated with greater toxicity. In this study, we focused on another understudied aspect of FA metabolism in PCa, β-oxidation, to evaluate its therapeutic potential.We showed previously (Balaban et al., 2019), as have others (Schlaepfer et al., 2014; Schlaepfer et al., 2015), that PCa cells exhibit increased FAO compared to prostate epithelial PNT-1 cells, or benign epithelial cells BPH-1 and WPMY-1. This metabolic phenotype is a vulnerability for PCa cells (Schlaepfer et al., 2014; Itkonen et al., 2017; Flaig et al., 2017). FAO inhibitors such as etomoxir, perhexiline or ranolazin inhibited tumor growth in vitro and in vivo (Schlaepfer et al., 2014; Itkonen et al., 2017; Flaig et al., 2017) and sensitized cells to ENZ treatment (Itkonen et al., 2017; Flaig et al., 2017). However, all of these studies were undertaken using immortalized cell line models of PCa, and as cancer metabolism is markedly influenced by the tumor microenvironment (Martinez-Outschoorn et al., 2012; Nieman et al., 2011; Nassar et al., 2018), employing preclinical models and primary tissues that retain the complexity of this microenvironment as a stepping stone to clinical trials may accelerate clinical translation and avoid futile targeting strategies or agents. In this study, we evaluated the efficacy of the FAO inhibitor, etomoxir, using our established PDE model. Remarkably, etomoxir inhibited effectively cell proliferation in PDEs (Figure 1A), strengthening the case that targeting FA oxidation may be a promising clinical strategy. Interestingly, etomoxir was more potent in inhibition of cell proliferation in PDEs than in vitro 2-dimensional growth of LNCaP cells, emphasizing that in vitro models based on 2D cultured cells alone are sub-optimal when evaluating anti-metabolism agents. This problem is compounded by the fact that standard growth media is rich in sugar and proteins, but contains low levels of lipids. As the clinical development of etomoxir was terminated due to severe hepatotoxicity associated with treatment (Holubarsch et al., 2007), we sought to identify new β-oxidation targets in PCa. As DECR1 is a directly androgen-repressed gene, its expression increases after castration or treatment with anti-androgens and is hypothesized to maintain tumor cell survival under castration conditions. Androgen-repressed genes are markedly understudied compared with androgen-induced genes, despite the fact that they possibly mediate adaptive survival pathways when androgen signalling is perturbed, and have already yielded novel therapeutic targets (Kregel et al., 2013; Tse et al., 2017).Surprisingly, very little is known about the biological role of DECR1 in cancer. HumanDECR1deficiency is lethal, with patients exhibiting hypocarnitinemia, decreased cellularoxygen consumption, increased lactic acidosis, and unusual accumulation of FA intermediates in urine and blood due to incomplete β-oxidation (Roe et al., 1990; Houten et al., 2014). DECR1-null mice exhibit impaired lipid metabolism, hypoglycemia and activation of ketogenesis, and cold intolerance (Miinalainen et al., 2009; Mäkelä et al., 2019). These phenotypes highlight the critical role of DECR1 in lipid metabolism. We confirmed the metabolic activities of DECR1 in PCa cells using a panel of metabolomic and lipidomic analyses. DECR1 knockdown increased levels of certain acylcarnitine species, indicating inhibition of β-oxidation. These results are consistent with previous studies reporting acylcarnitine accumulation in Decr1mice and DECR1-deficient patients (Roe et al., 1990; Miinalainen et al., 2009). We showed that DECR1 knockdown selectively inhibited PUFA catabolism, accompanied by an increase in glycolysis rate, which is also consistent with previous reports of FAO inhibition or impaired mitochondrial function leading to enhanced glucose uptake and glycolysis (Schlaepfer et al., 2015; Houten et al., 2014). Lipidomic analysis showed that DECR1 knockdown increased the abundance of PUFAs and certain lipids, particularly PE and PI phospholipid species, accompanied by increased levels of mitochondrial oxidative stress and particularly lipidperoxidation. In contrast to MUFAs, PUFAsare highly susceptible to peroxidation, thereby enhancing free radical generation and accumulation of toxic lipid peroxides (Das, 2011; Magtanong et al., 2019). Consistent with a role for PUFA oxidation in DECR1 function, ectopic DECR1 overexpression decreased mitochondrial oxidative stress. An important cellular protective response to excess intracellularlipid peroxides is the induction of ferroptosis, an iron-dependent form of cell death that is triggered by lipidperoxidation. Here, we show that the ferroptosis inhibitors ferrostatin and deferoxamine or the ferroptosis inducers erastin, FIN56 and ML210 abolished and augmented the effect of DECR1 on PCa cell death, respectively. These findings are consistent with a mechanism by which DECR1 knockdown-induced cell death is a ferroptosis-mediated process caused by PUFA accumulation, a conclusion that was independently validated in human prostate cancer during revision of this article (Blomme et al., 2020). It is therefore possible that PCa cells commonly select for DECR1 overexpression, not only to enhance ATP production to fulfil energy requirements, but also to protect cells from the tumoricidal effects of excess PUFAs.PUFAsare essential FAs that cannot be synthesized in mammals and are only obtained from the diet. Dietary fat not only promotes obesity, but also PCa progression and disease aggressiveness. Several preclinical PCa studies have compared high-fat (or Western-style diets) versus low fat diet and reported that the former promotes AKT and ERK activity, tumor growth, tumor incidence in genetically engineered/transgenic mouse models, tumor progression to CRPC and metastasis (reviewed in Narita et al., 2019). Clinical case-control studies indicated saturated fat is associated with an increased risk of advanced PCa (Bairati et al., 1998; Stéfani et al., 2000; Slattery et al., 1990; Whittemore et al., 1995). Several underlying mechanisms were proposed to explain the association between dietary fat and PCa development and progression, including growth factor signalling (such as IGF-1), inflammation, and endocrine modulation (Narita et al., 2019). While the evidence supporting the negative impacts of saturated dietary FAs are more consistent, the effect of dietary PUFAs on PCa aggressiveness remains inconclusive and differences between omega-3 and omega-6 have been reported (Bairati et al., 1998; Stéfani et al., 2000; Park et al., 2009; Fu et al., 2015). In contrast to omega-3 PUFAs, which are reported to inhibit PCa progression (Wang et al., 2012), omega-6 PUFAs (Khankari et al., 2016; Brown et al., 2010), and higher omega-6/omega-3 PUFA ratio, increase PCa risk (Williams et al., 2011; Apte et al., 2013). Dietary intervention by decreasing total fat intake and increasing omega-3 PUFAs was found to improve PCa survivorship (Epstein et al., 2012; Colli and Colli, 2005; Davies et al., 2011; Ornish et al., 2005). It is unclear whether there is a preference for n-6 or n-3 PUFA β-oxidation in PCa cells, however both require DECR1 for complete β-oxidation.Although FAO is a complex process that requires the activity of several enzymes, to date the entire focus of drug development strategies has been inhibitors against CPT1, the rate-limiting step of FA β-oxidation. CPT1 is responsible for synthesizing fatty acyl-carnitines from fatty acyl-CoAs which are then transported from the cytoplasm into the mitochondria by carnitine acylcarnitine translocase for subsequent processing then entry into the β-oxidation pathway. Even though targeting CPT1 is efficient in inhibiting FA β-oxidation, the clinical use of CPT1 inhibitors is challenging. Based on our current findings, we propose that DECR1 is an attractive alternative target to CPT1. CPT1 inhibition would suppress β-oxidation of all long FA species (saturated FA, MUFA and PUFA), whilst in contrast DECR1 is specific for PUFA. Homozygous CPT1 deficiency, of either the liver or muscle isoform, is lethal in mice (Nyman et al., 2005; Ji et al., 2008; Haynie et al., 2014), but Decr1miceare viable, and clinical symptoms arose only after metabolic stress (Miinalainen et al., 2009; Mäkelä et al., 2019). The marked overexpression of DECR1 in prostate tumors across multiple clinical cohorts, potentially coupled to PUFA-related dietary interventions, may lend further selectivity to targeting strategies. Of note, the crystal structure of DECR1 active site has been solved (Alphey et al., 2005), and thus developing DECR1 inhibitors is feasible.In summary, herein we strengthen the evidence base for the critical importance of FAO and, specifically, PUFA oxidation in PCa, thereby identifying a promising new therapeutic candidate, DECR1.
Materials and methods
Meta-Analysis of lipid metabolism genes
Individual RNA-sequencing (RNA-seq) datasets composed of matched normal versus tumor prostate cancerpatient tissue samples were acquired and are listed as follows: (Bray et al., 2018) The Cancer Genome Atlas (TCGA, n = 53); (Huggins and Hodges, 1941) Nikitina AS et al. (GSE89223, n = 10) (Nikitina et al., 2017; Tran et al., 2009) Ren S et al. (n = 14) (Ren et al., 2012; and (Cai and Balk, 2011) Ding Y et al. (GSE89194, n = 45) (Ding et al., 2016). Before the meta-analysis, RNA-seq data was quality controlled and analysed using the R limma voom-eBayes pipeline (Law et al., 2016).Effect sizes (log-fold changes) and corresponding variances were collected from the differential expression analysis under the matched-pairs design. Meta-analysis was performed by applying a restricted maximum-likelihood estimator (REML) within a random-effects model using the rma function from the R metafor package. At most one missing observation out of four was allowed per gene. Next, the retained genes were intersected with the list of pre-selected 735 genes involved in lipid metabolism as identified from REACTOME. Finally, the remaining genes were rank-ordered on the basis of their meta effect size scores across all four RNA-seq datasets. Top 20 candidate genes were selected for further disease-free survival association analyses from well-characterized clinical cohorts.
Clinical datasets
Transcriptomic data was downloaded from The Cancer Genome Atlas (TCGA) data portal, cBioPortal (Cerami et al., 2012), and GEO; GSE21032 Taylor et al., 2010; GSE35988 Grasso et al., 2012; GSE6099 Tomlins et al., 2007; GSE16560 (Sboner et al., 2010). Proteomics data was extracted from Iglesias-Gato et al., 2018.
Cell lines and tissue culture
The human normal prostate epithelial cell lines PNT1 and PNT2 were obtained from the European Collection of Authenticated Cell Cultures (ECACC), and prostate carcinoma cells LNCaP, VCaP, and 22RV1 were obtained from the American Type Culture Collection (ATCC; Rockville, MD, USA). Castrate resistant V16D and enzalutamide resistant MR49F cells were derived through serial xenograft passage of LNCaP cells (Toren et al., 2016) were a kind gift from Prof. Amina Zoubeidi laboratory. Cell lines were verified in 2018 via short tandem repeat profiling (Cell Bank Australia). Cell lines were maintained in RPMI-1640 medium containing 10% fetal bovine serum (FBS; Sigma-Aldrich, NSW, Australia) in 5% CO2 in a humidified atmosphere at 37°C. Prior to androgen treatment, cells were seeded in medium supplemented with 5% dextran charcoal coated FBS (DCC-FBS) and after 24 hr, 1 nM or 10 nM of dihydrotestosterone (DHT) was added. For anti-androgen treatment, cells were cultured in growth medium supplemented with 2.5 µM, 5 µM, 7.5 µM or 10 µM Enzalutamide (dissolved in dimethyl sulfoxide, DMSO; Sigma Aldrich). The sources and experimental conditions for primary antibodies used in this study are listed in the Key Resources Table. Primers were obtained from Sigma-Aldrich and their sequences are detailed in the Key Resources Table.
Ex vivo culture of human prostate tumors
Patient derived-explant culture was carried out according to techniques established in our laboratory and as described previously (Armstrong et al., 2016; Centenera et al., 2018; Centenera et al., 2013). 6 mm/8 mm biopsy cores were collected from men undergoing robotic radical prostatectomy at St. Andrew's Hospital (Adelaide, South Australia) with written informed consent through the Australian Prostate Cancer BioResource. The tissue was dissected into smaller 1 mm3 pieces and cultured on Gelfoam sponges (80 × 125 mm Pfizer 1205147) in 24-well plates pre-soaked in 500 µl RPMI‐1640 with 10% FBS, antibiotic/antimycotic solution. Etomoxir (100 µM) or Enzalutamide (10 µM) was added into each well and the tissues were cultured in 5% CO2 in a humidified atmosphere at 37°C for 48 hr, then snap frozen in liquid nitrogen and stored at −80°C, or formalin-fixed and paraffin-embedded.
Immunohistochemistry (IHC)
Paraffin-embedded tissue sections (2–4 µm) were deparaffinized in xylene, rehydrated through graded ethanol, and blocked for endogenous peroxidase before being subjected to heat-induced epitope retrieval (Armstrong et al., 2016). IHC staining was performed using DECR1 (HPA023238, Sigma Aldrich, diluted 1:500) antibody and the 3,3′-Diaminobenzidine (DAB) Enhanced Liquid Substrate System tetrahydrochloride (Sigma Aldrich) as described previously (Armstrong et al., 2016). Intensity of DECR1 immunostaining was measured by video image analysis (Armstrong et al., 2016).
Western blotting
Protein lysates were collected in RIPA lysis buffer (10 mMTris, 150 mMNaCl, 1 mMEDTA, 1% Triton X-100, 10% protease inhibitor). Western blotting on whole cell protein lysates were performed as previously described (Armstrong et al., 2016). Cell Fractionation. Protein lysates from each subcellular fraction (cytoplasm, mitochondria, and nucleus) were obtained from PNT1 and LNCaP cells using the cell fractionation kit (Abcam, VIC, Australia) according to the manufacturer’s protocol.
Quantitative Real-Time PCR (qPCR)
RNA was extracted from cells using the RNeasy RNA extraction kit (Qiagen), followed by the iScript cDNA Synthesis kit (Bio-Rad, NSW, Australia). qPCR was performed with a 1:10 dilution of cDNA using SYBR Green (Bio-Rad) on a CFX384 Real-Time System (Bio-Rad). Relative gene expression was calculated using the comparative Ct method and normalized to the internal control genes GUSB and L19 for prostate cancer cells and LNCaP-derived tumors, or TUBA1B, PPIA and GAPDH for PDEs.
Analysis of published ChIP-seq data
AR ChIP-seq data from published external datasets, GSE56288 (clinical specimens; seven normal prostate and 13 primary tumors) (Pomerantz et al., 2015) and GSE55064 (VCaP cell line; Veh, DHT treated, MDV3100 treated and Bicalutamide treated) (Asangani et al., 2014) were obtained from GEO and visualized using the Integrated Genome Browser (IGV).
Chromatin immunoprecipitation (ChIP)
LNCaP cells were seeded at 3 × 106 cells/plate in 15 cm plates in RPMI-1640 medium containing 10% DCC-FBS for 3 days, then treated for 4 hr with 10 nM DHT or Vehicle (ethanol). AR ChIP was performed as described previously (Paltoglou et al., 2017).
Transient RNA interference
The humanDECR1 ON-TARGET plus small interfering RNAs (siRNAs) and control siRNA (D-001810-01-20 ON-TARGET plus Non-targeting siRNA #1) were purchased from Millennium Science (VIC, Australia). Four siRNA were tested and the two most effective were selected for our experimentation: siDECR1-1 (J-009642-05-0002) and siDECR1-2 (J-009642-06-0002). The siRNAs at a concentration of 5 nM were reverse transfected using Lipofectamine RNAiMAX transfection reagent (Invitrogen, VIC, Australia) according to the manufacturer’s protocol. DECR1 downregulation (>80%) was confirmed on mRNA and protein levels.
Generation of stable shDECR1 and hDECR1 LNCaP cells
Short hairpin lentiviral expression vector
LNCaP cells were transduced with the universal negative control shRNA lentiviral particles (shControl), DECR1 shRNA lentiviral particles (shDECR1) or hDECR1 (GFP-Puro) designed by GenTarget Inc (San Diego, CA, USA) according to the manufacturer’s protocol (Figure 5—figure supplement 3).
Figure 5—figure supplement 3.
The sequence of the DECR1 shRNA and hDECR1 vectors.
Functional assays
Cell viability
Cells were seeded in triplicates in 24-well plates at a density of 3.0 × 104–6.0 × 104 cells/well and reverse transfected with siRNA overnight. Cells were manually counted using a hemocytometer 96 hr post-siRNA knockdown and viability was assessed by Trypan Blue exclusion as described previously (Armstrong et al., 2016).
Cell migration
Transwell migration assays were performed using 24-well polycarbonate Transwell inserts (3422, Sigma Aldrich). LNCaP, 22RV1 and MR49F cells transfected overnight with siRNA were seeded into the upper chamber of the Transwell at a density of 8 × 104–2.5 × 105 cells/well in serum-free medium. 650 µl of medium containing 5% FBS was added to the bottom chamber. Cells were incubated at 37°C for 48 hr. Non-migrated cells were gently removed using a cotton-tipped swab. The inserts were fixed in 4% paraformaldehyde for 20 min and stained with 1% crystal violet for 30 min. The images of migrated cells were captured using the Axio Scope A1 Fluorescent Microscope (Zeiss) at 40X magnification. The number of migrated cells were counted manually and presented as percentages relative to control cells ± SEM.
Cell invasion
Cell invasion were assessed using 24-well-plate BD Biocoat Matrigel Invasion Chambers (In Vitro Technologies, NSW, Australia) according to the supplier instructions. After 48 hr of siRNA transfection, 650 µl of medium containing 10% FBS was added to the bottom chamber, and equal number of cells within 1% FBS-contained medium were transferred to the upper chamber. After incubation at 37°C, 5% CO2 for 48 hr, non-invading cells as well as the Matrigel from the interior of the inserts were gently removed using a cotton-tipped swab. The inserts were fixed in 4% paraformaldehyde for 20 min and stained with 1% crystal violet for 30 min. The images of invaded cells were captured using the Axio Scope A1 Fluorescent Microscope (Zeiss) at 40X magnification. The number of invaded cells were counted manually and presented as percentages relative to control cells ± SEM.
Colony formation assay
DECR1 stable knockdown cells (shDECR1) or negative control cells (shControl) were prepared in a single-cell suspension before being plated in 6-well plates (500 cells/well). Cells were incubated for 2 weeks at 37°C and medium was replenished every 3–7 days. After 3 weeks, cells were washed with PBS, fixed with 4% paraformaldehyde and stained with 1% crystal violet for 30 min. Colonies were counted manually, and results were reported as number of colonies ± SEM.
3D Spheroid growth assay
LNCaP and 22RV1 cells were transfected with siRNA in 6-well plates for 48 hr. Cells were collected and prepared at a concentration of 7.5 × 104 cells/ml. Cell suspensions (1500 cells in 20 µl) were pipetted onto the inside of a petri dish lid, and 15 ml of PBS was added to the dish to prevent the drops from drying. The petri dishes were reassembled and incubated at 37°C for 5 days. Photos of the formed spheres were captured, and the sphere volume was determined using ReViSP software (Piccinini et al., 2015).
Seahorse extracellular flux analysis
Cells were plated on XF96 well cell culture microplates (Agilent, VIC, Australia) at equal densities in substrate-limited medium (DMEM with 0.5 mMglucose, 1.0 mMglutamine, 0.5 mMcarnitine and 1% FBS) and incubated overnight. One hour before the beginning of OCR measurement, the cells were changed into FAO Assay Medium (111 mMNaCl, 4.7 mMKCl, 2.0 mMMgSO4, 1.2 mMNa2HPO4, 2.5 mMglucose, 0.5 mMcarnitine and 5 mMHEPES). After baseline OCR is stabilized in FAO Assay Medium, 200 µM of linoleic-acid (LA) or palmitic acid (PA) were added before initializing measurements. Extracellular flux analysis was performed using the Seahorse XF Cell Mitochondrial Stress Test kit (Seahorse Bioscience) according to the manufacturer’s protocol. Extracellular flux experiments were performed on a Seahorse XF96 Analyzer and results were analysed using Seahorse Wave software for XF analyzers. The OCR values were normalized to cell numbers in each well.
Metabolomics
LNCaP cells were transfected with siRNA for 96 hr in no glucose medium (containing 10% FBS) supplemented with 2.5 mMglucose in 6-well plates. Cells were washed with 1 ml of 37°C Milli-Q water on the shaker for 2 s. The plate was placed in sufficient volumes of liquid nitrogen, enough to cover the surface of the plate and was briefly stored on dry ice. 600 µl of ice cold 90% 9:1 methanol:chloroform (MeOH:CHCl3) extraction solvent containing the internal standards (0.5 µl/samples) was added onto each well and allowed to incubate for 10 min. Cells were collected into 1.5 ml Eppendorf tubes, incubated on ice for 5 min, and centrifuged at 4°C for 5 min at 16,100 g. The supernatant was then transferred into a fresh 1.5 ml Eppendorf tube and allowed to dry in a Speedvac. Dried samples were derivatised with 20 µl methoxyamine (30 mg/ml in pyridine, Sigma Aldrich) and 20 µl N,O-Bis(trimethylsilyl)trifluoroacetamide (BSTFA) + 1% Trimethylchlorosilane (TMCS). The derivatised samples were analysed using GC QQQ targeted metabolomics as described in Best et al., 2018.
Lipidomics
Lipid extraction
700 μl of sample (4 μl of plasma diluted in water, or 700 μl of homogenized cells) was mixed with 800 μl 1 N HCl:CH3OH 1:8 (v/v), 900 μl CHCl3 and 200 μg/ml of the antioxidant 2,6-di-tert-butyl-4-methylphenol (BHT; Sigma Aldrich). 3 μl of SPLASH LIPIDOMIX Mass Spec Standard (#330707, Avanti PolarLipids) was spiked into the extract mix. The organic fraction was evaporated using a Savant Speedvac spd111v (Thermo Fisher Scientific) at room temperature and the remaining lipidpellet was stored at - 20°C under argon.
Mass spectrometry
Lipidpellets were reconstituted in 100% ethanol. Lipid species were analyzed by liquid chromatography electrospray ionization tandem mass spectrometry (LC-ESI/MS/MS) on a Nexera X2 UHPLC system (Shimadzu) coupled with hybrid triple quadrupole/linear ion trap mass spectrometer (6500+ QTRAP system; AB SCIEX). Chromatographic separation was performed on a XBridge amide column (150 mm ×4.6 mm, 3.5 μm; Waters) maintained at 35°C using mobile phase A [1 mM ammonium acetate in water-acetonitrile 5:95 (v/v)] and mobile phase B [1 mM ammonium acetate in water-acetonitrile 50:50 (v/v)] in the following gradient: (0–6 min: 0% B → 6% B; 6–10 min: 6% B → 25% B; 10–11 min: 25% B → 98% B; 11–13 min: 98% B → 100% B; 13–19 min: 100% B; 19–24 min: 0% B) at a flow rate of 0.7 mL/min which was increased to 1.5 mL/min from 13 min onwards. SM, CE, CER, DCER, HCER, LCER were measured in positive ion mode with a precursor scan of 184.1, 369.4, 264.4, 266.4, 264.4 and 264.4 respectively. TAG, DAG and MAG were measured in positive ion mode with a neutral loss scan for one of the fatty acyl moieties. PC, LPC, PE, LPE, PG, LPG, PI, LPI, PS and LPS were measured in negative ion mode by fatty acyl fragment ions. Lipid quantification was performed by scheduled multiple reactions monitoring (MRM), the transitions being based on the neutral losses or the typical product ions as described above. The instrument parameters were as follows: Curtain Gas = 35 psi; Collision Gas = 8 a.u. (medium); IonSpray Voltage = 5500 V and −4,500 V; Temperature = 550°C; Ion Source Gas 1 = 50 psi; Ion Source Gas 2 = 60 psi; Declustering Potential = 60 V and −80 V; Entrance Potential = 10 V and −10 V; Collision Cell Exit Potential = 15 V and −15 V. The following fatty acyl moieties were taken into account for the lipidomic analysis: 14:0, 14:1, 16:0, 16:1, 16:2, 18:0, 18:1, 18:2, 18:3, 20:0, 20:1, 20:2, 20:3, 20:4, 20:5, 22:0, 22:1, 22:2, 22:4, 22:5 and 22:6 except for TGs which considered: 16:0, 16:1, 18:0, 18:1, 18:2, 18:3, 20:3, 20:4, 20:5, 22:2, 22:3, 22:4, 22:5, 22:6.
Data analysis
Peak integration was performed with the MultiQuant software version 3.0.3. Lipid species signals were corrected for isotopic contributions (calculated with Python Molmass 2019.1.1) and were normalized to internal standard signals. Unpaired T-test p-values and FDR corrected p-values (using the Benjamini/Hochberg procedure) were calculated in Python StatsModels version 0.10.1.
Mitochondrial ROS measurement
LNCaP cells were transfected with siRNA for 96 hr in 6-well plates. Cells were collected into fluorescence-activated cell sorting (FACS) tubes and stained with 2.5 µM of MitoSOX Red stain (Thermo Fisher Scientific, VIC, Australia) for 30 min in a 37°C water bath. Cells were centrifuged at 1,500 rpm for 5 min, washed twice with 500 µl of PBS, and resuspended in 500 µl of pre-warmed PBS before the samples are read on a BD FACSymphony flow cytometer.
Acylcarnitine measurement
Total lipids were extracted from cells using two-phase extraction with methyl-tert-butyl-ether (MTBE)/methanol/water (10:3:2.5, v/v/v) (Matyash et al., 2008). Cell pellets were frozen in 8:1 methanol/water prior to extraction with the above solvent mixture; for cell culture supernatant samples, the cell culture medium replaced the water component. Deuterated (D3)-palmitoylcarnitine was included as an internal standard (200 pmole/sample for LNCaPsamples; 20 pmole/sample for tumor explant samples). Samples were reconstituted in 200 μL of the HPLC starting condition, defined below.Acylcarnitines were quantified by liquid chromatography-tandem mass spectrometry using a Q-Exactive HF-X mass spectrometer with heated electrospray ionization and a Vantage HPLC system (ThermoFisher Scientific). Extracts were resolved on a 2.1 × 100 mmWaters Acquity C18 UPLC column (1.7 µm pore size), using an 18 min binary gradient at 0.28 mL/min flow rate, as follows: 0 min, 80:20 A/B; 3 min, 80:20 A/B; 6 min, 57:43 A/B; 8 min, 35:65 A/B; 9 min, 0:100 A/B; 14 min, 0:100 A/B; 14.5 min, 80:20 A/B; 18 min, 80:20 A/B. Solvent A: 10 mM ammonium formate, 0.1% formic acid in acetonitrile:water (60:40); Solvent B: 10 mM ammonium formate, 0.1% formic acid in isopropanol:acetonitrile (90:10). Data was acquired in positive ion mode with data-dependent acquisition (full scan resolution 70,000 FWHM, scan range 220–1600 m/z). The ten most abundant ions in each cycle were subjected to fragmentation (collision energy 30 eV, resolution 17,500 FWHM). An exclusion list of background ions was used based on a solvent blank. TraceFinder v5.0 (Thermo Fisher Scientific) was used for peak detection and integration, based on exact precursor ion mass (m/z tolerance four ppm) and m/z 85.0 acylcarnitine product ion. Peak areas were normalised to the D3-palmitoylcarnitine internal standard.
Lipid peroxidation analysis by imaging
For imaging, LNCaP cells following DECR1 knockdown were plated at 5 × 103 cells/well in a 8-well chamber slide. Cells were then washed with Hank’s balanced salt solution (HBSS) and incubated with 5 µM BODIPY-581/591 C11 stain (Thermo Fisher Scientific). Cells were washed and fixed with 4% paraformaldehyde (PFA), and mounted with Prolong Gold anti-fade solution with DAPI (Thermo Fisher Scientific). Cells were imaged at 60 X magnification using a Olympus FV3000 Confocal Microscope. Quantification of BODIPY-C11 stain was performed using ImageJ analysis software.
In vivo experiments
Castration + ENZ study
LNCaP cells (5 × 106 cells in 50 μL 10% FBS/RPMI 1640 medium) were co-injected subcutaneously with 50 μL Matrigel in 6-week-old NOD Scid Gamma male mice (Bioresource Facility, Austin Health, Heidelberg, Australia). When tumors reached ~200 mm3, mice were randomized in different therapy groups. One group was left untreated (n = 5), one group was treated with vehicle control (10% DMSO/PBS; n = 5), one group was treated with enzalutamide (10 mg/kg MDV3100 in 10% DMSO/PBS) and one group was castrated by surgical castration under isofluorane anesthesia (n = 9). Five of the ten castrated mice were then treated daily with enzalutamide (10 mg/kg MDV3100 in 10%DMSO/PBS) by oral gavage for 7 days. Enzalutamide therapy of castrated mice started five days after surgery.
Subcutaneous tumor growth
DECR1 stable knockdown cells (shDECR1) or negative control cells (shControl) (5 × 106 cells in 50 μL 10% FBS/RPMI 1640 medium) were co-injected subcutaneously with 50 μL matrigel in 6-week-old NOD Scid Gamma male mice. Tumors were measured using callipers and their volumes were calculated using the formula length × width2/2.
Orthotopic tumor growth
Ten microliter containing 1 × 106 DECR1 stable knockdown cells (shDECR1) or negative control cells (shControl) were -injected intraprostatically in 8 week old NOD/SCID male mice. Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed at day 3 of the injection and once weekly after that using the IVIS Spectrum In Vivo Imaging System (PerkinElmer). D-luciferin (potassium salt, PerkinElmer) was dissolved in sterile deionized water (0.03 g/ml) and injected subcutaneously (3 mg/20 g of mouse body weight) before imaging. Bioluminescence is reported as the sum of detected photons per second from a constant region of interest. After the animals were sacrificed, lungs and livers were excised for ex vivo imaging using the IVIS system.After each study, tumors were excised and half was snap frozen for RNA extraction while the other half was formalin fixed and paraffin embedded. All animal procedures were carried out in accordance with the guidelines of the National Health and Medical Research Council of Australia, with subcutaneous xenograft studies approved by the Austin Health Animal Ethics Committee (approval number A2015/05311) and orthotopic xenograft studies approved by the University of Adelaide Animal Ethics Committee (approval number M-2019–037).
Statistical analysis
Results are reported as mean ± S.E.M. Statistical analysis was performed using GraphPad Prism (V7.0 for Windows). Differences between treatment groups were compared by T-test or one-way ANOVA followed by Tukey or Dunnett post hoc test. Significance is expressed as *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.Acceptance supan class="Disease">mmpan class="Gene">ary:
Your work identifies DECR1 as an important regulatory component of polyunsaturated fatty acid oxidation in prostate cancer. Your evidence suggests that DECR1 expression contributes to prostate cancer progression and that blocking this enzyme may reverse metabolic processes that are critical for disease progression. Congratulations on your body of work!Decision letter after pan class="Chemical">peer review:
Thank you for submitting your article "DECR1 is an androgen-repressed survival factor that protects prostate tumor cells from ferroptosis" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Maureen Murphy as the Senior Editor. The reviewers have opted to remain anonymous.The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you preppan class="Gene">are a revised submission.
Supan class="Disease">mmpan class="Gene">ary:
Fatty acid oxidation is important for some types of cancer. Inhibition of fatty acid oxidation has been explored as therapeutic strategy. Drugs that inhibit CPT1, the rate-limiting enzyme in fatty acid oxidation, are effective at reducing fatty acid oxidation but are associated with considerable toxicity. In this work, the authors identify DECR1, the rate-limiting enzyme for polyunsaturated fatty acid (PUFA) oxidation as a potential therapeutic target for prostate cancer. DECR1 expression is correlated with adverse tumor pathology and prognosis. DECR1 knockdown suppresses PUFA oxidation and cell growth / viability. The authors suggest that cell death induced by targeting DECR1 occurs through ferroptosis. Overall, this is a novel body of work that is interesting and well-written with significant merits. However, there are several items that should be addressed to improve the manuscript.Essentpan class="Disease">ial revisions:
1) The conclusion that cells are dying via ferroptosis is insufficiently supported. Ferroptosis is characterized by the accumulation of phospholipid hydroperoxides which can be measured by mass spec or using the dye BODIPY C11. Are the PUFAs channeled into specific lipids (e.g. phospholipids) or do they remain as free fatty acids? Dose response curves should be performed in the presence and absence of multiple ferroptosis inducers to determine IC50s. What is the effect of deferoxamine on cell death? What are the effect of apoptosis inhibitors on the cells?2) As it stands currently, the in vivo data are not convincing. In Figure 5 the authors stated that "LNCaP cells stably depleted of DECR1 showed highly variable growth rates in vivo, but inspection of the resultant tumors revealed significantly reduced cellular proliferation compared to control cells, concomitant with reduced DECR1 expression" the author should present the data for tumor growth and tumor volume. How do the authors explain the variability in tumor growth? For IHC, the authors should show a serial section for DECR1 and KI67 expression.3) Some of the in vitro effects, e.g., cell death, pan class="Gene">are relatively modest. pan class="Gene">Are these effects intensified with stable knockdown or knockout approaches using shRNA or CRISPR/Cas?
Essentpan class="Disease">ial revisions:
1) The conclusion that cells are dying via ferroptosis is insufficiently supported. Ferroptosis is characterized by the accumulation of phospholipid hydroperoxides which can be measured by mass spec or using the dye BODIPY C11. Are the PUFAs channeled into specific lipids (e.g. phospholipids) or do they remain as free fatty acids? Dose response curves should be performed in the presence and absence of multiple ferroptosis inducers to determine IC50s. What is the effect of deferoxamine on cell death? What are the effect of apoptosis inhibitors on the cells?We have incorporated these points into our updated Figure 6 and new Figure 6—figure supplements 1 and 2 of the revised manuscript, and in the subsection “DECR1 targeting induces lipidperoxidation and cellular ferroptosis”. To summarise the changes:In our original manuscript, we showed that DECR1 down-regulation led to accumulation of the free fatty acidlinoleate (Figure 4C) and we now include new lipidomics data to show increased levels of PUFAs in the PC, π and PS classes of phospholipids (Figure 6A and B). PUFAsare highly susceptible to lipidperoxidation and ferroptosis and, in response to the reviewer’s questions, we have performed multiple additional experiments to further prove that DECR1 activity regulates ferroptosis.Firstly, in the original manuscript we showed that DECR1 knockdown increased cellular levels of malondialdehyde, a marker of lipidperoxidation (Figure 6A, now Figure 6C). As suggested by the reviewer, we used the BODIPY C11 stain and intensity quantification, which revealed significant accumulation of phospholipid hydroperoxides, a hallmark of ferroptosis (new data Figure 6E). Our original data showed that DECR1 knockdown increases mitochondrial ROS levels (Figure 6B, now Figure 6D), while ectopic overexpression of DECR1 reduces mitochondrial ROS levels (Figure 6C, now Figure 6F). We extend these findings to show that ectopic overexpression of DECR1 also significantly reduces PUFA-induced ROS levels in the mitochondria (Figure 6G).Secondly, DECR1 knockdown increased the cell sensitivity to three inducers of ferroptosis (erastin, FIN56 and ML210, compared to our original manuscript using only erastin); and we extended the dose ranges as requested to show that the three agents exhibited a lower IC50 in DECR1 downregulated cells than control cells (Figure 6J, K, Figure 6—figure supplement 1B). Moreover, we now show that two ferroptosis inhibitors, Ferrostatin-1 and Deferoxamine (as suggested), completely prevent the effects of DECR1 knockdown on LNCaP cell viability and cell death (Figure 6H and I).Finally, we showed using flow cytometry that DECR1 knockdown-induced cell death is not characteristic of apoptosis (Figure 6—figure supplement 2A), and the apoptosis inhibitor ZVAD did not rescue the cells from cell death (Figure 6—figure supplement 2B). Collectively, these data (see revised Figure 6) strongly support ferroptosis as a primary mechanism of cell death in response to DECR1 targeting.2) As it stands currently, the in vivo data are not convincing. In Figure 5 the authors stated that "LNCaP cells stably depleted of DECR1 showed highly variable growth rates in vivo, but inspection of the resultant tumors revealed significantly reduced cellular proliferation compared to control cells, concomitant with reduced DECR1 expression" the author should present the data for tumor growth and tumor volume. How do the authors explain the variability in tumor growth? For IHC, the authors should show a serial section for DECR1 and KI67 expression.Subcutaneous growth of LNCaP tumor xenografts is widely acknowledged as being highly variable. Nevertheless, there was a significant decrease in proliferative index in the shDECR1tumors compared with shControl cells. We have included a serial section for DECR1and Ki67 staining of representative tumors as requested (Figure 5—figure supplement 2B). We have also included the individual tumor growth curves as requested (Figure 5—figure supplement 2A).In order to confirm these data as well as study the effect of DECR1 downregulation on PCa in the prostate microenvironment, we undertook a second study of orthotopically-grown LNCaP xenografts. These new data confirmed that DECR1 knockdown significantly inhibits tumor growth in the prostate (new data Figure 5K), but also significantly inhibits lung metastasis (new data Figure 5L), and have been added to the revised manuscript text:“In vivo, LNCaP cells stably depleted of DECR1 showed highly variable growth rates in a subcutaneous model (Figure 5—figure supplement 2A), but inspection of the resultant tumors revealed significantly reduced cellular proliferation compared to control cells, concomitant with reduced DECR1 expression (Figure 5I, Figure 5—figure supplement 2B). To study the effect of DECR1 downregulation on PCa in the prostate microenvironment, we undertook a second study using LNCaP orthotopic xenografts. DECR1 knockdown significantly retarded tumor growth (Figure 5K, (Figure 5—figure supplement 2C, D, E), and significantly inhibited lung metastasis in the orthotopic tumor model (Figure 5L).”3) Some of the in vitro effects, e.g., cell death, pan class="Gene">are relatively modest. pan class="Gene">Are these effects intensified with stable knockdown or knockout approaches using shRNA or CRISPR/Cas?
We used our shRNA stable knockdown LNCaP cells to assess this, showing a similar effect to the transient knockdown; with a ~25% decrease in cell viability and almost 2-fold increase in cell death detected (new data Figure 5B).
Appendix 1—key resources table
Reagent type (species) or resource
Designation
Source or reference
Identifiers
Additional information
Strain, strain background (M. musculus, male)
NOD scid Gamma (M. musculus, male,) Mice
The Jackson Laboratory/Interbred at SAHMRI Bioresources
NOD.Cg-Prkdcscid/J RRID:IMSR_JAX:001303
Cell line (Homo-sapiens)
LNCaP
ATCC
ATCC CRL-1740 RRID:CVCL_1379
Cell line (Homo-sapiens)
VCaP
ATCC
ATCC CRL-2876 RRID:CVCL_2235
Cell line (Homo-sapiens)
22RV1
ATCC
ATCC CRL-2505 RRID:CVCL_1045
Cell line (Homo-sapiens)
PNT1A
The European Collection of Authenticated Cell Cultures (ECACC)
Cat# 95012614 RRID:CVCL_2163
Cell line (Homo-sapiens)
PNT2
The European Collection of Authenticated Cell Cultures (ECACC)
Cat# 95012613 RRID:CVCL_2164
Cell line (Homo-sapiens)
V16D
PMID:27046225
Kind gift from Prof. Amina Zoubeidi
Cell line (Homo-sapiens)
MR49F
PMID:27046225
Kind gift from Prof. Amina Zoubeidi
Transfected construct (Homo sapiens)
control siRNA
Dharmacon
D-001810-01-20 ON-TARGET plus Non-targeting siRNA #1
transfected construct (human)
Transfected construct (Homo sapiens)
siDECR1-1
Dharmacon
J-009642-05-0002
transfected construct (human)
Transfected construct (Homo sapiens)
siDECR1-2
Dharmacon
J-009642-06-0002
transfected construct (human)
Transfected construct (Homo sapiens)
DECR1 shRNA lentivector
GenTargrt
LVS-1002
Lentiviral construct to transfect and express the shRNA.
Transfected construct (Homo sapiens)
hDECR1 Overexpressing Lentivector
GenTargrt
LVS-2002
Lentiviral construct to transfect and overexpress DECR1.
Transfected construct (Homo sapiens)
Negative control shRNA lentivector
GenTargrt
LVS-1002
Lentiviral construct to transfect and express the shRNA.
Antibody
Anti-human β-Actin (Mouse monoclonal)
Sigma-Aldrich
Cat#: A5441 RRID:AB_476744
(WB 1:2000)
Antibody
Anti-human-HSP90 (Rabbit Polyclonal)
Cell Signalling Technology
Cat#: 48745 RRID:CVCL_E547
(WB 1:1000)
Antibody
Anti-human DECR1 (Rabbit Polyclonal)
Prestige Antibodies (Sigma-Aldrich)
Cat#: HPA023238 RRID:AB_1847587
(WB 1:1000) (IHC: 1:500)
Antibody
Anti-human Malondialdehyde (Rabbit Polyclonal)
Abcam
Cat#: ab6463 RRID:AB_305484
(WB 1:1000)
Antibody
Anti- human Androgen receptor (Rabbit Polyclonal)
Santa Cruz Biotechnology
Cat#: sc-816 RRID:AB_1563391
(WB 1:1000)
Antibody
Anti-human PARP (Rabbit Polyclonal)
Cell Signalling Technology
Cat#: 9542 RRID:AB_592473
(WB 1:1000)
Antibody
Anti-human Cytochrome C (Rabbit Polyclonal)
Abcam
Cat#: ab90529 RRID:AB_10673869
(WB 1:2000)
Other
MitoTracker Red CMXRos
Thermo Fisher Scientific
Cat#: M7512
ICC 1:1000
Other
MitoSOX Red Mitochondrial Superoxide Indicator
Thermo Fisher Scientific
Cat#: M36008
Flow Cytometry: 2.5 µM
Other
3,3′-Diaminobenzidine (DAB) Enhanced Liquid Substrate System tetrahydrochloride
Sigma Aldrich
Cat#: D3939
Other
BODIPY-C11
Thermo Fisher Scientific
Cat#: D3861
Imaging: 5 µM
Antibody
Anti-human KI67 (Mouse monoclonal)
DAKO
Cat#: M7240 RRID:AB_2142367
(IHC 1:200)
Antibody
Anti-human AR (Rabbit polyclonal)
Santa Cruz
Cat#: sc-816 RRID:AB_1563391
(WB 1:1000)
Sequence-based reagent
DECR1_F
This paper
PCR primers
CTAAATGGCACAGCCTTCGT
Sequenced-based reagent
DECR1_R
This paper
PCR primers
AACCTGAACCAGTCTCAGCA
Sequence-based reagent
GAPDH_F
This paper
PCR primers
TGCACCACCAACTGCTTAGC
Sequenced-based reagent
GAPDH_R
This paper
PCR primers
GGCATGGACTGTGGTCATGAG
Sequence-based reagent
PPIA_F
This paper
PCR primers
GCATACGGGTCCTGGCAT
Sequence-based reagent
PPIA_R
This paper
PCR primers
ACATGCTTGCCATCCAACC
Sequence-based reagent
TUBA1B _F
This paper
PCR primers
CCTTCGCCTCCTAATCCCTA
Sequence-based reagent
TUBA1B _R
This paper
PCR primers
CCGTGTTCCAGGCAGTAGA
Sequence-based reagent
MKI67_F
This paper
PCR primers
GCCTGCTCGACCCTACAGA
Sequence-based reagent
MIK67_R
This paper
PCR primers
GCTTGTCAACTGCGGTTGC
Sequence-based reagent
L19_F
This paper
PCR primers
TGCCAGTGGAAAAATCAGCCA
Sequence-based reagent
L19_R
This paper
PCR primers
CAAAGCAAATCTCGACACCTTG
Sequence-based reagent
GUSB_F
This paper
PCR primers
CGTCCCACCTAGAATCTGCT
Sequence-based reagent
GUSB_R
This paper
PCR primers
TTGCTCACAAAGGTCACAGG
Sequence-based reagent
DECR1_F
This paper
ChIP-qPCR
TTCTGGAGCGCTAAGAGAGC
Sequence-based reagent
DECR1_R
This paper
ChIP-qPCR
AGGGCTTCATCTGACAGTGG
Sequence-based reagent
KLK3_F
This paper
ChIP-qPCR
GCCTGGATCTGAGAGAGATATCATC
Sequence-based reagent
KLK3_R
This paper
ChIP-qPCR
ACACCTTTTTTTTTCTGGATTGTTG
Sequence-based reagent
NC2_F
This paper
ChIP-qPCR
GTGAGTGCCCAGTTAGAGCATCTA
Sequence-based reagent
NC2_R
This paper
ChIP-qPCR
GGAACCAGTGGGTCTTGAAGTG
Chemical compound, drug
Etomoxir
Sigma Aldrich
Cat#: E1905
Chemical compound, drug
Dihydrotestosterone
Sigma Aldrich
Cas#: 521-18-6
Chemical compound, drug
Enzalutamide
Sapphire Bioscience
Cat#: S1250
Chemical compound, drug
Bovine-serum albumin
Bovostar
Cat#: BSAS-AU
Chemical compound, drug
Linoleic acid
Sigma Aldrich
Cat#: L1376
Chemical compound, drug
Palmitic acid
Sigma Aldrich
Cat#: P0500
Chemical compound, drug
D-Luciferin
PerkinElmer
Cat#: 122799
3 mg/20 g
Chemical compound, drug
Deferoxamine
Sigma Aldrich
Cat#: D9533
Chemical compound, drug
Ferrostatin
Sigma Aldrich
Cat#: SML0583
Chemical compound, drug
Erastian
Sigma Aldrich
Cat#: E7781
Chemical compound, drug
ML210
Tocris Bioscience
Cat#: 6429
Chemical compound, drug
FIN56
Tocris Bioscience
Cat#: 6280
Chemical compound, drug
cell fractionation kit
Abcam
Cat#: ab109719
Chemical compound, drug
RNeasy RNA extraction kit
Qiagen
Cat#: 74136
Chemical compound, drug
iScript cDNA Synthesis kit
Bio-Rad
Cat#: 1708890
Chemical compound, drug
Seahorse XF Cell Mitochondrial Stress Test kit
Agilent
Cat#: 103015–100
Software, algorithm
GraphPad Prism
GraphPad Software, Inc
Prism V7 RRID:SCR_002798
Software, algorithm
R
R Development Core Team, 2019
R version 3.6.2 RRID:SCR_001905
Software, algorithm
ReViSP
PMID:25561413
ReViSP
Volume assessment of cancer spheroids
Software, algorithm
IVIS Spectrum In Vivo Imaging System
PerkinElmer
IVIS Spectrum In Vivo Imaging System RRID:SCR_018621
Authors: Isabel R Schlaepfer; Leah Rider; Lindsey Ulkus Rodrigues; Miguel A Gijón; Colton T Pac; Lina Romero; Adela Cimic; S Joseph Sirintrapun; L Michael Glodé; Robert H Eckel; Scott D Cramer Journal: Mol Cancer Ther Date: 2014-08-13 Impact factor: 6.261
Authors: A S Whittemore; L N Kolonel; A H Wu; E M John; R P Gallagher; G R Howe; J D Burch; J Hankin; D M Dreon; D W West Journal: J Natl Cancer Inst Date: 1995-05-03 Impact factor: 13.506
Authors: Chris Tran; Samedy Ouk; Nicola J Clegg; Yu Chen; Philip A Watson; Vivek Arora; John Wongvipat; Peter M Smith-Jones; Dongwon Yoo; Andrew Kwon; Teresa Wasielewska; Derek Welsbie; Charlie Degui Chen; Celestia S Higano; Tomasz M Beer; David T Hung; Howard I Scher; Michael E Jung; Charles L Sawyers Journal: Science Date: 2009-04-09 Impact factor: 47.728
Authors: B W C Tse; M Volpert; E Ratther; N Stylianou; M Nouri; K McGowan; M L Lehman; S J McPherson; M Roshan-Moniri; M S Butler; J Caradec; C Y Gregory-Evans; J McGovern; R Das; M Takhar; N Erho; M Alshalafa; E Davicioni; E M Schaeffer; R B Jenkins; A E Ross; R J Karnes; R B Den; L Fazli; P A Gregory; M E Gleave; E D Williams; P S Rennie; R Buttyan; J H Gunter; L A Selth; P J Russell; C C Nelson; B G Hollier Journal: Oncogene Date: 2017-01-16 Impact factor: 9.867
Authors: Lisa M Butler; Ylenia Perone; Jonas Dehairs; Leslie E Lupien; Vincent de Laat; Ali Talebi; Massimo Loda; William B Kinlaw; Johannes V Swinnen Journal: Adv Drug Deliv Rev Date: 2020-07-23 Impact factor: 15.470
Authors: Andrea K Miyahira; Jelani C Zarif; Catherine C Coombs; Robert R Flavell; Joshua W Russo; Samir Zaidi; Di Zhao; Shuang G Zhao; Kenneth J Pienta; Howard R Soule Journal: Prostate Date: 2021-11-03 Impact factor: 4.104
Authors: Kim H Kwan; Ingrid J G Burvenich; Margaret M Centenera; Yit Wooi Goh; Angela Rigopoulos; Jonas Dehairs; Johannes V Swinnen; Ganesh V Raj; Andrew J Hoy; Lisa M Butler; Andrew M Scott; Jonathan M White; Uwe Ackermann Journal: Nucl Med Biol Date: 2020-11-28 Impact factor: 2.408
Authors: Ali Ghoochani; En-Chi Hsu; Merve Aslan; Meghan A Rice; Holly M Nguyen; James D Brooks; Eva Corey; Ramasamy Paulmurugan; Tanya Stoyanova Journal: Cancer Res Date: 2021-01-22 Impact factor: 13.312