Literature DB >> 32683392

Resveratrol Suppresses Human Nasopharyngeal Carcinoma Cell Growth Via Inhibiting Differentiation Antagonizing Non-Protein Coding RNA (DANCR) Expression.

Jiafeng Zhang1, Xiaojie Jin1, Chuan Zhou1, Hui Zhao1, Ping He1, Yalin Hao1, Qiongna Dong1.   

Abstract

BACKGROUND Although resveratrol has been found to show anti-cancer effects and potential chemotherapeutic activities in several cancers, the role and molecular mechanisms of resveratrol in nasopharyngeal carcinoma (NPC) remains poorly understood. This study aimed to investigate the effect of resveratrol in NPC progression and its molecular mechanism. MATERIAL AND METHODS Quantitative real-time polymerase chain reaction and western blotting were used to detect the expression of DANCR and PTEN. MTT assay and EdU assay were performed to detect the cell proliferation in NPC cells with different treatment. The effect of resveratrol on cell migration was explored by Transwell migration assay. RNA immunoprecipitation assay and chromatin immunoprecipitation assay were performed to test the interaction between DANCR, EZH2, and PTEN. A mouse xenograft model of NPC cell was established, and immunohistochemistry assay was performed to detect the PTEN expression. RESULTS Resveratrol treatment inhibited NPC cell growth and migration in a dose-dependent manner. Additionally, resveratrol downregulated the expression of DANCR and DANCR overexpressing abrogated the inhibition effect of resveratrol on NPC cell migration. Mechanistically, DANCR could bind to EZH2 and downregulated PTEN expression through mediating the binding of EZH2 on PTEN promoter. Furthermore, rescue experiments suggested resveratrol inhibited NPC cell growth and migration by the DANCR/PTEN pathway. Resveratrol significantly decreased the tumor volume and tumor weight and increased the expression of PTEN. CONCLUSIONS Resveratrol increased PTEN expression and suppressed NPC cell growth and migration through downregulation of DANCR.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 32683392      PMCID: PMC7388650          DOI: 10.12659/MSM.923622

Source DB:  PubMed          Journal:  Med Sci Monit        ISSN: 1234-1010


Background

Nasopharyngeal carcinoma (NPC) is one of the most common head and neck neoplasm and is an epithelial carcinoma [1]. A distinct racial and geographic distribution is a key characteristic of NPC, as Southern China and South East Asia are high prevalence areas. To date, radiotherapy has been the main treatment for early NPC, but NPC radiotherapy is accompanied by severe side-effects, including tinnitus, dizziness and headache, reduced white blood cell, and vomiting [2]. In addition, for patients with NPC with a late course of disease, chemotherapy is used in combination with radiotherapy. Local recurrence and distant metastasis mainly result in the failure of chemotherapy and radiotherapy in NPC. It has been reported that treatment with Chinese medicine can increase the sensitivity of radiotherapy and alleviate the acute reaction of radiotherapy [3]. Therefore, finding an effective and less toxic alternative has become the inevitable trend for NPC treatment. Resveratrol (trans-3,4′,5-trihydroxystilbene, RSV) is a natural polyphenolic phytoalexin present in several plant species, such as peanuts, grapes, and herbs [4]. Mounting evidence has demonstrated the potential chemopreventive and chemotherapeutic activities of resveratrol in multiple diseases, including cancer, diabetes, cardiovascular disease, neurodegenerative disease, and metabolic disease [5,6]. Resveratrol exerts anticancer effects through mediating the function of molecular targets associated with cell proliferation, cell cycle and apoptosis [7]. Recently, research has revealed the potent anti-proliferative and pro-apoptotic effects of resveratrol in NPC [8]. However, the molecular mechanism involved in the effects of resveratrol in NPC is poorly understood. Long non-coding RNAs (lncRNAs) have been found to be emerging targets of Chinese medicine in cancer development and progression [9]. For example, curcumin could regulate the expression of lncRNA-ROR and MEG3 in prostate cancer and ovarian cancer, respectively [10,11]. Resveratrol-inhibited MALAT1 has been shown to play important roles in colorectal cancer tumorigenesis [12]. Differentiation antagonizing non-protein coding RNA (DANCR) was newly identified as an oncogenic lncRNA in various malignant tumors [13]. It has been reported that DANCR promotes the stemness features of hepatocellular carcinoma cells [14]. Our previous study found that DANCR promoted NPC cell proliferation and migration and suppressed the expression of phosphatase and tensin homolog (PTEN) in NPC cells [15]. However, the biological functions of DANCR in the anti-cancer effect of resveratrol in NPC have not been established yet. In this study, the effect of resveratrol on cell proliferation and migration was detected in NPC cell lines. Whether DANCR mediates the anti-cancer effect of resveratrol in NPC was also investigated in vitro and in vivo. Furthermore, we found that DANCR repressed PTEN expression through mediating the binding of EZH2 on PTEN promoter.

Material and Methods

Cell culture

The NPC cell lines SUNE-1 and 5-8F, maintained in our laboratory following authentication, were maintained in Roswell Park Memorial Institute (RPMI)-1640 medium (Gibco; Waltham, MA, USA) adding 10% fetal bovine serum (FBS, Gibco) in 5% CO2 at 37°C.

Cell transfection

Specific small interfering RNA (siRNA) targeting DANCR (si-DANCR), targeting EZH2 (si-EZH2), targeting PTEN (si-PTEN) and scrambled negative control (si-NC) were purchased from GenePharma (Shanghai, China) and the sequences are presented in Table 1. To construct DANCR overexpression plasmid (pcDNA-DANCR), PCR was performed with complementary DNA (cDNA) from SUNE-1 cells as the template. Plasmid (500 ng) or siRNAs (50 nM) were transfected into SUNE-1 cells and 5–8F cells using Lipofectamine® 2000 (Invitrogen) in line with the manufacturers’ instruction.
Table 1

Primer sequences and siRNA Sequences used for quantitative RT-PCR.

NameSequences (5′-3′)
DANCRForward: CGTACTAACTTGTAGCAACCReverse: TCAGCTGCATTGAGTTAGCG
PTENForward: ACTATTCCCAGTCAGAGGCGReverse: GAACTTGTCTTCCCGTCGTG
GAPDHForward: ACTCACTCAAGATTGTCAGCAReverse: GGCCATCACGCCACAGCTTT
si-DANCRGCUGGUAUUUCAAUUGACU
si-EZH2GCAGAAAGAUACAGCUGAA
si-PTENGACAGAUGUUUGAAGAUAA
si-NCUUCUCCGAACGUGUCACGU

siRNA – small interfering RNA; RT-PCR – real-time polymerase chain reaction; DANCR – differentiation antagonizing non-protein coding RNA; PTEN – phosphatase and tensin homolog; GAPDH – glyceraldehyde 3-phosphate dehydrogenase; si-DANCR – specific siRNA targeting DANCR; si-EZH2 – specific siRNA targeting EZH2; si-PTEN – specific siRNA targeting PTEN; si-NC – scrambled negative control.

Cell proliferation assay

To detect the effect of resveratrol on cell growth in SUNE-1 cells and 5–8F cells, MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay (Sigma-Aldrich) was conducted. Resveratrol was purchased from Sigma (Sigma-Aldrich) and dissolved at a concentration of 100 mmol/L in 100% dimethyl sulfoxide (DMSO) as a stock solution, stored at −20°C. The final DMSO concentration did not exceed 0.1% throughout the study. Briefly, 0 μM, 25 μM, 50 μM, and 100 μM resveratrol was added into the SUNE-1 cells or 5–8F cells (1×103/well) cultures in 96-well plates for 24 hours or 48 hours [8,16,17]. Then 10 μL of MTT (5 mg/mL) was added into each well for 4 hours and the formazan crystals was dissolved by DMSO (150 μL). A microplate reader (Thermo) was used to measure the absorbance at 490 nm. EdU (5-ethynyl-2′-deoxyuridine; RiboBio, Guangzhou, China) incorporation assay was carried out to detect the cell proliferation in SUNE-1 cells with different treatment. Briefly, cells (4×103/well) in logarithmic phase were incubated with 50 μM EdU for 2 hours followed by fixed with 4% paraformaldehyde for 30 minutes and stained with Apollo staining solution for 30 minutes. DNA content was stained by Hoechst 33342 for 30 minutes. Images were observed under a laser scanning confocal microscope (Leica TCS Sp5). Three independent experiments were conducted for each assay.

Real-time polymerase chain reaction (RT-PCR)

Following the manufacturer’s protocol, total RNA was isolated from NPC cells and tumor tissues using TRIzol® reagent (Invitrogen). For RT reaction, cDNA was obtained using the RNA as template with M-MLV reverse transcriptase (Takara.). A SYBR Green kit (Takara) was used for qPCR with 7500 Real-Time PCR System (Applied Biosystems). The qPCR primers used in this study were presented in Table 1. Relative expression normalized to GAPDH (glyceraldehyde 3-phosphate dehydrogenase) was measured by the 2−ΔΔCt quantification method [18].

Western blot

The RNA immunoprecipitation assay (RIPA) lysis buffer (Beyotime) was used to extract total protein in transfected cells. Equal amounts of proteins (30 μg) were loaded per lane in 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The separated proteins were transferred onto polyvinylidene difluoride (PVDF) membranes (Millipore), which were blocked in 5% milk at 37°C. After 2 hours, the primary antibodies, including PTEN antibody (1: 1,000; cat. no. ab31392; Abcam) and β-actin antibody (1: 2000; cat. no. ab8227; Abcam), were incubated with the membranes overnight at 4°C. After washing with tris-buffered saline (TBS) buffer, the membrane was incubated with the horseradish peroxidase-conjugated secondary antibody (1: 2000; cat. no. ab6721; Abcam) for 2 hours. Blots were observed using the ECL detection system and analyzed by ImageJ V1.8 (National Institutes of Health). The results were calculated from 3 independent experiments.

Cell migration assay

SUNE-1 cells or 5–8F cells exposed to different treatment in serum-free medium were cultured in the upper chambers of Transwell chamber. In the lower chamber, RPMI-1640 medium containing 10% FBS acted as chemotactic factor. After cultured in incubator with 37°C, 5% CO2 for 24 hours, migrated cells to the lower chamber were fixed in 4% paraformaldehyde, stained with 0.1% crystal violet (Sigma-Aldrich), and photographed. Each experiment was performed in triplicate.

RNA immunoprecipitation (RIP) assay

RIP assay was carried out with RNA-Binding Protein Immunoprecipitation Kit (Millipore) following the manufacturer’s instructions. Briefly, cell lysates were incubated with antibody against EZH2 or negative control IgG overnight at 4°C. The immunoprecipitated RNA was collected and analyzed with qRT-PCR to quantify DANCR expression.

Chromatin immunoprecipitation (ChIP) assay

The EZ-ChIPTM kit (Millipore, Billerica, MA, USA) was used for chromatin immunoprecipitation (ChIP) assay. Briefly, nucleus was isolated from the cell lysates. Crosslinked chromatin was sonicated to shear the DNA. The chromatin supernatants were incubated with following antibodies: EZH2 (cat. no. ab191250; Abcam), H3K27me3 (cat. no. ab6002; Abcam). Normal IgG served as the control. After elution and de-crosslinking, the chromatin was analyzed by qRT-PCR.

Immunohistochemistry

Paraffin-embedded tissue specimens were deparaffinized and rehydrated. The sections were incubated with anti-PTEN antibody (1: 100; cat. no. ab31392; Abcam) overnight at 4°C. Then sections were incubated with secondary antibody for 20 minutes at 37°C. The proteins were visualized with diaminobenzidine.

Establishment of a mouse xenograft model of NPC cells

All animal experiments were approved by The Institutional Animal Care and Use Committee of Ren Ji Hospital, School of Medicine, Shanghai Jiaotong University. BALB/c nu/nu mice (weight, 25–30 g; age, 6-weeks) were purchased from Better Biotechnology Co., Ltd. (Nanjing, China). SUNE-1 cells (2×106) were injected into the right flanks of nude mice. One week after the inoculation, the mice were randomly divided into 2 groups (n=5 for each group): the control group and resveratrol treatment group. The mice in resveratrol treatment group were intraperitoneally injected with resveratrol at 20 mg/kg body weight; dissolved in 200 μL of 10% DMSO in phosphate-buffered saline (PBS) once a day until the completion of the experiment. The mice in control group were exposed to the vehicle (10% DMSO in PBS). The equation: V=1/2×length×width2, was used to measure tumor sizes. After sacrificed by cervical dislocation soaked in 75% ethanol for 10 minutes, tumor tissues were collected for further analysis at the end of the experiments.

Statistical analysis

Data analyzed by SPSS software (Version 23) were shown as the mean±standard deviation from three replicates. Student’s t-test was used to assess differences between 2 groups, and multiple comparisons was analyzed by one-way analysis of variance (ANOVA) followed by Student-Newman-Keuls post hoc test. Statistically significant difference was represented by the P value <0.05.

Results

Resveratrol treatment inhibited NPC cell growth and migration

SUNE-1 cells and 5–8F cells were subjected to different concentration of resveratrol for 24 hours or 48 hours. The results of MTT assay suggested that resveratrol significantly decreased the cell viabilities in SUNE-1 cells and 5–8F cells in a dose-dependent manner, as evidenced by the decreased cell viability in the 100 μM resveratrol group compared to the 25 μM and 50 μM resveratrol group (Figure 1A). Then, we estimated the changes in cell migration by Transwell migration assay. As shown in Figure 1B, cell migration of SUNE-1 and 5–8F cells were also obviously repressed after resveratrol treatment. These results suggested the anti-tumor effect of resveratrol in NPC as demonstrated by the inhibited NPC cell growth and migration after resveratrol treatment.
Figure 1

Resveratrol treatment inhibited NPC cell growth and migration. SUNE-1 cells and 5–8F cells were treated with different concentration of resveratrol for 24 hours or 48 hours. (A) Cell growth and (B) migration were detected by MTT assay and Transwell migration assay, respectively. Data were shown as the mean±SD of 3 independent experiments. * P<0.05 compared with control. NPC – nasopharyngeal carcinoma; MTT – 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide); SD – standard deviation.

DANCR mediates the anti-cancer effect of resveratrol in NPC

To investigate the role of DANCR in the anti-cancer effect of resveratrol, we first detected the relative DANCR level in SUNE-1 cells and 5–8F cells treated with resveratrol. Resveratrol significantly suppressed the expression of DANCR in SUNE-1 cells and 5–8F cells in a dose-dependent manner (Figure 2A). Then, pcDNA-DANCR vector was constructed to overexpress DANCR and the expression of DANCR was increased by 4.13-fold and 4.78-fold in SUNE-1 cells and 5–8F cells (Figure 2B). The expression of DANCR was also downregulated by si-DANCR in SUNE-1 cells and 5–8F cells (Figure 2B). As shown in Figure 2C, DANCR overexpressing abrogated the inhibition effect of resveratrol on NPC cell migration, suggesting that resveratrol regulated metastasis of NPC by targeting and downregulation of DANCR expression. We further explored the effect of resveratrol and DANCR on PTEN expression, which was a common tumor suppressor. Western blot assay demonstrated that resveratrol treatment enhanced the protein level of PTEN in SUNE-1 and 5–8F cells, while DANCR overexpression played the opposite role (Figure 2D, 2E).
Figure 2

DANCR mediated the anti-cancer effect of resveratrol in NPC. Relative DANCR level was determined by qRT-PCR in SUNE-1 cells and 5–8F cells treated with resveratrol (A) or transfected with pcDNA-DANCR or si-DANCR (B). (C) Cell migration was measured in SUNE-1 cells and 5–8F cells treated with resveratrol and pcDNA-DANCR. The protein level of PTEN was detected by western blot in SUNE-1 cells and 5–8F cells treated with resveratrol (D) or transfected with pcDNA-DANCR (E). Data were shown as the mean±SD of 3 independent experiments. * P<0.05 compared with control group or pcDNA group or si-NC group. DANCR – differentiation antagonizing non-protein coding RNA; NPC – nasopharyngeal carcinoma; qRT-PCR – quantitative real-time polymerase chain reaction; pcDNA – plasmid cloned DNA; si-DANCR – specific small interfering RNA (siRNA) targeting DANCR; si-NC – scrambled negative control; SD – standard deviation.

DANCR was required for EZH2 binding on PTEN promoter

Our experiments verified that resveratrol and DANCR regulated the expression of PTEN, and DANCR mediates the anti-cancer effect of resveratrol in NPC, thus, we further investigated the mechanism of how DANCR regulated PTEN. The loss function assay indicated that DANCR knockdown dramatically increased the mRNA level of PTEN by 4.62-fold and 5.55-fold in SUNE-1 and 5–8F cells, respectively (Figure 3A). It was previously reported that DANCR could interact with methyltransferase EZH2 which modulated the gene silencing through catalyzing the trimethylation of histone 3 on lysine 27 (H3K27me3) [19]. In addition, EZH2 has been reported to bind to PTEN promotor and inhibited its expression [20]. Thus, we speculated that DANCR silenced PTEN expression through mediating the binding of EZH2 on PTEN promoter. Therefore, RIP assay was performed using anti-EZH2 antibodies in SUNE-1 and 5–8F cells. The results showed that DANCR was significantly enriched following immunoprecipitation of EZH2 compared with IgG (Figure 3B), suggesting that DANCR could bind to EZH2. Silencing EZH2 was obtained through the transfection of si-EZH2 in SUNE-1 and 5–8F cells (Figure 3C). To explore the effect of EZH2 on the expression of PTEN, SUNE-1 and 5–8F cells were transfected with si-EZH2. As shown in Figure 3D, silencing EZH2 enhanced PTEN expression in SUNE-1 and 5–8F cells, resulting in a 3.75-fold and 2.55-fold increase in PTEN mRNA level, respectively (Figure 3D). In addition, si-PTEN decreased the expression of PTEN in SUNE-1 and 5–8F cells. Finally, ChIP assay was conducted in SUNE-1 and 5–8F cells transfected with si-NC or si-DANCR. Silencing DANCR decreased EZH2 binding and H3K27me3 enrichment on PTEN promoter (Figure 3E). These results suggested that DANCR downregulated PTEN by interacting with EZH2.
Figure 3

DANCR was required for EZH2 binding on PTEN promoter. (A) The expression of PTEN in SUNE-1 cells and 5–8F cells transfected with si-DANCR was determined by qRT-PCR and western blot analysis. (B) RIP assay was performed in SUNE-1 cells and 5–8F cells. (C) The expression of EZH2 in SUNE-1 cells and 5–8F cells transfected with si-EZH2. (D) The expression of PTEN in SUNE-1 cells and 5–8F cells transfected with si-EZH2 or si-PTEN was determined by qRT-PCR and western blot analysis. (E) ChIP analysis on PTEN promoter was performed in SUNE-1 cells and 5–8F cells transfected with si-DANCR. Data were shown as the mean±SD of 3 independent experiments. * P<0.05 versus si-NC group or IgG group. DANCR – differentiation antagonizing non-protein coding RNA; PTEN – phosphatase and tensin homolog; si-DANCR – specific small interfering RNA (siRNA) targeting DANCR; qRT-PCR – quantitative real-time polymerase chain reaction; RIP – RNA immunoprecipitation; ChIP – chromatin immunoprecipitation; SD – standard deviation, si-NC – scrambled negative control.

Resveratrol inhibited NPC cell growth and migration by DANCR/PTEN pathway

To investigate the involvement of DANCR and PTEN in resveratrol-mediated NPC progression, rescue assays were designed. As shown in Figure 4A, resveratrol plus DANCR overexpression significantly decreased the expression of PTEN and resulted in the decreased mRNA level by 37.2% and 42.8% compared with resveratrol treatment alone in SUNE-1 and 5–8F cells, respectively. EdU incorporation assay and Transwell migration assay showed that DANCR overexpression or PTEN silencing obviously reversed the suppression of cell proliferation and migration induced by resveratrol in SUNE-1 cells (Figure 4B, 4C).
Figure 4

Resveratrol inhibited NPC cell growth and migration by DANCR/PTEN pathway. SUNE-1 cells and 5–8F cells were treated with resveratrol and transfected with pcDNA-DANCR. (A) The expression of PTEN was determined by qRT-PCR and western blot analysis in these cells. (B) EdU incorporation assay and (C)Transwell migration assay was performed in these cells. Data were shown as the mean±SD of 3 independent experiments. * P<0.05 versus control group; # P<0.05 versus RSV+pcDNA group. NPC – nasopharyngeal carcinoma; DANCR – differentiation antagonizing non-protein coding RNA; PTEN – phosphatase and tensin homolog; qRT-PCR – quantitative real-time polymerase chain reaction; EdU – 5-ethynyl-2′-deoxyuridine; SD – standard deviation; RSV – resveratrol; pcDNA – plasmid cloned DNA.

Resveratrol suppressed NPC tumor growth in vivo

To verify the role of resveratrol in NPC in vivo, a xenograft NPC mouse model was established, and the mice were exposed to resveratrol or vehicle. The results revealed that resveratrol significantly decreased tumor volume and tumor weight (Figure 5A, 5B, 5D). Relative DANCR level in tumor tissue was obviously repressed by 58% after resveratrol treatment (Figure 5C). Immunohistochemical assay suggested that resveratrol treatment increased the expression of PTEN in tumor tissue (Figure 5E).
Figure 5

Resveratrol suppressed NPC tumor growth in vivo. (A) The tumor volume was calculated every 4 days. (B) The tumor weight was measured. (C) Relative DANCR level in tumor tissue was detected by qRT-PCR. (D) Representative images of tumors in each group; bar=1 cm. (E) Immunohistochemical assay was performed using PTEN antibody in tumor tissues. Data were shown as the mean ± SD of 3 independent experiments. * P<0.05 versus control group. NPC – nasopharyngeal carcinoma; DANCR – differentiation antagonizing non-protein coding RNA; qRT-PCR – quantitative real-time polymerase chain reaction; PTEN – phosphatase and tensin homolog; SD – standard deviation.

Discussion

Although the 5-year survival rate of NPC patients was greatly improved via the combination of chemotherapy and radiotherapy, the overall prognosis remains poor resulting from high recurrence and relapse rates. Numerous phytochemicals have been found to be cost-effective, with several beneficial effects on health, including anti-tumor, antioxidant, and anti-inflammatory functions [9]. Resveratrol, as a polyphenolic phytoalexin, has garnered the attention of several researchers for its pleiotropic activities to suppress tumor growth on several cancers, including prostate cancer, gastric cancer, and breast cancer [21-23]. In this study, we found anti-tumor effects of resveratrol in NPC as demonstrated by the inhibited NPC cell growth and migration after resveratrol treatment. Resveratrol suppressed NPC tumor growth in vivo. Consistent with our study, Xiong et al. demonstrated the antitumor effect of resveratrol on human NPC cells through inhibiting survivin expression [16]. Huang et al. found that resveratrol could increase cell apoptosis in NPC cells via regulating mitochondria and endoplasmic reticulum stress [24]. It has been reported that resveratrol could modulate multiple pathways and the expression of lncRNAs, resulting in the suppression of proliferation, migration, and invasion of cancer cells [25]. For example, Geng et al. suggested that resveratrol-mediated inhibition of NEAT1 repressed proliferation and migration of multiple myeloma cells via the Wnt/β-catenin signaling pathway [26]. We found that resveratrol regulated metastasis of NPC by targeting and downregulation of DANCR expression. Resveratrol controls several key oncogenic pathways, such as PI3K/Akt, JAK/STAT, JNK, p38/MAPK, and Wnt/β-catenin, which might further regulate the expression of transcription factors. Additionally, lncRNA could be regulated by some transcription factors. If resveratrol can downregulate the expression of DANCR through transcription factors requires further study. DANCR has been reported to be an oncogenic gene in several cancers [14,27]. Mao et al. suggested that DANCR promoted gastric cancer migration and invasion via epigenetically silencing lncRNA-LET [28]. Zhang et al. demonstrated DANCR was associated with papillary thyroid cancer aggressive clinical features [29]. DANCR also acted as a microRNA (miRNA) sponge to participate in tumorigenesis and progression, such as targeting miR-496 in lung adenocarcinoma and miR-149 in bladder cancer [27,30]. In our previous study, DANCR was found to suppress the expression of PTEN in NPC cells [15]. In our current study, we also found DANCR inhibited NPC cell growth and migration by repressing PTEN. To unravel the mechanism of how DANCR regulated PTEN, we first detect the interaction between DANCR and EZH2, which was reported to bind to PTEN promotor and inhibited its expression. RIP assay showed that DANCR could bind to EZH2. ChIP assay further suggested that silencing DANCR decreased EZH2 binding and H3K27me3 enrichment on PTEN promoter. PTEN is a common suppressor in several malignant tumor, including NPC. For example, miRNA-222 promotes tumor growth and confers radio-resistance in NPC by targeting PTEN [31]. Another report showed that LIM and SH3 protein 1 promotes NPC progression through negatively regulation of PTEN [32]. PTEN could function as a protein phosphatase to dephosphorylate phosphatidylinositol-(3,4,5)-trisphosphate, then suppressing PI3K/AKT pathway [33]. PI3K/AKT pathway was associated with the activation of several protein targets that are involved in cell proliferation, invasion, and tumorigenesis. PTEN can be regulated via several mechanisms, including epigenetic silencing, transcriptional repression, and miRNA regulation [31,34]. Several lines of evidence suggested that EZH2 could epigenetically regulate the expression of PTEN via catalyzing H3K27me3 [34]. EZH2, as the functional component of the polycomb repressive complex 2 (PRC2), can catalyze H3K27me3 to repress gene transcription. Mechanistically, our results indicated that DANCR downregulated PTEN expression through mediating the binding of EZH2 on PTEN promoter.

Conclusions

Our results demonstrated that resveratrol could increase PTEN expression and suppress NPC cell growth and migration through downregulation of DANCR. Mechanistically, DANCR downregulated PTEN by interacting with EZH2. Our data suggest that resveratrol may represent as a potential treatment for patients with NPC and repression of DANCR levels may be beneficial for increasing the anti-cancer effect of resveratrol.
  34 in total

1.  Curcumin suppresses proliferation and in vitro invasion of human prostate cancer stem cells by ceRNA effect of miR-145 and lncRNA-ROR.

Authors:  Te Liu; Huiying Chi; Jiulin Chen; Chuan Chen; Yongyi Huang; Hao Xi; Jun Xue; Yibing Si
Journal:  Gene       Date:  2017-08-24       Impact factor: 3.688

2.  Long noncoding RNA DANCR increases stemness features of hepatocellular carcinoma by derepression of CTNNB1.

Authors:  Sheng-xian Yuan; Jie Wang; Fu Yang; Qi-fei Tao; Jin Zhang; Li-li Wang; Yuan Yang; Hui Liu; Zhen-guang Wang; Qing-guo Xu; Jia Fan; Lei Liu; Shu-han Sun; Wei-ping Zhou
Journal:  Hepatology       Date:  2015-07-22       Impact factor: 17.425

Review 3.  PI3K-Akt pathway: its functions and alterations in human cancer.

Authors:  M Osaki; M Oshimura; H Ito
Journal:  Apoptosis       Date:  2004-11       Impact factor: 4.677

4.  Curcumin suppresses cisplatin resistance development partly via modulating extracellular vesicle-mediated transfer of MEG3 and miR-214 in ovarian cancer.

Authors:  Jing Zhang; Jinyu Liu; Xinyan Xu; Li Li
Journal:  Cancer Chemother Pharmacol       Date:  2017-02-08       Impact factor: 3.333

5.  microRNA-222 promotes tumor growth and confers radioresistance in nasopharyngeal carcinoma by targeting PTEN.

Authors:  Wei Wu; Xi Chen; Shilong Yu; Rui Wang; Ruikun Zhao; Chao Du
Journal:  Mol Med Rep       Date:  2017-10-31       Impact factor: 2.952

6.  Antioxidant activities of novel resveratrol analogs in breast cancer.

Authors:  Anwesha Chatterjee; Amruta Ronghe; Subhash B Padhye; David A Spade; Nimee K Bhat; Hari K Bhat
Journal:  J Biochem Mol Toxicol       Date:  2017-09-28       Impact factor: 3.642

7.  The antitumor effect of resveratrol on nasopharyngeal carcinoma cells.

Authors:  Huisheng Xiong; Jun Cheng; Shen Jiang; Jun Wen; Yang Jian; Lu Wei; Zhang Zhe; Jiang Fu-Qiang; Xie Peng
Journal:  Front Biosci (Landmark Ed)       Date:  2019-03-01

8.  LASP1 promotes nasopharyngeal carcinoma progression through negatively regulation of the tumor suppressor PTEN.

Authors:  Qingzu Gao; Lihua Tang; Ling Wu; Kaitao Li; Hui Wang; Weidong Li; Juan Wu; Mingyi Li; Shuang Wang; Liang Zhao
Journal:  Cell Death Dis       Date:  2018-03-12       Impact factor: 8.469

9.  Resveratrol Ameliorates Glucocorticoid-Induced Bone Damage in a Zebrafish Model.

Authors:  Qun Luo; Shengbo Liu; Liming Xie; Yongjie Yu; Limin Zhou; Yuzhen Feng
Journal:  Front Pharmacol       Date:  2019-03-22       Impact factor: 5.810

10.  Resveratrol inhibits invasion and metastasis of colorectal cancer cells via MALAT1 mediated Wnt/β-catenin signal pathway.

Authors:  Qing Ji; Xuan Liu; Xiaoling Fu; Long Zhang; Hua Sui; Lihong Zhou; Jian Sun; Jianfeng Cai; Jianmin Qin; Jianlin Ren; Qi Li
Journal:  PLoS One       Date:  2013-11-11       Impact factor: 3.240

View more
  4 in total

Review 1.  A review on the role of DANCR in the carcinogenesis.

Authors:  Soudeh Ghafouri-Fard; Tayyebeh Khoshbakht; Bashdar Mahmud Hussen; Aria Baniahmad; Mohammad Taheri; Mohammad Samadian
Journal:  Cancer Cell Int       Date:  2022-05-19       Impact factor: 6.429

Review 2.  Mechanistic role of DANCR in the choreography of signaling pathways in different cancers: Spotlight on regulation of Wnt/β-catenin and JAK/STAT pathways by oncogenic long non-coding RNA.

Authors:  Ammad Ahmad Farooqi; Auyezova Ardak Mukhanbetzhanovna; Seher Yilmaz; Lazzat Karasholakova; Ishmuratova Margarita Yulaevna
Journal:  Noncoding RNA Res       Date:  2021-01-13

Review 3.  Engineering neoantigen vaccines to improve cancer personalized immunotherapy.

Authors:  Zaoqu Liu; Jinxiang Lv; Qin Dang; Long Liu; Siyuan Weng; Libo Wang; Zhaokai Zhou; Ying Kong; Huanyun Li; Yilin Han; Xinwei Han
Journal:  Int J Biol Sci       Date:  2022-09-01       Impact factor: 10.750

4.  Overexpression of Notch2 enhances radiosensitivity via inhibition of the AKT/mTOR signaling pathway in nasopharyngeal carcinoma.

Authors:  Li-Zhi Wu; Mao-Ling Huang; Cheng-Lin Qi; Li-Jun Shen; You Zou; Rui Yang; Jian-Fei Sheng; Shi-Ming Chen
Journal:  Bioengineered       Date:  2021-12       Impact factor: 3.269

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.