Steffen Abay-Nørgaard1, Benedetta Attianese1, Laura Boreggio1, Anna Elisabetta Salcini2. 1. BRIC, University of Copenhagen, Biotech Research and Innovation Centre, Ole Maaloes vej 5, 2200, Copenhagen, Denmark. 2. BRIC, University of Copenhagen, Biotech Research and Innovation Centre, Ole Maaloes vej 5, 2200, Copenhagen, Denmark lisa.salcini@bric.ku.dk.
Abstract
Post-translational histone modifications regulate chromatin compaction and gene expression to control many aspects of development. Mutations in genes encoding regulators of H3K4 methylation are causally associated with neurodevelopmental disorders characterized by intellectual disability and deficits in motor functions. However, it remains unclear how H3K4 methylation influences nervous system development and contributes to the aetiology of disease. Here, we show that the catalytic activity of set-2, the Caenorhabditis elegans homologue of the H3K4 methyltransferase KMT2F/G (SETD1A/B) genes, controls embryonic transcription of neuronal genes and is required for establishing proper axon guidance, and for neuronal functions related to locomotion and learning. Moreover, we uncover a striking correlation between components of the H3K4 regulatory machinery mutated in neurodevelopmental disorders and the process of axon guidance in C. elegans Thus, our study supports an epigenetic-based model for the aetiology of neurodevelopmental disorders, based on an aberrant axon guidance process originating from deregulated H3K4 methylation.
Post-translational histone modifications regulate chromatin compaction and gene expression to control many aspects of development. Mutations in genes encoding regulators of H3K4 methylation are causally associated with neurodevelopmental disorders characterized by intellectual disability and deficits in motor functions. However, it remains unclear how H3K4 methylation influences nervous system development and contributes to the aetiology of disease. Here, we show that the catalytic activity of set-2, the Caenorhabditis elegans homologue of the H3K4 methyltransferase KMT2F/G (SETD1A/B) genes, controls embryonic transcription of neuronal genes and is required for establishing proper axon guidance, and for neuronal functions related to locomotion and learning. Moreover, we uncover a striking correlation between components of the H3K4 regulatory machinery mutated in neurodevelopmental disorders and the process of axon guidance in C. elegans Thus, our study supports an epigenetic-based model for the aetiology of neurodevelopmental disorders, based on an aberrant axon guidance process originating from deregulated H3K4 methylation.
The development of the nervous system requires the coordination of several events, including neuronal progenitor self-renewal, cell migration and differentiation along different lineages, directional neurite outgrowth, and synapse formation. During each step, tight transcriptional control of neurodevelopmental genes is crucial, with chromatin factors playing a major regulatory function by controlling chromatin accessibility (Iwase and Martin, 2018). The contribution of chromatin factors to synaptic plasticity, learning and memory testifies to the broad role of epigenetic mechanisms in the formation and functionality of the nervous system (Ma et al., 2010; Guan et al., 2015; Yao et al., 2016; Kim and Kaang, 2017; Gallegos et al., 2018).The relevance of chromatin factors in nervous system development is highlighted when considering neurodevelopmental disorders, which are conditions characterized by intellectual disability in which social/motor and learning skills are variably affected (De Rubeis et al., 2014; LaSalle et al., 2013; Pinto et al., 2014; Ronan et al., 2013; Iwase et al., 2017; Gabriele et al., 2018). Advances in next-generation sequencing have allowed a thorough analysis of individuals affected by neurodevelopmental disorders, generating valuable insights for inferring the molecular basis of these diseases. Strikingly, chromatin regulators have emerged as the second most-associated category, outside of genes directly involved in synaptic function (De Rubeis et al., 2014; LaSalle et al., 2013; Pinto et al., 2014; Ronan et al., 2013; Iwase et al., 2017; Gabriele et al., 2018). In particular, regulators of histone 3 lysine 4 (H3K4) methylation are well represented among mutated chromatin factors (Vallianatos and Iwase, 2015; Shen et al., 2014). The levels of H3K4 methylation are dynamically regulated by the action of lysine methyltransferases (KMTs), the majority of which belong to the KMT2 family (KMT2A-D or MLL1-4, and KMT2F/G or SETD1A/B), and lysine demethylases (KDMs) of the KDM1 and KDM5 families (Pedersen and Helin, 2010). KMT2 members are the catalytic subunits of COMPASS-like complexes (complex of proteins associated with Set-1) that include WDR5, RBBP5, ASH2L and DPY30 as core components, and are required for optimal catalytic activity of each complex (Qu et al., 2018; Li et al., 2016).Mutations in KMT2 members have been identified in cases of Wiedemann–Steine syndrome (Sun et al., 2017; Jones et al., 2012), Kleefstra syndrome (Kleefstra et al., 2012) and Kabuki syndrome (Ng et al., 2010), and are associated with schizophrenia, autism and neurodevelopmental disorders (O'Donnell-Luria et al., 2019; Takata et al., 2016, 2014; Singh et al., 2016). KDM1 and KDM5 members have been found to be mutated in autism spectrum disorders (De Rubeis et al., 2014; Adegbola et al., 2008; Iossifov et al., 2014), X-linked mental retardation (Gonçalves et al., 2014; Abidi et al., 2008; Iwase et al., 2007), non-syndromic intellectual disability (Tunovic et al., 2014; Athanasakis et al., 2014) and Kabuki syndrome (Pilotto et al., 2016; Rauch et al., 2012). Finally, PHF8, a H3K4me3 binder (Tsukada et al., 2010; Kleine-Kohlbrecher et al., 2010; Qi et al., 2010), is altered in cases of X-linked retardation (Redin et al., 2014; Koivisto et al., 2007; Abidi et al., 2007; Laumonnier, 2005; Siderius et al., 1999). Taken together, these results strongly suggest that tight control of H3K4 methylation is crucial for brain development and functionality, and that its deregulation is implicated in the pathogenesis of neurodevelopmental disorders. However, the roles of the H3K4 regulatory machinery in key aspects of neuronal development remain poorly characterized. In particular, how H3K4 methylation impacts axon guidance, a process required to direct the axons to their targets and establish functional neuronal circuits, is unknown. Investigation of this process is limited by the complexity of the mammalian nervous system and by the inadequacy of in vitro systems to reproduce physiological conditions. Thus, in vivo studies in tractable model organisms could help to dissect the role of histone methylation in this highly conserved biological process (McCammon and Sive, 2015).Caenorhabditis elegans, in which the H3K4 methylation machinery is well conserved, is an amenable model system for studying neurodevelopmental mechanisms. Factors such as a well-defined neuronal connectome and a simple body plan make this organism ideal for unveiling the roles of chromatin factors, and to assess the functional relevance of genetic variations observed in neurodevelopment diseases (Nørgaard et al., 2018; Pedersen et al., 2013; Zallen et al., 1998; Boulin et al., 2006; Adler et al., 2006; Pocock and Hobert, 2008; Johnston and Hobert, 2003). In C. elegans, the process of axon guidance can be studied by following the trajectory of PVQ axons (PVQs), which run along the entire animal body in a stereotyped manner. Owing to this invariant pattern of development, the PVQs have been used to identify genes and pathways implicated in axon guidance (Chisholm et al., 2016; Mariani et al., 2016; Riveiro et al., 2017). In this study, we directly tested the role of H3K4 methylation in regulating axon guidance by analysing mutant animals lacking the majority of known H3K4 regulators. The results show that H3K4 methylation regulation is strictly required for the establishment of axon trajectories, and that the deposition of methylation on H3K4 is crucial for neuronal functions related to locomotion and learning.
RESULTS
Multiple regulators of H3K4 methylation are required for axon guidance
The PVQs are a pair of interneurons located at the posterior region of the animal, with axons projecting anteriorly during mid-embryogenesis along the ventral nerve cord in two distinct and parallel bundles, which are separated by the ventral midline (Fig. 1A). To test the hypothesis that the regulation of H3K4 methylation is relevant in the establishment of proper axon guidance, transgenic animals expressing a GFP reporter in PVQ neuronal cell bodies and axons were crossed with deletion mutants of components of the H3K4 regulatory machinery. Based on H3K4-related functions (Table 1), we included in our analysis alleles for set-2, set-16, set-17 and set-30, which were previously reported to act as H3K4 methyltransferases (Fisher et al., 2010; Greer et al., 2014, 2010). We also tested mutant alleles for an H3K4 demethylase, spr-5 (Nottke et al., 2011), and for genes encoding components of the COMPASS-like complexes (Beurton et al., 2019; Li and Kelly, 2011; Vandamme et al., 2012), such as wdr-5.1, rbbp-5 and ash-2. Mutants for the H3K4 demethylase rbr-2 and for the H3K4 binder jmjd-1.2 were used as positive controls for phenotypic changes (Mariani et al., 2016; Riveiro et al., 2017). Deletion mutants for set-2, set-16, spr-5, wdr-5.1, ash-2 and rbbp-5 displayed defects in PVQ axon guidance (Fig. 1B), resulting in aberrant midline crossover of the axons often occurring in the posterior part of the body (Fig. 1A). The axonal defects observed in all mutants were noticeably similar in terms of pattern and penetrance. In contrast, we found that deletions of set-17 and set-30 did not compromise the PVQ patterning (Fig. 1B). Interestingly, although human homologues of set-2 (KMT2F/G), set-16 (KMT2A-D), spr-5 (KDM1A), rbr-2 (KDM5A-D), jmjd-1.2 (PHF8), ash-2 (ASH2L), wdr-5.1 (WDR5) and rbbp-5 (RBBP5) are mutated in neurodevelopmental diseases (Table 1), no alterations have been reported for the homologues of set-17 and set-30 (corresponding to PRDM7/9 and KMT3C, respectively), which were previously reported to methylate H3K4 and H3K36 (Hayashi et al., 2005; Eram et al., 2014; Blazer et al., 2016; Brown et al., 2006; Abu-Farha et al., 2008). Thus, our analysis reveals that the majority of H3K4 methylation regulators in C. elegans contribute to the establishment of correct axon guidance, indicating that the regulation of H3K4 methylation is crucial in this process. More importantly, these results highlight a striking and previously unknown correlation between genes regulating H3K4 methylation mutated in neurodevelopmental diseases and genes involved in axon guidance in C. elegans.
Fig. 1.
Loss of H3K4me regulators causes axon guidance defects. (A) Top: schematic of PVQ neurons in wild type at L4 stage. Bottom: representative image of the posterior section of wild-type and set-2(tm1630) L4 worms expressing GFP in PVQ neurons (transgene oyIs14). White arrowheads indicate the most common defect observed in mutant animals, in which the left PVQ neuron defasciculates and erroneously migrates to the contralateral side of the ventral nerve cord and back again. (B) Quantification of PVQ defects at L4 stage in wild type and in mutants of genes involved in H3K4me regulation. Mutants for rbr-2, a H3K4 demethylase, and jmjd-1.2, a H3K4me3 binder, previously reported to exhibit axon guidance defects (Mariani et al., 2016; Riveiro et al., 2017), were used as positive controls. All the alleles used carry large deletions and are most likely null mutants. The set-16(n4526) mutant was scored at L1 stage due to larval lethality. n>150 for all strains, except for set-16(n4526), n=56. Statistical significance testing used one-way ANOVA (Tukey's multiple comparison test). **P<0.005, ***P<0.0005, ****P<0.0001, n.s., not significant compared with wild type. Black dots represent independent scorings. Data are mean±s.e.m. Scale bar: 50 µm.
Table 1.
Loss of H3K4me regulators causes axon guidance defects. (A) Top: schematic of PVQ neurons in wild type at L4 stage. Bottom: representative image of the posterior section of wild-type and set-2(tm1630) L4 worms expressing GFP in PVQ neurons (transgene oyIs14). White arrowheads indicate the most common defect observed in mutant animals, in which the left PVQ neuron defasciculates and erroneously migrates to the contralateral side of the ventral nerve cord and back again. (B) Quantification of PVQ defects at L4 stage in wild type and in mutants of genes involved in H3K4me regulation. Mutants for rbr-2, a H3K4 demethylase, and jmjd-1.2, a H3K4me3 binder, previously reported to exhibit axon guidance defects (Mariani et al., 2016; Riveiro et al., 2017), were used as positive controls. All the alleles used carry large deletions and are most likely null mutants. The set-16(n4526) mutant was scored at L1 stage due to larval lethality. n>150 for all strains, except for set-16(n4526), n=56. Statistical significance testing used one-way ANOVA (Tukey's multiple comparison test). **P<0.005, ***P<0.0005, ****P<0.0001, n.s., not significant compared with wild type. Black dots represent independent scorings. Data are mean±s.e.m. Scale bar: 50 µm.
SET-2 controls axon guidance of a subset of neurons
To gain insight into the molecular mechanisms underlying the axonal defects observed in H3K4 regulator mutants, we characterized the role of set-2 in detail. set-2 is homologous to KMT2F/G (also called SETD1a/b), which has essential roles during early mouse embryogenesis (Bledau et al., 2014). In humans, a role for KMT2F/G mutations in neurodevelopmental disorders has been recently suggested by the identification of variants in KMT2F and KMT2G in individuals with intellectual disability, autism, epilepsy and schizophrenia (O'Donnell-Luria et al., 2019; Singh et al., 2016; Hiraide et al., 2018). SET-2 is considered the major methyltransferase for H3K4 in C. elegans (Xiao et al., 2011), but its role in neuronal development has not been investigated. The set-2(tm1630) and set-2(n4589) alleles carry large deletions at the 5′ end of the gene, including the start codon (Fig. 2A), and show similar defective axon guidance phenotypes (Fig. 2B). Furthermore, transgenic expression of a fosmid containing the set-2 gene in the set-2(tm1630) allele rescued the axon guidance phenotype (Fig. 2B). These results strongly suggest that the axonal defect observed is linked to aberrations of set-2.
Fig. 2.
SET-2 is required in the nervous system to ensure proper PVQ axon guidance. (A) Schematic of the set-2 gene. RRM, RNA recognition motif; SET, methyltransferase domain. Deletions and point mutations (indicated by an asterisk) used in this study are shown. (B) Quantification of PVQ defects at L4 stage in wild type and set-2 deletion alleles, and in set-2(tm1630) animals ectopically expressing a genomic region that includes the set-2 gene (fosmid WRM0638aG05). (C) Quantification of PVQ defects at L4 stage in wild type and set-2(tm1630) mutants expressing set-2 cDNA in different tissues. Promoters used to drive set-2 expression were as follows: neuronal, rgef-1; hypodermal, dpy-7; and PVQ, sra-6. n>150. Statistical significance testing used one-way ANOVA (Tukey's multiple comparison test). *P<0.05; **P<0.005; ***P<0.0005; ****P<0.0001; n.s., not significant. In C, comparisons are with set-2. Black dots represent independent scorings. Data are mean±s.e.m.
SET-2 is required in the nervous system to ensure proper PVQ axon guidance. (A) Schematic of the set-2 gene. RRM, RNA recognition motif; SET, methyltransferase domain. Deletions and point mutations (indicated by an asterisk) used in this study are shown. (B) Quantification of PVQ defects at L4 stage in wild type and set-2 deletion alleles, and in set-2(tm1630) animals ectopically expressing a genomic region that includes the set-2 gene (fosmid WRM0638aG05). (C) Quantification of PVQ defects at L4 stage in wild type and set-2(tm1630) mutants expressing set-2 cDNA in different tissues. Promoters used to drive set-2 expression were as follows: neuronal, rgef-1; hypodermal, dpy-7; and PVQ, sra-6. n>150. Statistical significance testing used one-way ANOVA (Tukey's multiple comparison test). *P<0.05; **P<0.005; ***P<0.0005; ****P<0.0001; n.s., not significant. In C, comparisons are with set-2. Black dots represent independent scorings. Data are mean±s.e.m.We investigated the focus of action of set-2 by testing the ability of set-2 expression in different tissues to rescue the defects observed in set-2(tm1630) mutants. Our results showed that SET-2 acts specifically in the nervous system to control PVQ development (Fig. 2C, Fig. S1). However, re-expression of set-2 in PVQ neurons was not sufficient to rescue the phenotype (Fig. 2B). This result is consistent with a non-cell-autonomous function of set-2; however, it should be noted that several technical issues (inappropriate time and/or level of expression) might also account for this negative outcome. To determine whether SET-2 is required in embryos to establish correct axon guidance, or during larval development to maintain PVQ axonal position, we analysed the defect of PVQ axons in freshly hatched larvae. The percentage of axon defects identified in L1 was similar to the one observed in mutant adult animals (16%±2) (Fig. S2), suggesting that SET-2 is required during embryogenesis to ensure proper PVQ axon guidance. In agreement with this, transgenic animals carrying an mCherry-tagged transcriptional reporter showed set-2 expression in the early embryo (Fig. S3). Loss of set-2 also impacted the projection of HSN neurons, which extend during larval development, and the axon trajectory of VD and DD neurons in the dorsal nerve cord (Table 2). In contrast, other neurons, such as the mechanosensory neurons (AVM, ALM, PVM and PLM) and the AVK interneuron, displayed normal axon guidance pattern in set-2 mutant animals (Table 2). Notably, abrogation of set-2 did not impact the migration of AVM, PVM and HSN neurons (Table 2). These results indicate that SET-2 regulates the projection of several neurons but is not required to organize the overall architecture of the C. elegans nervous system.
Table 2.
Neuroanatomical analysis of
Neuroanatomical analysis of
The catalytic activity of SET-2 is required to control axon guidance
SET-2 mainly catalyzes the tri-methylation of H3K4 (Li and Kelly, 2011; Xiao et al., 2011). In agreement with this, we observed strongly reduced levels of H3K4me3 in the set-2(tm1630) mutant embryos, indicating that SET-2 is the main enzyme catalyzing H3K4me3 in embryos (Fig. 3A, Fig. S4). Several point mutations in the SET domain have been shown to perturb the activity of the protein without compromising its stability (Rickels et al., 2017; Dorighi et al., 2017). To directly assess the relevance of the enzymatic activity of SET-2, and therefore of H3K4me3, in the context of axonal guidance, we introduced mutations in the set-2 gene giving rise to two mutated alleles set-2(zr1504) and set-2(zr2012), in which conserved amino acids located in the SET domain were mutated (H1447K and R1426W, respectively, Fig. 3A). In the set-2(zr2012) allele, we introduced a mutation leading to the same amino acid substitution found in SETD1B/KMT2G in a case of intellectual disability linked to epilepsy and autism (Hiraide et al., 2018). Therefore, the set-2(zr2012) allele provided a simple model with which to test the effects of a disease-associated mutation of set-2 in an in vivo context. In both mutant animals, we observed a strong reduction of H3K4me3 levels, similar to the one detected in the set-2(tm1630) deletion allele, both by western blot and immunofluorescence in embryos (Fig. 3A, Fig. S4). Importantly, these mutant alleles showed axonal defects with similar penetrance to the set-2(tm1630) deletion mutant (Fig. 3B). Therefore, our result, together with the evidence (Fig. S5) that no axon abnormalities are observed in the set-2(ok952) allele, an in-frame deletion in which the levels of H3K4me3 in embryos were not affected (Xiao et al., 2011), suggests the catalytic activity of SET-2 is crucial for proper axon guidance.
Fig. 3.
The catalytic activity of SET-2 is paramount for correct axon guidance. (A) Top: alignment of a region of the SET domain of SET-2 with homologues in different species. The grey shading denotes conserved amino acids. The red residues denote the conserved amino acids substituted in set-2 alleles zr2012 and zr1504. Corresponding amino acid substitutions in human are shown. In the zr2012 allele, Arg1426 is changed to Trp, thus reproducing a disease-associated mutation (R1842W). Bottom: representative western blot showing embryonic H3K4me3 levels in the indicated strains. H3 was used as loading control. The numbers indicate the average of H3K4me3 relative to wild type, from three independent experiments ±s.e.m. (B) Quantification of PVQ defects at L4 stage in wild type and indicated set-2 mutant alleles. Statistical significance testing used one-way ANOVA (Tukey's multiple comparison test). n>150, ****P<0.0001 compared with wild type. Black dots represent independent scorings. Data are mean±s.e.m.
The catalytic activity of SET-2 is paramount for correct axon guidance. (A) Top: alignment of a region of the SET domain of SET-2 with homologues in different species. The grey shading denotes conserved amino acids. The red residues denote the conserved amino acids substituted in set-2 alleles zr2012 and zr1504. Corresponding amino acid substitutions in human are shown. In the zr2012 allele, Arg1426 is changed to Trp, thus reproducing a disease-associated mutation (R1842W). Bottom: representative western blot showing embryonic H3K4me3 levels in the indicated strains. H3 was used as loading control. The numbers indicate the average of H3K4me3 relative to wild type, from three independent experiments ±s.e.m. (B) Quantification of PVQ defects at L4 stage in wild type and indicated set-2 mutant alleles. Statistical significance testing used one-way ANOVA (Tukey's multiple comparison test). n>150, ****P<0.0001 compared with wild type. Black dots represent independent scorings. Data are mean±s.e.m.
SET-2 genetic interactions with pathways regulating axon guidance
Multiple conserved redundant pathways control axon guidance. The role of several signalling pathways like Netrin, Slit, Ephrins and Semaphorin in this context is well characterised in C. elegans. Similarly, the relevance of transmembrane proteins such as Syndecan and other proteoglycans is well established (Chisholm et al., 2016). Genetic interaction assays have been used to determine the components of these pathways and to establish functional relationships among the genes involved (Zallen et al., 1998; Bülow et al., 2008). In order to assess whether set-2 acts within known pathways, we generated animals carrying the set-2(tm1630) allele together with mutations of genes belonging to the major axon guidance pathways, and analysed the trajectories of the PVQ neurons. Concomitant abrogation of set-2 and components of the Ephrin (vab-1) or Semaphorin (plx-2) pathways resulted in a phenotype that had a penetrance similar to the one observed in the single mutants (Table 3). Analogous results were obtained in sdn-1;set-2. On the contrary, when the Netrin (unc-5) and sax-3/ROBO pathways (sax-3) were ablated in the set-2 genetic background, we observed an exacerbation of the phenotype (Table 3). Therefore, set-2 appears to act in parallel with the Netrin and SAX-3/ROBO pathways, and in concert with Ephrins and Semaphorin, the main antero-posterior signalling pathways involved in axon guidance.
Table 3.
Genetic interaction of
Genetic interaction ofA similar experimental approach was performed to analyse the crosstalk among the H3K4 methylation regulators we found involved in axon guidance. To investigate the relationship of set-2 with rbr-2, spr-5 and jmjd-1.2, we analysed the PVQ defects of animals lacking a combination of these genes. None of the double mutants showed an additive effect (Fig. 4A), suggesting that the regulators act jointly to ensure the correct levels of H3K4 methylation and normal axon guidance. However, the abrogation of rbr-2 in the set-2(tm1630) background led to an amelioration of the axon phenotype, suggesting that rbr-2, likely through its H3K4 demethylase activity, can counteract the effect of set-2 in axon guidance. A similar neutralizing effect of rbr-2 mutations has been observed previously for the lifespan phenotype of set-2 (Greer et al., 2010). Finally, we analysed the penetrance of the defects in compound mutants of set-2 with rbbp-5 or ash-2, components of the COMPASS complexes. Double mutants showed levels of defects similar to those observed in single mutants (Fig. 4B), suggesting that set-2 controls the axon guidance process in the context of the COMPASS complex.
Fig. 4.
(A) Quantification of PVQ defects at L4 stage in wild type, and in single and compound mutants of H3K4 regulators. (B) Quantification of PVQ defects at L4 stage in wild type, and in single and compound mutants of COMPASS complex members. (C) Quantification of PVQ defects at L4 stage in wild type and single and compound mutants of actin modulators. n>150 for all strains [except for cdc-42(gk388); set-2(tm1630), n=63]. Statistical significance testing used one-way ANOVA (Tukey's multiple comparison test). ***P<0.0005, ****P<0.0001 n.s., not significant compared with single mutants with the highest penetrance. Black dots represent independent scorings. Data are mean±s.e.m.
(A) Quantification of PVQ defects at L4 stage in wild type, and in single and compound mutants of H3K4 regulators. (B) Quantification of PVQ defects at L4 stage in wild type, and in single and compound mutants of COMPASS complex members. (C) Quantification of PVQ defects at L4 stage in wild type and single and compound mutants of actin modulators. n>150 for all strains [except for cdc-42(gk388); set-2(tm1630), n=63]. Statistical significance testing used one-way ANOVA (Tukey's multiple comparison test). ***P<0.0005, ****P<0.0001 n.s., not significant compared with single mutants with the highest penetrance. Black dots represent independent scorings. Data are mean±s.e.m.
set-2 controls axon guidance by regulating actin remodelling through wsp-1
Actin remodelling at the growth cone is ultimately the key process directing axon guidance. We therefore tested whether the defect observed in set-2 mutant animals could be related to aberrant regulation of actin dynamics. We generated double mutants eliminating set-2 in concomitance with wsp-1/WASP, wve-1/WAVE and unc-34/Ena/VASP, which are known actin-regulator genes (Higgs and Pollard, 2001). Although we observed no effect with unc-34 or wve-1, ablation of wsp-1 fully rescued the set-2 axon guidance phenotype (Fig. 4C). This result suggests that set-2 controls axon guidance by regulating actin remodelling specifically through wsp-1. We also tested the effect of cdc-42 and nck-1 ablation, the mammalian homologues of which are known activators of N-WASP (Alekhina et al., 2017). As only loss of cdc-42 rescued the set-2 phenotype (Fig. 4C), we conclude that an aberrant CDC-42-dependent activation of WSP-1 is likely fundamental to the axonal defect observed in set-2 mutant animals.
Transcriptional regulation mediated by SET-2
H3K4me3 is a post-translational modification identified at promoter regions of transcriptionally active genes and, in agreement with this, loss of set-2 has been reported to deregulate transcriptional activity (Beurton et al., 2019; Robert et al., 2014). To gain insight into the mechanisms of action of SET-2 in axon guidance, we analysed the transcriptome of set-2(tm1630) mutants at the mid-embryonic stage in which PVQ axon development occurs. Principal component analysis (PCA) of RNA-sequencing datasets from wild-type and set-2(tm1630) animals indicated that the gene expression patterns in set-2 mutant embryos were significantly different from wild-type embryos (Fig. 5A), with 6444 genes (FDR<0.05) differentially expressed (DE) (Fig. 5B, Table S1). A similar number of genes were downregulated and upregulated in comparison with wild-type animals (Table S1). The median log2 fold changes of gene expression were 2.27±0.018 (mean±s.e.m.) for upregulated genes and 1.78±0.01 (mean±s.e.m.) for downregulated genes. Strikingly, among the downregulated genes, gene ontology (GO) analysis identified genes associated with neuronal function categories, including neuronal development, locomotion, chemotaxis, neuronal cell projection, axon guidance and synaptic transmission (Fig. 5C,Table S1). And, with the exception of sax-3, all the other genes involved in axon guidance pathways tested for genetic interactions are listed as downregulated genes in the RNA-sequencing dataset. Among the upregulated genes, categories related to germ cell biology and DNA replication/repair were significantly enriched (Fig. 5D), corroborating previous studies that implicated set-2 in fertility and genome stability (Xiao et al., 2011; Herbette et al., 2017). We also analysed the transcriptome of the set-2(zr2012) allele that expresses a mutant SET-2 protein with an amino acid substitution found in SETD1B in a case of intellectual disability (Hiraide et al., 2018). Despite a smaller number of DE genes identified in animals carrying this allele (3053 DE genes, FDR<0.05) (Table S1, Fig. S6), the intersection of DE genes and consistently downregulated genes in the two set-2 alleles was significant (P<0.001 and P<0.0001, respectively). Importantly, GO analysis of downregulated genes in set-2(zr2012) and consistently downregulated genes in set-2(tm1630) and set-2(zr2012) identified neuronal categories as enriched, confirming the relevance of set-2 in positively regulating the transcription of neuronal genes (Fig. S6, Table S1). These results suggest that, in agreement with its catalytic activity, SET-2 contributes substantially to the regulation of gene expression in embryos. Furthermore, the identification of several downregulated genes belonging to the cell projection/axon guidance class corroborates our finding that the regulation of H3K4 methylation is required for the establishment of proper axon trajectory.
Fig. 5.
Transcriptional regulation mediated by SET-2. (A) PCA plot of wild-type and set-2(tm1630) mid-embryos. Each dot represents one sample and each colour a genotype. (B) MA plot showing gene expression changes in set-2(tm1630). The x-axis represents the mean of counts, the y-axis represents log2 fold change. DE genes with FDR<0.05 are shown in red. (C,D) GO analysis of the biological processes of downregulated (C) and upregulated (D) genes in the set-2(tm1630) allele using g:Profiler and adjusted P-values (Bonferroni correction). Selected top scoring categories are presented together with the number of genes identified in each category.
Transcriptional regulation mediated by SET-2. (A) PCA plot of wild-type and set-2(tm1630) mid-embryos. Each dot represents one sample and each colour a genotype. (B) MA plot showing gene expression changes in set-2(tm1630). The x-axis represents the mean of counts, the y-axis represents log2 fold change. DE genes with FDR<0.05 are shown in red. (C,D) GO analysis of the biological processes of downregulated (C) and upregulated (D) genes in the set-2(tm1630) allele using g:Profiler and adjusted P-values (Bonferroni correction). Selected top scoring categories are presented together with the number of genes identified in each category.
Loss of set-2 impairs nervous system functionality
Besides the genes required for the establishment of proper axon guidance, the transcriptome analysis of set-2 mutant alleles revealed that numerous neuronal genes were differentially expressed, suggesting a broad role for set-2 in the nervous system. Therefore, we tested whether the loss of set-2 would result in abnormal neuronal functionality. Despite set-2(tm1630) and set-2(zr2012) mutant animals appearing superficially wild type, we detected differences when compared with control animals in specific functional tests. Locomotion in C. elegans is controlled by excitatory cholinergic and inhibitory GABAergic motor neurons, the functionality of which can be determined by observing animals swimming in liquid. set-2(tm1630) and set-2(zr2012) mutant animals displayed a reduced rate of body bends in liquid compared with wild-type animals (Fig. 6A). Furthermore, when left moving on a plate for 1 h at 20°C, set-2(tm1630) and set-2(zr2012) mutants appeared to explore fewer regions of the plate (Fig. 6B) and to move in a tighter circular pattern compared with control animals (Fig. S7). A closer analysis of the crawling tracks revealed differences in wave amplitude between control animals and mutants, but no significant differences were observed when comparing wave lengths (Fig. 6C). Overall, these results suggest abnormal locomotion behaviour in set-2(tm1630) and set-2(zr2012) mutant animals. Defecation in C. elegans is the result of a stereotyped and tightly regulated motor programme involving the subsequent contraction of three distinct sets of enteric muscles (Schuske et al., 2004). Monitoring this relatively simple process is a powerful method for determining neuronal system functionality and synaptic transmission. We found that the rate of defecation in both set-2 mutants was significantly reduced compared with wild-type animals (Fig. 6D). Last, we assessed chemotaxis responses towards attractive stimuli (Mori, 1999) by testing the response of set-2 mutant animals to sodium chloride. No differences were observed in the set-2(tm1630) and set-2(zr2012) mutant animals compared with control animals, suggesting that set-2 mutants have an intact chemotactic response (Fig. 6E). In C. elegans, the chemotactic response changes according to previous experiences (Tomioka et al., 2006; Saeki et al., 2001). When animals are grown in the presence of food and sodium chloride, they are attracted to the salt. In contrast, when worms are starved in the presence of salt, they learn to avoid it as they associate the salt with an unfavourable condition. We tested whether this associative learning process was affected in set-2(tm1630) and set-2(zr2012) mutant animals by conditioning animals in unseeded plates containing sodium chloride and subsequently testing their reaction to the salt. In contrast to wild-type animals, conditioned set-2 mutants were still attracted to sodium chloride, suggesting a defect in the associative learning process (Fig. 6E). Overall, these results indicate that mutations in the set-2 gene, in correlation with aberrant expression of neuronal genes, result in compromised neuronal functions.
Fig. 6.
Loss of SET-2 impairs
nervous system functionality. (A) Quantification of body bends in liquid in wild type, set-2(tm1630) and set-2(zr2012). n>60, Student's t-test. (B) Quantification of exploratory behaviour in wild type, set-2(tm1630) and set-2(zr2012). n>30, Student's t-test. (C) Left and middle: quantification of wavelength and amplitude of tracks left on a bacterial lawn by wild type, set-2(tm1630) and set-2(zr2012). n>30, Student's t-test. Right: representative images of crawling tracks in wild-type, set-2(tm1630) and set-2(zr2012) mutant animals. (D) Quantification of DMP length in wild type, set-2(tm1630) and set-2(zr2012). n>30, Student's t-test. (E) Quantification of the chemotactic response to NaCl and plasticity in set-2(tm1630) and set-2(zr2012). Worms were washed and placed directly onto assay plates (naive) or onto conditioning plates for 1 h before being tested (conditioned). Chemotactic indices of mutant strains in the conditioned state were compared with wild type in the same conditions. The comparison of chemotactic indices of wild type in naive and conditioned states is marked with a line. n>200, Statistical significance testing used one-way ANOVA (Tukey's multiple comparison test). ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05, n.s., not significant compared with wild type. In A-D, black dots represent single animals. In E, black dots represent independent replicates. Error bars indicate s.e.m.
Loss of SET-2 impairs
nervous system functionality. (A) Quantification of body bends in liquid in wild type, set-2(tm1630) and set-2(zr2012). n>60, Student's t-test. (B) Quantification of exploratory behaviour in wild type, set-2(tm1630) and set-2(zr2012). n>30, Student's t-test. (C) Left and middle: quantification of wavelength and amplitude of tracks left on a bacterial lawn by wild type, set-2(tm1630) and set-2(zr2012). n>30, Student's t-test. Right: representative images of crawling tracks in wild-type, set-2(tm1630) and set-2(zr2012) mutant animals. (D) Quantification of DMP length in wild type, set-2(tm1630) and set-2(zr2012). n>30, Student's t-test. (E) Quantification of the chemotactic response to NaCl and plasticity in set-2(tm1630) and set-2(zr2012). Worms were washed and placed directly onto assay plates (naive) or onto conditioning plates for 1 h before being tested (conditioned). Chemotactic indices of mutant strains in the conditioned state were compared with wild type in the same conditions. The comparison of chemotactic indices of wild type in naive and conditioned states is marked with a line. n>200, Statistical significance testing used one-way ANOVA (Tukey's multiple comparison test). ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05, n.s., not significant compared with wild type. In A-D, black dots represent single animals. In E, black dots represent independent replicates. Error bars indicate s.e.m.
DISCUSSION
Despite the recognition of H3K4 methylation as a crucial epigenetic modification in neuronal development, its biological role in this tissue is only marginally understood (Mariani et al., 2016; Riveiro et al., 2017). In this study, we specifically addressed the role of the main H3K4 methyltransferase SET-2 in neuronal development using C. elegans as a model system. Our results demonstrate the requirement of the catalytic activity of SET-2, and therefore for H3K4 methylation, in the process of axon guidance. Moreover, we showed that several proteins involved in the regulation of H3K4 methylation are also required for the establishment of axon trajectories, including set-16, another H3K4 methyltrasferase. We do not know whether set-2 and set-16 have a redundant role in axon guidance and share common targets. Nevertheless, the requirement of multiple H3K4 regulators likely reflects the notion that axon guidance is a complex process regulated by a multitude of extracellular cues and signalling pathways that need to be integrated, and temporally and spatially coordinated. We propose that such orchestration is, at least in part, epigenetically controlled and occurs by fine-tuning the transcription of the implicated genes through H3K4 methylation regulation.Our analysis showed that the catalytic activity of SET-2 is required for the correct axon guidance through a mechanism that involves the regulation of cytoskeleton dynamics. Remarkably, the axon guidance defects observed in the H3K4 methylation regulators investigated in detail so far (rbr-2, jmjd-1.2 and set-2) are all suppressed by wsp-1 ablation (this study and Mariani et al., 2016; Riveiro et al., 2017), suggesting that, in line with the genetic interaction observed among set-2, rbr-2 and jmjd-1.2, wsp-1 is a shared target (Fig. 7). Our results, showing that only wsp-1, and not other known actin regulators like unc-34 or wve-1, suppresses the axonal defects, suggests that the H3K4 regulatory machinery controls a specific branch of actin remodelling. It should also be noted that the modalities by which H3K4 regulators control WSP-1 functionality are likely different, as rbr-2 controls wsp-1 expression (Mariani et al., 2016), whereas jmjd-1.2 appears to regulate its activation through nck-1 and cdc-42 (Riveiro et al., 2017). The effect of set-2 on wsp-1 activation seems to strictly depend on cdc-42, as ablation of cdc-42, but not nck-1, ameliorates the axonal phenotype. Puzzlingly, in set-2(tm1630), the levels of wsp-1 expression appeared reduced (Table S1). As loss of wsp-1 did not result in axon defects, the wsp-1 downregulation observed is likely due to a compensatory mechanism that reduces the effects of its aberrant activation. The identification of direct targets of SET-2 will help to clarify the specific mechanism underlying the genetic interactions observed.
Fig. 7.
Schematic model depicting the role of rbr-2, set-2 and jmjd-1.2 in regulating wsp-1-mediated actin remodelling and axon guidance. rbr-2 directly influences wsp-1 transcription (Mariani et al., 2016), whereas set-2 and jmjd-1.2 control wsp-1 activity through cdc-42 and nck-1 (this study and Riveiro et al., 2017). The action of set-16, COMPASS complex components and spr-5 on wsp-1 remain to be elucidated. Mammal homologues found mutated in neurodevelopmental diseases are shown in red.
Schematic model depicting the role of rbr-2, set-2 and jmjd-1.2 in regulating wsp-1-mediated actin remodelling and axon guidance. rbr-2 directly influences wsp-1 transcription (Mariani et al., 2016), whereas set-2 and jmjd-1.2 control wsp-1 activity through cdc-42 and nck-1 (this study and Riveiro et al., 2017). The action of set-16, COMPASS complex components and spr-5 on wsp-1 remain to be elucidated. Mammal homologues found mutated in neurodevelopmental diseases are shown in red.It is intriguing that only a subset of neurons is invariantly disturbed by the loss of H3K4 regulator genes (this study and Mariani et al., 2016; Riveiro et al., 2017), suggesting that in these neurons the process of axon guidance is particularly vulnerable and under epigenetic control. This possibility is also suggested by a study showing that defects in axon guidance of the same subset of neurons are observed in animals experiencing oxygen deprivation during embryonic development (Pocock and Hobert, 2008). Further analyses testing other adverse environmental conditions, and cell-specific studies related to expression patterns and lineage, will help us to understand the origin of this susceptibility.set-2 mutant alleles show phenotypes related to locomotion and learning. It is likely that these phenotypes might only partially depend on axon-guidance defects. Indeed, transcriptional profiles and GO analyses of set-2 alleles identified several neuronal categories among DE genes, which suggest a novel and broad role for set-2 in the C. elegans nervous system. The role of set-2 mammalian homologues in neurons has not been investigated owing to the essential nature of these genes during mouse embryogenesis. However, considering our results and the frequency of mutations in these genes in cases of intellectual disability, autism, epilepsy and schizophrenia (O'Donnell-Luria et al., 2019; Singh et al., 2016; Hiraide et al., 2018), it is tempting to hypothesise an evolutionarily conserved role for KMT2F and KMT2G in nervous system development, which deserves further investigation.In the context of disease, the recent identification by genome-wide association studies of a H3K4 regulation domain affected in neuronal disorders has emphasised the potential impact of epigenetic regulation in the developing nervous system and in illness. By demonstrating that C. elegans homologues of H3K4 regulators mutated in disease are all required for proper axon guidance (Fig. 7), and that a disease-associated mutation of SETD1B reproduces the axonal phenotype in the nematode, our studies provide evidence for a common denominator among these genes. Altogether, our results suggest that aberrant axon guidance is a shared trait in neurodevelopmental diseases and offer experimental support to a recently suggested hypothesis proposing that dysregulated axonal guidance underlines neurological disorders (Van Battum et al., 2015; Niftullayev and Lamarche-Vane, 2019; McFadden and Minshew, 2013).
MATERIALS AND METHODS
Genetics and strains
C. elegans strains were cultured using standard growth conditions at 20°C with Escherichia coli OP50 (Brenner, 1974). Double mutant animals were generated by using a standard crossing procedure. set-2(tm1630) was backcrossed six times and set-2(zr2012) was backcrossed two times. Neuronal marker strains were backcrossed three times. The strains used are listed in Table S2. set-16(n4526) is a balanced strain. Heterozygotes segregate Dpy sterile animals (+/+), larval lethal animals (−/−) and wild-type animals (+/−).
Generation of constructs
The set-2 transcriptional reporter includes a ∼400 bp region located at the 5′ end of the set-2 gene amplified using the following primers: 5′-ccgatgcacagtagaaatctg-3′ and 5′-gcaaacttcatatccagaccata-3′. The PCR product was cloned into pD95.75mCherry. Tissue-specific rescue constructs were made using a MultiSite Gateway Three-Fragment Vector Construction Kit (Life Technologies) as described previously (Mariani et al., 2016). The set-2 cDNA was a kind gift from Francesca Palladino (École normale supérieure de Lyon, France).
Generation of transgenic lines
Transgenic lines were created by microinjection (Mello et al., 1991). The set-2 transcriptional reporter line was obtained by injecting 50 ng/µl of reporter construct into the N2 strain. Tissue-specific rescue constructs (10 ng/µl) were injected along with myo-2::mCherry (5 ng/µl) as a co-injection marker into set-2(tm1630). The fosmid (5 ng/µl) was injected along with co-injection marker myo-2::mCherry (5 ng/µl). The fosmid (WRM0638aG05) was a kind gift from Roger Pocock (Monash University, Melbourne, Australia). The transgenic lines used in this study are listed in Table S2.
CRISPR lines
CRISPR lines were created by injecting ssDNA repair templates for set-2 with desired substitutions cloned into pJJR50 (zr1504 sgRNA sequence CCTTCGCGTAGCAATTAGGT and zr2012 sgRNA sequence TCACATGATGCAGATCAATT). The mix contained a pha-1 repair template and pJW1285 (driving the expression of Cas9) was injected into pha-1(e2123) mutants. All constructs were injected at a concentration of 50 ng/µl. Selection for pha-1 wild-type clones was performed at 25°C. Mutations were confirmed by sequencing. The mutation in the zr1504 allele was selected based on the following criteria: (1) conserved from yeast to human; (2) outside of the interaction surface with other components of the mixed lineage leukaemia-complex based on Shinsky et al. (2014); and (3) a conservative substitution (H to K). The mutation in the zr2012 allele reproduces an alteration identified in SETD1B/KMT2G in a case of intellectual disability linked to epilepsy and autism (Hiraide et al., 2018).
Western blot and immunostaining
Protein extracts were prepared from embryos obtained after hypochlorite treatment of animals grown at 20°C. Samples were boiled in SDS-PAGE buffer for 5 min and sonicated for 10 min using a Diagenode Bioruptor (UCD-300). The following antibodies were used: anti-H3K4me3 (Cell Signaling Technology, C42D8; 1:750); polyclonal anti-H3 (Abcam, ab1791; 1:10.000); and peroxidase-labelled anti-rabbit secondary antibody (Vector Laboratories; 1:10.000). Western blots were quantified using ImageJ [National Institutes of Health (NIH)].Embryo staining was performed as described by Chin-Sang et al. (1999). The primary antibody for H3K4me3 (Cell Signaling Technology, C42D8; 1:500) was incubated overnight at 4°C and the secondary antibody [goat anti-rabbit IgG (Alexa Fluor 488, Invitrogen, A11008; 1:500)] was incubated for 2 h at room temperature. Embryos were stained with DAPI and slides were mounted using mounting media.
Axon guidance analyses
The axon guidance phenotype was scored at 20°C at the L4 stage, unless otherwise stated. Worms were immobilized in NaN3 and placed on microscope slides with a 5% agarose pad. Results from at least three biological independent experiments were used for statistical analyses. Images were obtained using a Zeiss AXIO Imager M2 fluorescence microscope. Owing to the larval lethality of the strain, the scoring of the set-16 mutant was conducted at the early larval stage. Arrested larvae were considered set-16 null. Investigators were not blinded during the experiments.
Statistical analyses
Statistical analysis for all neuronal scoring was performed using GraphPad Prism 8 using Student's t-test or one-way ANOVA (Tukey's multiple comparison). All values are presented as mean percentages.
RNA-sequencing
RNA was isolated from three independent experiments per genotype. Hermaphrodites were bleached twice to achieve better synchronization. Eggs recovered from the second hypochlorite treatment of highly synchronized young adult animals were kept at 20°C for 4 h in M9 media to reach mid-embryogenesis (the majority of the eggs were at comma stage) and freeze cracked in liquid nitrogen. Wild-type and set-2 samples were prepared and analysed in parallel, to minimise, as much as possible, synchronisation and batch issues. RNA was extracted using an Arctutus PicoPure RNA Isolation Kit (Thermo Fisher Scientific, KIT0204). Sequencing libraries was constructed using a TruSeq RNA Library Prep Kit v2 (Illumina, RS-122-2001). Libraries were sequenced using a NextSeq 500 system and a NextSeq 500/550 High Output Kit v2 (Illumina, FC-404-2005).
RNA-sequencing analysis
RNA-sequencing results were analysed using Galaxy (v19.05). Reads were mapped to the C. elegans genome (WS220) using a criterion of two mismatches. Number of reads aligned for each replica was between 14.6 to 53.1 million. DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR<0.05 were analysed using g:Profiler (biit.cs.ut.ee/gprofiler/gost) with Bonferroni correction. The P value for overlapping gene lists was calculated using the statistical significance of the overlap between two groups of genes tool (www.nemates.org/MA/progs/overlap_stats.html).
Neuronal function analyses
Thrashing assay in liquid
A 96-well microtitre plate, with each well containing 400 µl of M9 media, was used. Three young adult-stage worms of the same strain were placed in each well and left for 10 min at 20°C to adapt. Body bends were counted for 30 s. One bend was counted every time the mid-body of the animal returned to the same position. The experiment was carried out using at least 60 worms per strain.
Tracking and exploration assay
Nematode Growth Media (NGM) plates (6 cm) were seeded with 600 µl of OP50 grown overnight in lysogeny broth at 37°C and stored at 25°C for one night. One young adult stage worm was placed in the centre of the bacteria lawn and left to crawl for 1 h at 20°C. For the tracking assay, animals were removed after 1 h of crawling and the body length was measured for normalization. The tracks that the animals left on the plates were visualized using a dissecting microscope and a digital camera using the same magnification settings (20×). The amplitude and wavelength of the tracks were measured using ImageJ. For the exploration assay, animals were removed after 1 h of crawling and plates were superimposed on a grid containing 3×3 mm wide squares, and the number of squares entered by the worm were manually counted as described previously (Juozaityte et al., 2017). Both assays were performed using at least 30 worms per strain.
Defecation assay
Defecation was assessed as described previously (Mahoney et al., 2008). Each defecation motor program (DMP) cycle was counted as the interval between two posterior body-wall muscle contractions. Five full cycles for each animal were counted. This assay was carried out using at least 30 worms per strain.
Chemotaxis and chemotaxis plasticity assay
The chemotactic response to NaCl was conducted as described previously (Tomioka et al., 2006). Briefly, 20 ml of buffered agar was poured into 10 cm diameter Petri dishes. To set up a salt gradient, 10 µl of 2.5 M NaCl solution was applied to the attractant spot, and 10 µl of ddH2O was applied to the control spot 16 h before the assay. Another 10 µl of 2.5 M NaCl solution or water was applied 4 h before the assay onto the same spots. NaN3 (1 µl) was applied to both spots 1 min before the assay. Synchronized young adult animals were washed three times with chemotaxis (CTX) solution [5 mM KH2PO4/K2HPO4 (pH 6), 1 mM CaCl2 and 1 mM MgSO4], and 40 to 50 worms were placed in the centre of the assay plate in a minimal volume buffer. Animals were left to crawl for 45 min at 20°C, after which the plates were placed at 4°C overnight and the chemotactic index was calculated. The chemotaxis index was defined as the number of animals in the NaCl area (within 1.5 cm of the solution spot) minus the number of animals in the control area, divided by the total number of animals on the plate. Worms unable to leave the centre of the assay plate were censored. The chemotaxis was assessed with assay plates prepared in the same way as above. Synchronized young adult animals were washed three times with CTX solution, and 40 to 50 worms were placed onto conditioning plates prepared with NGM media (containing NaCl) and without E. coli OP50. Animals were conditioned for 1 h, washed again once with CTX solution and placed in the centre of the assay plates. Worms were left to crawl for 45 min at 20°C, after which the plates were placed at 4°C overnight. The chemotactic index was calculated as before. Several independent biological replicates were analysed. Investigators were not blinded during the experiments.
Authors: Timothy R Mahoney; Shuo Luo; Elaine K Round; Martin Brauner; Alexander Gottschalk; James H Thomas; Michael L Nonet Journal: Proc Natl Acad Sci U S A Date: 2008-10-13 Impact factor: 11.205
Authors: Amanda C Nottke; Sara E Beese-Sims; Luiz F Pantalena; Valerie Reinke; Yang Shi; Monica P Colaiácovo Journal: Proc Natl Acad Sci U S A Date: 2011-07-18 Impact factor: 11.205
Authors: Alba Redo Riveiro; Luca Mariani; Emily Malmberg; Pier Giorgio Amendola; Juhani Peltonen; Garry Wong; Anna Elisabetta Salcini Journal: Development Date: 2017-01-26 Impact factor: 6.868
Authors: Bradley P Coe; Holly A F Stessman; Arvis Sulovari; Madeleine R Geisheker; Trygve E Bakken; Allison M Lake; Joseph D Dougherty; Ed S Lein; Fereydoun Hormozdiari; Raphael A Bernier; Evan E Eichler Journal: Nat Genet Date: 2018-12-17 Impact factor: 38.330
Authors: Kristel M Dorighi; Tomek Swigut; Telmo Henriques; Natarajan V Bhanu; Benjamin S Scruggs; Nataliya Nady; Christopher D Still; Benjamin A Garcia; Karen Adelman; Joanna Wysocka Journal: Mol Cell Date: 2017-05-05 Impact factor: 17.970
Authors: Hank H Qi; Madathia Sarkissian; Gang-Qing Hu; Zhibin Wang; Arindam Bhattacharjee; D Benjamin Gordon; Michelle Gonzales; Fei Lan; Pat P Ongusaha; Maite Huarte; Nasser K Yaghi; Huijun Lim; Benjamin A Garcia; Leonardo Brizuela; Keji Zhao; Thomas M Roberts; Yang Shi Journal: Nature Date: 2010-07-11 Impact factor: 49.962