Literature DB >> 32671610

Effects of two kinds of fishery drugs on the expressions of GAD and GABA-T mRNA in crucian carp (Carassius auratus gibelio).

Fan Zhang1, Kun Hu2, Jianzhen Huang1, Zhi Tan1, Jiming Ruan3.   

Abstract

The objective of this study was to investigate the effects of difloxacin (DIF) and avermectin (AVM) on glutamate decarboxylase (GAD) and GABA-transaminase (GABA-T) in different tissues of crucian carp (Carassius auratus gibelio). After the treatments of DIF and AVM, the mRNA expressions of GAD and GABA-T in different tissues were detected by quantitative real-time PCR (qPCR). The results showed that the mRNA expressions of GAD65, GAD67, and GABA-T in the telencephalon (Tel), mesencephalon (Mes), cerebella (Cer), and medulla oblongata (Med) were downregulated significantly with the safe dose (SD, 20 mg/kg) of DIF (P < 0.05 or P < 0.01). While the expressions of GAD65 and GAD67 in the kidney at 12 h had strikingly upregulated to 13.81 ± 1.06** and 150.67 ± 12.85** times. Treated with the lethal dose of 50% (LD50, 2840 mg/kg b. W.) of DIF, the mRNA expressions of GAD65, GAD67, and GABA-T in all tissues were increased significantly (P < 0.01). The results of AVM group showed that the mRNA expressions of GAD65, GAD67, and GABA-T both in the central and peripheral tissues were all remarkably downregulated at the safe concentration (SC, 0.0039 mg/L) and the lethal concentration of 50% (LC50, 0.039 mg/L), except for the mRNA inhibitions of GAD65, GAD67, and GABA-T in the muscle at 2 h which sharply downregulated to 0.20 ± 0.02ΔΔ × 10-2, 0.57 ± 0.06ΔΔ × 10-1 and 0.44 ± 0.02ΔΔ × 10-1, respectively (P < 0.01).

Entities:  

Keywords:  Avermectin; Difloxacin; GABA-transaminase; Gamma-aminobutyric acid; Glutamate decarboxylase

Mesh:

Substances:

Year:  2020        PMID: 32671610      PMCID: PMC7584538          DOI: 10.1007/s10695-020-00847-z

Source DB:  PubMed          Journal:  Fish Physiol Biochem        ISSN: 0920-1742            Impact factor:   2.794


Introduction

GABA, an important inhibitory neurotransmitter in many organisms, along with glutamate (Glu), is involved in the neuromodulation of most synaptic activity. GABA arises via decarboxylation of L-glutamate by glutamate decarboxylase (GAD) (Chung et al. 1992) and is metabolized subsequently via GABA-transferase (GABA-T) to succinic semialdehyde, which is then oxidized to succinate (Wood et al. 1978). This process would directly affect the accumulations of GABA in organisms. The changes of Glu and GABA in nerve endings would result in rearrangements of the nervous system that increases neural activity (Nasreen et al. 2012). The production and metabolism of GABA can be predicted by observing changes in the expression of enzymes present in nerve endings. However, many factors affect how well GABA works, which include heavy metal (Struzyńska and Sulkowski 2004), antibiotics (Matsuo et al. 1998), insecticide (Sánchez-Borzone et al. 2017), and other biological toxins (Kudryavtsev et al. 2015). The imbalances of excitatory or inhibitory neurotransmitters caused by drugs can lead to nerve abnormalities, causing organisms to exhibit symptoms of nerve poisoning. Fluoroquinolones (FQs) were widely used in aquaculture due to its good bactericidal effect in China. Its family includes difloxacin (DIF), ofloxacin, pefloxacin, enoxacin, norfloxacin, etc. However, the side effects of FQs have been widely reported in recent years, such as its muscular toxicity (Demetrious 2018), renal toxicity (Owens and Ambrose 2005), and neurotoxicity (Xiao et al. 2018). Many reports suggested FQs could have caused severe neurotoxic reactions, which lead to hallucinations, depression, and other neurological diseases (Barrett and Login 2009; Grill and Maganti 2011; Guiol et al. 1993). It had been reported that norfloxacin (Xi et al. 2019) and DIF (Ruan et al. 2014a) caused non-target biological neurotoxicity. Albino male mice treated with ciprofloxacin were found the levels of Glu and GABA significantly reduced (Arafa et al. 2015). While as a broad-spectrum insecticide, avermectin (AVM) was also widely used for parasites killing in aquaculture. The problems of non-target biological poisoning caused by AVM were becoming more and more serious, including in birds (de Faria et al. 2018a, b), fish (Novelli et al. 2016), batrachians (Vasconcelos et al. 2016), and mammals (Nasr et al. 2016). Experiments on Danio rerio (Weichert et al. 2017), mice (Da et al. 2018), and pigeon (Li et al. 2013) had been found that AVM could cause neurotoxicity. On specific physiological and biochemical indicators, AVM exposure enhanced the contents of GABA, glycine, Glu, and aspartic acid in the cerebrum, cerebellum, and optic lobe of American king pigeons significantly (Chen et al. 2014). Crucian carp (Carassius auratus gibelio) is one of the tremendous economic value fish which widely cultivated in China. Therefore, this paper intends to study the possible variations of GABA’s synthetase and metabolic enzyme in crucian carp after treated with DIF and AVM.

Materials and methods

Experimental animals and fishery drugs

Crucian carp were bought from a farm in Nantong City, Jiangsu Province, east of China as experimental fish, which body weights were 50.04 ± 3.12 g, and fed for 2 weeks before the beginning of the experiments. Plenty of oxygen was pumped into the water during the whole experiment. Temperature and pH values were maintained in the right range of crucian carp. All the fish were fed twice per day. The SD and the lethal dose of 50% at 96 h (96 h LD50) of DIF were 20 mg/kg b. W. and 2840 mg/kg b. W. which referred from the previous study (Ruan et al. 2014a). According to the body weights of the experimental fish, DIF was singly orally administered into the foregut of the experimental fish. The SC and 96 h LC50 of AVM were 0.0039 mg/L and 0.039 mg/L by the method of single bath administration (Ruan et al. 2013).

The sample collections

The experimental fish were randomly divided into three groups at the corresponding dose/concentration, 60 fish per group. Samples of Tel, Mes, Cer, Med, liver, kidney, and muscle were collected and stored at − 80 °C for the mRNA extractions. All fish were handled following the “Regulation on Animal Experimentation.”

Total RNA extraction, reverse transcription, RT-PCR analysis, and qPCR analysis

The procedures of total RNA extraction, RT-PCR, and qPCR analysis were referred from the previous article (Ruan et al. 2014b). The primers pairs were shown in the Table 1.
Table 1

Information of primers of the paper

GenesPrimer sequence(5′-3′)GenBank IDSize (bp)Temp. (°C)
β-Actin

Forward TACGTTGCCATCCAGGCTGTG

Reverse CATGGGGCAGGGCGTAACC

M24113.112455–60
GAD65

Forward TTCTCTGTCGCTGCTCTGAT

Reverse CTCTCGGCTGTAGACCCAT

AF149832.124657.4
GAD67

Forward GTTTTCTGATATCAAGCGTCTCAC

Reverse TGGCAGGTTGTCGTAAATTAG

AF149833.120956.1
GABA-T

Forward GCTGCCTGGCCACAACACA

Reverse TCCCTCACAAACTCCTCCAGA

DQ287923.111557.5
Information of primers of the paper Forward TACGTTGCCATCCAGGCTGTG Reverse CATGGGGCAGGGCGTAACC Forward TTCTCTGTCGCTGCTCTGAT Reverse CTCTCGGCTGTAGACCCAT Forward GTTTTCTGATATCAAGCGTCTCAC Reverse TGGCAGGTTGTCGTAAATTAG Forward GCTGCCTGGCCACAACACA Reverse TCCCTCACAAACTCCTCCAGA

Data processing

The comparative threshold method (2-ΔΔCT) was employed to calculate the relative expression of the genes. The data were expressed as mean ± standard deviation (SD) and SPSS 17.0 (Chicago, IL, USA) was used for one-way ANOVA, where P < 0.05 and P < 0.01, respectively, indicated significant and extremely significant difference.

Results and analysis

Analysis of genes expressions in the brain at the SD of DIF

From Fig. 1 a and b, it could be found that GAD65 and GAD67 expressions were significantly suppressed (P < 0.01) in the crucian carp’s brain by SD of DIF (20 mg/kg b. W.) after treatment at 0.083, 2, and 120 h. The volumes and the time-points which GAD65 expressions remarkably inhibited were 0.25 ± 0.05ΔΔ at 0.083 h in Tel, 0.12 ± 0.01ΔΔ at 12 h in Med, and 0.18 ± 0.01ΔΔ at 120 h in Mes, respectively (Fig. 1a). GAD67 levels were strongly suppressed in Med, and the changes in which were 0.46 ± 0.06ΔΔ times at 0.083 h, 0.22 ± 0.01ΔΔ times at 12 h, and 0.30 ± 0.01ΔΔ times at 120 h times (Fig. 1b). The same as GAD67, GABA-T gene in Med and the changes of which were 0.57 ± 0.02ΔΔ times at 0.083 h, 0.37 ± 0.03ΔΔ times at 12 h, and 0.55 ± 0.06ΔΔ times at 120 h (Fig. 1c). However, GABA-T levels were significantly upregulated in Tel and Cer at 120 h, and their volumes were 1.21 ± 0.20** and 1.55 ± 0.14** (P < 0.01).
Fig. 1

Effects in brain GAD and GABA-T mRNA expressions at the SD of DIF

Effects in brain GAD and GABA-T mRNA expressions at the SD of DIF Note: 0.083 h, 12 h, and 120 h were the three-time points of DIF at the SD (20 mg/kg b. W.) (Ruan et al. 2014a). “Δ” and “ΔΔ” mean significant (P < 0.05) or extremely significant (P < 0.01) downregulation, while “*” and “**” mean significant (P < 0.05) or extremely significant (P < 0.01) upregulation. The same as followed.

Analysis of mRNA expressions in peripheral tissues at the SD of DIF

GAD expressions in the peripheral tissues were extremely significant inhibited by DIF (P < 0.01). As shown in Fig. 2 a and b and, GAD65 and GAD67 genes were suppressed to minimums for 0.12 ± 0.01ΔΔ and 0.22 ± 0.01ΔΔ at 12 h, while GABA-T genes were significantly upregulated in the liver. The maximum changes of GABA-T were 1.76 ± 0.18** times at 120 h in the liver (Fig. 2c). GAD and GABA-T levels appeared consistent trends as first decreasing, then increasing, and decreasing in the kidney. Among them, GAD65 levels were 0.19 ± 0.05ΔΔ at 0.083 h, 13.81 ± 1.06** at 12 h, and 0.36 ± 0.05ΔΔ at 120 h (Fig. 3a), while GAD67 levels were 0.37 ± 0.08ΔΔ at 0.083 h, 150.67 ± 12.85** at 12 h, and 3.64 ± 0.28* at 120 h (Fig. 3b). Moreover, GABA-T gene were 1.02 ± 0.02* at 0.083 h, 5.22 ± 0.22** at 12 h, and 0.25 ± 0.01ΔΔ at 120 h (Fig. 3c). GAD65 level was greatly inhibited in the muscle, and its minimum value was 0.04 ± 0.008ΔΔ at 0.083 h (Fig. 4a), while GAD67 level was extremely significant increased with a maximum change of 2.89 ± 0.58** times at 12 h (Fig. 4b). GABA-T levels were 0.68 ± 0.05ΔΔ at 0.083 h, 1.37 ± 0.14** at 12 h, and 0.93 ± 0.08ΔΔ at 120 h (Fig. 4c), which also showed a same trend as “decreasing—increasing—decreasing.”
Fig. 2

Effects of GAD and GABA-T mRNA expressions in the liver at the SD of DIF

Fig. 3

Effects of GAD and GABA-T mRNA expressions in the kidney at the SD of DIF

Fig. 4

Effects of GAD and GABA-T mRNA expressions in the muscle at the SD of DIF

Effects of GAD and GABA-T mRNA expressions in the liver at the SD of DIF Effects of GAD and GABA-T mRNA expressions in the kidney at the SD of DIF Effects of GAD and GABA-T mRNA expressions in the muscle at the SD of DIF

Analysis of mRNA expressions at LD50 of DIF

The GAD65, GAD67, and GABA-T levels were extremely increased both in the brain and peripheral tissues of the crucian carp at LD50 of DIF (P < 0.01, Tables 2 and 3). The volumes of extremely stimulated GAD65, GAD67, and GABA-T levels were 2.25 ± 0.16** in Cer, 2.41 ± 0.09** in Tel, and 1.97 ± 0.23** in Med (Table 2). As in the kidney, GAD65 and GAD67 levels were significantly increased by 3.81 ± 0.19** and 8.46 ± 1.43**. A phenomenon in the muscle was that GAD65 level was suppressed by 0.32 ± 0.03ΔΔ times at 0.083 h, while GAD67 and GABA-T levels were raised to 14.19 ± 1.25** times and 1.12 ± 0.18** times (Table 2).
Table 2

GAD65, GAD67, and GABA-T mRNA expressions at LD50 of DIF

TissuesGAD65GAD67GABA-T
Tel1.02 ± 0.142.41 ± 0.09**1.04 ± 0.16**
Mer1.08 ± 0.8**1.38 ± 0.23**1.03 ± 0.11**
Cer2.25 ± 0.16**1.79 ± 0.06**1.12 ± 0.18**
Med1.41 ± 0.07**1.57 ± 0.11**1.97 ± 0.23**
Liver1.41 ± 0.07**1.57 ± 0.21**1.04 ± 0.16**
Kidney3.81 ± 0.19**8.46 ± 1.43**1.03 ± 0.11**
Muscle0.32 ± 0.03ΔΔ14.19 ± 1.25**1.12 ± 0.18**
Table 3

GAD65, GAD67 and GABA-T mRNA expressions at LC50 of AVM

TissuesGAD65GAD67GABA-T
Tel0.17 ± 0.03ΔΔ0.32 ± 0.05ΔΔ0.83 ± 0.02ΔΔ
Mer0.12 ± 0.01ΔΔ0.23 ± 0.02ΔΔ0.66 ± 0.05ΔΔ
Cer0.41 ± 0.02ΔΔ0.61 ± 0.09ΔΔ0.68 ± 0.05ΔΔ
Med0.23 ± 0.03ΔΔ0.19 ± 0.01ΔΔ0.64 ± 0.07ΔΔ
Liver0.27 ± 0.03ΔΔ0.23 ± 0.02ΔΔ0.53 ± 0.06ΔΔ
Kidney0.36 ± 0.06ΔΔ0.35 ± 0.04ΔΔ0.91 ± 0.09ΔΔ
Muscle(× 10−1)0.029 ± 0.002ΔΔ0.62 ± 0.02ΔΔ0.53 ± 0.05ΔΔ
GAD65, GAD67, and GABA-T mRNA expressions at LD50 of DIF GAD65, GAD67 and GABA-T mRNA expressions at LC50 of AVM

Analysis of mRNA expressions in the brain at the SC of AVM

Treated by AVM, the levels of GAD65, GAD67, and GABA-T were extremely inhibited in the brain (P < 0.01, Fig. 5). The volumes and the time-points which GAD65 expressions remarkably inhibited were 0.16 ± 0.01ΔΔ at 0.083 h in Mer, 0.17 ± 0.01ΔΔ at 2 h in Med, and 0.20 ± 0.02ΔΔ at 120 h in Mes, respectively (Fig. 5a). There were significantly downregulated GAD67 gene expressions in Med, which of the gene levels were 0.19 ± 0.02ΔΔ at 0.083 h, 0.14 ± 0.02ΔΔ at 2 h, and 0.16 ± 0.03ΔΔ at 120 h (Fig. 5b). In contrast, the GABA-T level was less inhibited, with which was minimum by 0.53 ± 0.06 times at 0.083 h in Cer (Fig. 5c).
Fig. 5

Effects of GAD and GABA-T mRNA expressions in the brain at the SC of AVM

Effects of GAD and GABA-T mRNA expressions in the brain at the SC of AVM Note: 0.083 h, 2 h, and 120 h were the time points of AVM at the SC (0.0039 mg/L) (Ruan et al. 2013).

Analysis of mRNA expressions in peripheral tissues at the SC of AVM

According to Fig. 6, the GAD and GABA-T levels in the liver were both strongly inhibited at the SC of AVM (P < 0.01, Fig. 6). GAD65 and GAD67 levels were remarkably suppressed to 0.09 ± 0.01ΔΔ at 0.083 h (Fig. 6a) and 0.05 ± 0.01ΔΔ at 2 h (Fig. 6b). GABA-T genes were inhibited significantly, with minimum of which was 0.23 ± 0.02ΔΔ at 2 h in the liver (Fig. 6c), and expressions of GABA-T showed as a “high-low-high” trend. The GAD and GABA-T levels were also significantly downregulated in the kidney. In general, the volumes and the time-points which GAD65, GAD67, and GABA-T levels remarkably inhibited were 0.52 ± 0.05ΔΔ at 0.083 h (Fig. 7a), 0.06 ± 0.01ΔΔ at 0.083 h (Fig. 7b), and 0.26 ± 0.02ΔΔ at 2 h (Fig. 7c), respectively. Similarly, GAD and GABA-T levels in the muscle were also inhibited strongly. The largest variation range of GAD65, GAD67, and GABA-T were 0.20 ± 0.02ΔΔ × 10−2 (Fig. 8a), 0.57 ± 0.06ΔΔ × 10−1 (Fig. 8b), and 0.44 ± 0.02ΔΔ × 10−1 times greater (Fig. 8c) at 2 h, respectively.
Fig. 6

Effects of GAD and GABA-T mRNA expressions in the liver at the SC of AVM

Fig. 7

Effects of GAD and GABA-T mRNA expressions in the kidney at the SC of AVM

Fig. 8

Effects of GAD and GABA-T mRNA expressions in the muscle at the SC of AVM

Effects of GAD and GABA-T mRNA expressions in the liver at the SC of AVM Effects of GAD and GABA-T mRNA expressions in the kidney at the SC of AVM Effects of GAD and GABA-T mRNA expressions in the muscle at the SC of AVM

Analysis of mRNA expressions at the LC50 of AVM

GAD65, GAD67, and GABA-T levels both in the brain and peripheral tissues were significantly downregulated (P < 0.01) at 96 h LC50 (0.039 mg/L). GAD65 level was inhibited significantly to 0.12 ± 0.01ΔΔ in Mer. Furthermore, GAD67 and GABA-T levels with minimum values were 0.19 ± 0.01ΔΔ and 0.64 ± 0.07ΔΔ in Med (Table 3). Compared to the liver, GAD65, GAD67, and GABA-T levels in the kidney were less inhibited. And the mRNA expressions of GAD65, GAD67, and GABA-T were 0.36 ± 0.06ΔΔ, 0.35 ± 0.04ΔΔ, and 0.91 ± 0.09ΔΔ, respectively. GAD and GABA-T levels in the muscle were inhibited strongly, where the relative expressions of GAD65, GAD67, and GABA-T were 0.0029 ± 0.0002ΔΔ, 0.062 ± 0.002ΔΔ, and 0.053 ± 0.005ΔΔ, respectively (Table 3).

Discussions

Effects of DIF on the mRNA expressions of GAD and GABA-T in crucian carp

It is generally believed that FQs antagonizes inhibitory neurotransmitter GABA, thereby increasing nerve excitability, leading to convulsions, epilepsy, and other adverse reactions (Motomura et al. 1991; Matsuo et al. 1998). GABA mediates the release of inhibitory synapses of neurons, which can reduce the hyperexcitability of neurons. Previous study found that crucian carp suffered from impatience and restlessness, body type tremors when treated with DIF (Ruan et al. 2014a). Meanwhile, it was also found in this paper that GAD65, GAD67, and GABA-T levels were significantly downregulated at 0.083 and 12 h in the brain after administrated with DIF at its SD (20 mg/kg b. W.), while GAD65, GAD67, and GABA-T levels were significantly upregulated at LD50 (2840 mg/kg b. W.) of DIF (P < 0.01, Fig. 1 and Table 2). However, GABA-T levels were significantly upregulated at 120 h in Tel and Cer after treated with DIF at its SD, which seemed to suggest that DIF could stimulate the overexpression of GABA-T to consume the GABA flux in the nerve center as an antagonistic inhibitor of GABA and enhance the convulsion effect of crucian carp. Moreover, the decreased GABA levels were also reported in the albino rat brain after intraperitoneal injection of FQS (Arafa et al. 2015). Similarly, GABA was continuously inhibited, resulting in epilepsy of old people after treated with FQS (Isaacson et al. 1993). These pieces of evidence suggested that the systemic neurotoxicity of crucian carp may be related to the upregulation of mRNA levels of GAD and GABA-T in various tissues treated with the lethal dose of DIF. After the treatments at SD or LD50 of DIF, GABA-T level was significantly increased (P < 0.01) in the liver (Fig. 2 and Table 2). While GAD levels were of different expressions at the two doses, which may be lead to the accumulation of GABA in the liver for the reason of DIF. In addition, GAD and GABA-T levels showed time-concentration effect after administration with DIF at its SD or LD50 in the kidney (Fig. 4). This may suggested that low dose of DIF would inhibit GABA pathway, while high dose (or high residual) has opposite performance, the same as the effect of DIF on the central nervous system. This phenomenon may be a protective mechanism of stress resistance in crucian carp.

Effects of AVM on the mRNA expressions of GAD and GABA-T in crucian carp

GABA levels in organisms were determined by the dynamic balance between synthesis and catabolism and regulated by the level of GAD, precursor availability, and possibly GABA degradation (de Graaf et al. 2006). It has been reported that the neurotoxicity of AVM to organisms was due to its ability to trigger the opening of Cl− channels (Lasota and Dybas 1991). This process was irreversible and only occurred in invertebrates (Cornejo et al. 2014). In addition, the neurotoxicity of AVM was also reflected in the destruction of a large number of nerve cells (Shu et al. 2010). After been exposed to AVM at the SC (0.0039 mg/L) and LC50 (0.039 mg/L), the mRNA expressions of GAD and GABA-T both in the brain and peripheral tissues of crucian carp were inhibited significantly in this paper (P < 0.01, Figs. 4, 5, 6, 7, 8 and Table 3). This result indicated that the central nervous system was influenced by AVM in crucian carp. It was found that the mRNA levels of GAD65, GAD67, and GABA-T in the goldfish’s brain were downregulated after treatment with GABA receptor agonists (Martyniuk et al. 2007). Similar results were found in this paper. Interestingly, GABA-T was inhibited to a much lower degree than that of GAD’s in the brain at LC50 of AVM. Based on previous research, the GAD level was much higher than that of GABA-T in the brain, which seemed to indicate that AVM would causes different expression of GAD and GABA-T (Ruan et al. 2014b). But on the contrary, GAD and GABA-T levels were extremely inhibited in the muscle after treated with AVM at the SC or at the LC50 (Fig. 8 and Table 3), which suggested that neuromuscular synthesis and metabolic rate of GABA were stagnant. This may lead to an imbalance in muscular nerve regulation, such as pathological convulsion of muscle. Similar findings were also found that the status of crucian carp was in physical imbalance and has a slower respiration rate after AVM treatments (Wang and Lu 2010). After been exposed to AVM, it was discovered that Japanese quails has a decrease of response to its natural enemies (de Faria et al. 2018b). Other paper found that AVM would cause twitching and keep exciting in bees; this may relate to the fact that AVM inhibits the expressions of GAD and GABA-T in the cerebellum (Zhao et al. 2014). Besides, deltamethrin and β-cypermethrin could downregulate GABA-T level in the cerebral cortex of rats, which resulting in an increase in GABA level (Ji et al. 2003; Han et al. 2014). All the evidences mentioned above suggested that AVM would break through the blood-brain barrier, which lead to the increase of GABA through affecting the mRNA expressions of GAD65, GAD67, and GABA-T in crucian carp’s nervous system.

Conclusion

The expressions of GAD65, GAD67, and GABA-T were all significantly downregulated at the SD of DIF except for the upregulated expression of GABA-T in the kidney and muscle tissues at 120 h, while the expressions of the three genes were significantly upregulated at the LD50 of DIF. In addition, the expressions of GAD65, GAD67, and GABA-T in various tissues of crucian carp were significantly downregulated both at the SC and LC50 of AVM.
  32 in total

1.  Assessing the ecotoxicity of potentially neurotoxic substances - Evaluation of a behavioural parameter in the embryogenesis of Danio rerio.

Authors:  Fabian G Weichert; Carolin Floeter; Adriana S Meza Artmann; Ulrike Kammann
Journal:  Chemosphere       Date:  2017-07-27       Impact factor: 7.086

2.  Glutamate decarboxylase and GABA aminotransferase levels in different regions of rat brain on the onset of Leptazol induced convulsions.

Authors:  Zahida Nasreen; Tahmeen Jameel; Ashfaq Hasan; N Parveen; B Sadasivudu
Journal:  Neurochem Res       Date:  2011-09-21       Impact factor: 3.996

3.  Neurotoxins from snake venoms and α-conotoxin ImI inhibit functionally active ionotropic γ-aminobutyric acid (GABA) receptors.

Authors:  Denis S Kudryavtsev; Irina V Shelukhina; Lina V Son; Lucy O Ojomoko; Elena V Kryukova; Ekaterina N Lyukmanova; Maxim N Zhmak; Dmitry A Dolgikh; Igor A Ivanov; Igor E Kasheverov; Vladislav G Starkov; Joachim Ramerstorfer; Werner Sieghart; Victor I Tsetlin; Yuri N Utkin
Journal:  J Biol Chem       Date:  2015-07-28       Impact factor: 5.157

4.  Effects of norfloxacin exposure on neurodevelopment of zebrafish (Danio rerio) embryos.

Authors:  Jinlei Xi; Juan Liu; Shijing He; Wanyao Shen; Cizhao Wei; Ke Li; Yufeng Zhang; Jiang Yue; Zheqiong Yang
Journal:  Neurotoxicology       Date:  2019-02-12       Impact factor: 4.294

5.  Relationship Between Fluoroquinolone Structure and Neurotoxicity Revealed by Zebrafish Neurobehavior.

Authors:  Chaoqiang Xiao; Ying Han; Ying Liu; Jingpu Zhang; Changqin Hu
Journal:  Chem Res Toxicol       Date:  2018-03-27       Impact factor: 3.739

6.  The production and efflux of 4-aminobutyrate in isolated mesophyll cells.

Authors:  I Chung; A W Bown; B J Shelp
Journal:  Plant Physiol       Date:  1992-06       Impact factor: 8.340

Review 7.  Neurotoxic effects associated with antibiotic use: management considerations.

Authors:  Marie F Grill; Rama K Maganti
Journal:  Br J Clin Pharmacol       Date:  2011-09       Impact factor: 4.335

8.  The effects of GABA agonists on glutamic acid decarboxylase, GABA-transaminase, activin, salmon gonadotrophin-releasing hormone and tyrosine hydroxylase mRNA in the goldfish (Carassius auratus) neuroendocrine brain.

Authors:  C J Martyniuk; J P Chang; V L Trudeau
Journal:  J Neuroendocrinol       Date:  2007-05       Impact factor: 3.627

9.  Attenuation of γ-aminobutyric acid (GABA) transaminase activity contributes to GABA increase in the cerebral cortex of mice exposed to β-cypermethrin.

Authors:  Y Han; D Cao; X Li; R Zhang; F Yu; Y Ren; L An
Journal:  Hum Exp Toxicol       Date:  2013-11-12       Impact factor: 2.903

10.  Effects of Insecticidal Ketones Present in Mint Plants on GABAA Receptor from Mammalian Neurons.

Authors:  Mariela Eugenia Sánchez-Borzone; Leticia Delgado Marin; Daniel Asmed García
Journal:  Pharmacogn Mag       Date:  2017 Jan-Mar       Impact factor: 1.085

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.