Güliz Gürel Özcan1, Sumi Lim1, Patricia LA Leighton2,3, W Ted Allison2,3, Jason Rihel1. 1. Department of Cell and Developmental Biology, UCL, London, United Kingdom. 2. Centre for Prions & Protein Folding Disease, University of Alberta, Edmonton, Canada. 3. Department of Biological Sciences, University of Alberta, Edmonton, Canada.
Abstract
Disrupted sleep is a major feature of Alzheimer's disease (AD), often arising years before symptoms of cognitive decline. Prolonged wakefulness exacerbates the production of amyloid-beta (Aβ) species, a major driver of AD progression, suggesting that sleep loss further accelerates AD through a vicious cycle. However, the mechanisms by which Aβ affects sleep are unknown. We demonstrate in zebrafish that Aβ acutely and reversibly enhances or suppresses sleep as a function of oligomer length. Genetic disruptions revealed that short Aβ oligomers induce acute wakefulness through Adrenergic receptor b2 (Adrb2) and Progesterone membrane receptor component 1 (Pgrmc1), while longer Aβ forms induce sleep through a pharmacologically tractable Prion Protein (PrP) signaling cascade. Our data indicate that Aβ can trigger a bi-directional sleep/wake switch. Alterations to the brain's Aβ oligomeric milieu, such as during the progression of AD, may therefore disrupt sleep via changes in acute signaling events.
Disrupted sleep is a major feature of Alzheimer's disease (AD), often arising years before symptoms of cognitive decline. Prolonged wakefulness exacerbates the production of amyloid-beta (Aβ) species, a major driver of AD progression, suggesting that sleep loss further accelerates AD through a vicious cycle. However, the mechanisms by which Aβ affects sleep are unknown. We demonstrate in zebrafish that Aβ acutely and reversibly enhances or suppresses sleep as a function of oligomer length. Genetic disruptions revealed that short Aβ oligomers induce acute wakefulness through Adrenergic receptor b2 (Adrb2) and Progesterone membrane receptor component 1 (Pgrmc1), while longer Aβ forms induce sleep through a pharmacologically tractable Prion Protein (PrP) signaling cascade. Our data indicate that Aβ can trigger a bi-directional sleep/wake switch. Alterations to the brain's Aβ oligomeric milieu, such as during the progression of AD, may therefore disrupt sleep via changes in acute signaling events.
Accumulation of amyloid-beta (Aβ) in plaques, along with tau tangles, is one of the two pathological hallmarks of Alzheimer’s disease (AD). Change in Aβ levels in the brain is one of the earliest known pathological events in AD and is detectable years before the development of Aβ plaques and decades before the clinical onset of AD (Bateman et al., 2007; Jack et al., 2013). Because of its importance in AD progression, Aβ has been mostly characterized as a functionless, pathological, intrinsically neurotoxic peptide (Moir and Tanzi, 2019). However, Aβ is an ancient neuropeptide conserved across vertebrates through at least 400 million years of evolution (Moir and Tanzi, 2019). Aβ’s cleavage from amyloid precursor protein (APP) is tightly regulated by multiple enzymatic reactions (O'Brien and Wong, 2011), and its release from neurons is carefully controlled (Kamenetz et al., 2003). Aβ interacts with numerous surface receptors and can activate intrinsic cellular signalling cascades to alter neuronal and synaptic function (Jarosz-Griffiths et al., 2016). More recently, Aβ has been suggested to act as an antimicrobial peptide (Soscia et al., 2010), and the deposition of Aβ may be induced as an innate immune defence mechanism against microbial pathogens (Kumar et al., 2016). However, the various biological effects of Aβ in health or disease remain obscure.One of the earliest symptoms of AD is the disruption of sleep, and ADpatients have sleep-wake abnormalities, including insomnia at night and increased napping during the day (Allen et al., 1987; Loewenstein et al., 1982; Moran et al., 2005; Prinz et al., 1982). Multiple transgenicADmouse models that overproduce Aβ also show disrupted sleep phenotypes (Roh et al., 2012; Sterniczuk et al., 2010; Wang et al., 2002), often in the absence of neuronal loss and preceding impairments of learning and memory (Irizarry et al., 1997). In non-pathological conditions, Aβ levels in the cerebrospinal fluid (CSF) are modulated by the sleep-wake cycle (Kang et al., 2009; Xie et al., 2013). Aβ generation and release are controlled by electrical and synaptic activity (Cirrito et al., 2005; Kamenetz et al., 2003), leading to increased extracellular Aβ levels during wakefulness and decreased levels during sleep (Kang et al., 2009; Xie et al., 2013). These observations have led to the proposal that sleep and Aβ dynamics create a vicious feed-forward cycle, wherein increases in wakefulness result in increased extracellular Aβ and aggregation, which then dysregulates sleep, further exacerbating pathogenic Aβ production (Roh et al., 2012). How increased Aβ burden leads to disruptions in sleep remains unknown, although AD-related cell death of critical sleep/wake regulatory neurons has been suggested as a possible mechanism (Fronczek et al., 2012; Lim et al., 2014; Manaye et al., 2013).Given the relationship between Aβ and sleep, we hypothesized that Aβ may directly modulate sleep-regulatory pathways independently of neuronal cell death. To test this, we took advantage of the ability to directly deliver small molecules and Aβ peptides to the brain of larval zebrafish, which have conserved APP processing machinery and Aβ peptides (Newman et al., 2014) and share genetic, pharmacological, and neuronal sleep-regulatory mechanisms with mammals (Barlow and Rihel, 2017). We found that Aβ size-dependently and reversibly modulates behavior through two distinct genetic, pharmacologically tractable pathways that regulate sleep in opposing directions.
Results
Aβ dose-dependently modifies zebrafish sleep and wake behavior
Isolating the specific biological effects of Aβ has been experimentally difficult. One challenge is that Aβ is processed from a series of complex cleavage steps of a longer transmembrane protein, APP, which also produces other protein products with a variety of functions (O'Brien and Wong, 2011). This restricts the utility of genetic manipulations to tease out Aβ-specific roles from the other APP components. Another challenge is that Aβ forms, in vitro and in vivo, a variety of oligomeric species (e.g. dimers, longer oligomers, or large fibrils) with diverse structures, binding affinities, and signalling properties (Benilova et al., 2012; Jarosz-Griffiths et al., 2016). Teasing out the biological signalling capabilities of these diverse oligomeric species requires selective manipulation of Aβ oligomeric states, which is difficult in vitro and is currently nearly impossible endogenously in vivo.To overcome some of these barriers, we developed an injection assay in which the amount and type of the Aβ oligomers can be controlled and then tested the acute signaling effects of Aβ on sleep and wake behavior. Our minimally invasive intra-cardiac injection assay in 5 days post fertilization (5 dpf) larval zebrafish avoids direct damage to brain tissue (Figure 1A and B). This technique rapidly (<1 hr, peaking within 2–3 hr) and reversibly delivers Aβ to the larval brain, as assessed by injection of fluorescently tagged Aβ42 and subsequent confocal brain imaging (Figure 1B, Figure 1—figure supplement 1A,B). To generate different Aβ oligomeric species, we modified previously established in vitro monomeric Aβ incubation protocols (see Extended Methods) that enrich for Aβ with different oligomeric sizes and opposing effects on rat neuronal excitability (Kusumoto et al., 1998; Orbán et al., 2010; Whitcomb et al., 2015). By incubating Aβ42 overnight at increasing temperatures, we generated Aβ oligomeric pools with significantly different lengths, as measured by transmission electron microscopy (TEM) (Figure 1C and Figure 1—figure supplement 1C). Aβ42 incubated overnight at 4°C consisted of fewer and shorter oligomers (Aβshort, mean 45 ± 11 nm, median = 39 nm) than when incubated at 25°C (Aβlong, mean 75 ± 10 nm, median = 61 nm) or at 37°C (Aβv-long, mean 121 ± 10 nm, median = 88 nm) (Figure 1C).
Figure 1.
Aβ oligomers bi-directionally affect sleep and wake in zebrafish larvae.
(A) Experimental schematic. Aβ was injected into the heart of 5 dpf larvae in the morning (ZT2 = zeitgeber time 2, that is 2hr after lights on). Behavior was then monitored in a square-welled 96-well plate for 24–48 hr on a 14 hr:10 hr light:dark cycle. (B) Heart-injected HiLyteTM Fluor 647-labeled Aβ42 (fAβ) penetrated the whole larval brain as visualized by confocal microscopy (optical sections, dorsal view) taken 2 hr after injection. Anterior is to the top. (C) Aβ prepared under increasing temperatures adopted longer oligomeric lengths, as measured by transmission electron microscopy. Each dot is a single oligomer (N = number measured), and the bars show the median. Data was taken from five randomly selected micrographs from two independent experiments. **p≤0.01, ****p≤1×10-7 Kruskal-Wallis, Tukey-Kramer post-hoc test. (D, E) Exemplar 24 hr traces post-injection comparing the effect of Aβshort (blue) on average waking activity (D) and sleep (E) versus Aβrev controls (grey). Ribbons represent ±the standard error of the mean (SEM). Light and dark bars indicate the lights ON and lights OFF periods, respectively. N = the number of larvae in each condition. (D’, E’) The effect of Aβshort relative to Aβrev on waking (D’) and sleep (E’) during the first day is shown, pooled from n = 5 independent experiments. Each dot represents a single larva normalized to the mean of the Aβrev control, and error bars indicate ± SEM. The mean difference effect size and 95% confidence interval is plotted to the right. *p<0.05, Tp <0.1, one-way ANOVA. (F, G) Exemplar 24 hr traces post-injection comparing the effect of Aβlong (green) on average waking activity (F) and sleep (G) versus Aβrev controls (grey). (F’, G’) The effect of Aβlong relative to Aβrev on waking (F’) and sleep (G’) during the first day is shown, pooled from n = 4 independent experiments. *p<0.05, **p<0.01, one-way ANOVA. (H, I) Exemplar 24 hr traces post-injection comparing the effect of Aβv_long (magenta) on average waking activity (H) and sleep (I) versus Aβrev peptide controls (grey). (H’, I’) The effect of Aβv_long relative to Aβrev on waking (H’) and sleep (I’) during the first day is shown, pooled from n = 3 independent experiments. (J) The effect of different Aβ preparations on the number of sleep bouts relative to Aβrev controls. The difference effect size and 95% confidence interval is plotted below. The asterisks indicate statistically significant different effects among the preps (***p<0.001, one-way ANOVA). See also Figure 1—figure supplements 1–3.
(A) Same images from Figure 1B, highlighting the region of interest in the telencephalon for fluorescence intensity measurements in B. Anterior is to the top, dorsal view. (B) Heart-injected fluorescently-tagged Aβ (black) penetrates the brain within 1 hr and peaks in concentration 2–3 hr post-injection. Cyan shows background fluorescence of a negative control. The shaded area shows ± standard deviation from three independent injections. (C) Electron micrographs of Aβ oligomers formed after 24 hr incubation at 4°C, 25°C, and 37°C. Aβarctic was incubated at 25°C for 2 hr as a positive control. The color code is used throughout the main and supplementary figures. Scale bar = 100 nm (D) The Aβshort (blue) and Aβlong (green) have opposing, dose-dependent effects on average waking activity, normalized to Aβrev injections. The error bars represent ±the SEM. doseXprep interaction *p≤0.05, ****p≤0.0001 two-way ANOVA, Fisher’s least significant difference post hoc test. p≤0.001, prep effect (plotted in F). (E) Aβshort (blue) and Aβlong (green) have opposing, dose-dependent effects on sleep. doseXprep interaction, two-way ANOVA, *p≤0.05, Fisher’s least significant difference post hoc test. p≤0.05, prep effect (plotted in G). Based on the data in D-E, 10 nM was chosen as the concentration for all subsequent Aβ injection experiments. (F) The waking activity for each larva in D, normalized to Aβrev injections and plotted to emphasize the significant effect of the preparation irrespective of dose (p<0.001, two-way ANOVA). (G) Sleep for each larva in E normalized to Aβrev injections and plotted to emphasize the significant effect of the preparation (p<0.001, two-way ANOVA). (H) Sleep plot of untreated WT (black), anesthetized only (red), mock injected (blue) and PBS injected (green) fish on a 14 hr:10 hr light:dark cycle (indicated by the white and black bars). The ribbons represent ±the SEM. (I) Sleep for each larva in H (WT (black), anesthetised only (red), mock injected (blue) and PBS injected (green)) shows that there is no statistical difference in sleep due to any of the manipulations (p>0.05, one-way ANOVA). (J) Sleep plot after vehicle injection (PBS, magenta trace) and immediate tracking compared to larvae that had acclimated to the apparatus for 24 hr (black trace). The ribbons represent ±the SEM. Gold stars flag significantly different timepoints (p<0.05, repeated measures ANOVA) and were used to determine the window for calculating the evening-only effects of Aβ injections. (K) Calculating Aβ injection effects across the whole day or only in the evening window (data from Figure 1) has minimal effect on the analysis of Aβshort or Aβlong. The only exception (red shading) is for the reduction in sleep by Aβshort, due to a flooring effect.
(A) Dorsal and ventral views of representative 5 dpf larval brains stained for Caspase-3 activation (purple) to map apoptosis. Exposure to the topoisomerase inhibitor camptothecin (CPT, 1 µM), which induces apoptosis, serves as a positive control. DAPI stains nuclei in white for reference. Anterior is to the left. Scale bar = 100 µm (B,C) Quantification of the number of Caspase-3-positive cells after exposure to 1 µM CPT or Aβ oligomer injections (n = 5 brains for each condition, B-dorsal, C-ventral). Only CPT significantly increased apoptosis relative to Aβrev. ns, p>0.05, one-way ANOVA, Tukey’s post-hoc test. (D) Survival curves to adulthood after 5dpf injection of Aβ oligomers. There are no significant differences among survival curves, p>0.05, Kaplan-Meier log rank test.
(A–B) The effects of Aβshort (A) and Aβlong (B) on waking activity (top) and sleep (bottom) return to baseline after 24 hr. Shown in A and B are traces for 48 hr post-injection on a 14 hr:10 hr light:dark cycle (indicated by the white and black bars). The ribbons represent ±the SEM. Plotted on the right are the percent change induced by Aβ relative to Aβrev for day 1 versus day 2, demonstrating that these parameters return to baseline (*p≤0.01, paired t-test). Each line represents a single larva, the thicker line represents the mean ± SEM. (C) Activity traces of Aβshort (blue), Aβlong (green), and Aβrev (black) during and after a ten minute dark pulse are indistinguishable. Traces are for a 10 min:10 min:10 min light:dark:light window (indicated by the white and black bars). The ribbons represent ±the SEM. (D) The effects of Aβrev (black), convulsant PTZ (10 mM, orange), Aβshort (blue), and Aβlong (green) on sub-second larval bout structures. Shown are delta pixel movement of one representative larva in each group for ~1 min (see Figure 1—video 1). Unlike PTZ treated larvae, Aβ injected larvae have normal bout structures. Representative larvae were chosen to also highlight that, while overall Aβlong injected larvae are less active, individual animals can have sustained periods of heightened activity. Similarly, individual Aβshort injected animals can exhibit periods of relatively dampened activity. (E) The effects of Aβrev (black), convulsant PTZ (10 mM, orange), Aβshort (blue) and Aβlong (green) on high-frequency bouts (HFB) in a 5 min interval. Each dot represents a single larva. PTZ-induced HFB’s is non-existent or very rare in the other groups (n = 24 for all groups).
Figure 1—figure supplement 1.
Aβ oligomers exert dose-dependent, short-term effects on zebrafish sleep.
(A) Same images from Figure 1B, highlighting the region of interest in the telencephalon for fluorescence intensity measurements in B. Anterior is to the top, dorsal view. (B) Heart-injected fluorescently-tagged Aβ (black) penetrates the brain within 1 hr and peaks in concentration 2–3 hr post-injection. Cyan shows background fluorescence of a negative control. The shaded area shows ± standard deviation from three independent injections. (C) Electron micrographs of Aβ oligomers formed after 24 hr incubation at 4°C, 25°C, and 37°C. Aβarctic was incubated at 25°C for 2 hr as a positive control. The color code is used throughout the main and supplementary figures. Scale bar = 100 nm (D) The Aβshort (blue) and Aβlong (green) have opposing, dose-dependent effects on average waking activity, normalized to Aβrev injections. The error bars represent ±the SEM. doseXprep interaction *p≤0.05, ****p≤0.0001 two-way ANOVA, Fisher’s least significant difference post hoc test. p≤0.001, prep effect (plotted in F). (E) Aβshort (blue) and Aβlong (green) have opposing, dose-dependent effects on sleep. doseXprep interaction, two-way ANOVA, *p≤0.05, Fisher’s least significant difference post hoc test. p≤0.05, prep effect (plotted in G). Based on the data in D-E, 10 nM was chosen as the concentration for all subsequent Aβ injection experiments. (F) The waking activity for each larva in D, normalized to Aβrev injections and plotted to emphasize the significant effect of the preparation irrespective of dose (p<0.001, two-way ANOVA). (G) Sleep for each larva in E normalized to Aβrev injections and plotted to emphasize the significant effect of the preparation (p<0.001, two-way ANOVA). (H) Sleep plot of untreated WT (black), anesthetized only (red), mock injected (blue) and PBS injected (green) fish on a 14 hr:10 hr light:dark cycle (indicated by the white and black bars). The ribbons represent ±the SEM. (I) Sleep for each larva in H (WT (black), anesthetised only (red), mock injected (blue) and PBS injected (green)) shows that there is no statistical difference in sleep due to any of the manipulations (p>0.05, one-way ANOVA). (J) Sleep plot after vehicle injection (PBS, magenta trace) and immediate tracking compared to larvae that had acclimated to the apparatus for 24 hr (black trace). The ribbons represent ±the SEM. Gold stars flag significantly different timepoints (p<0.05, repeated measures ANOVA) and were used to determine the window for calculating the evening-only effects of Aβ injections. (K) Calculating Aβ injection effects across the whole day or only in the evening window (data from Figure 1) has minimal effect on the analysis of Aβshort or Aβlong. The only exception (red shading) is for the reduction in sleep by Aβshort, due to a flooring effect.
Aβ oligomers bi-directionally affect sleep and wake in zebrafish larvae.
(A) Experimental schematic. Aβ was injected into the heart of 5 dpf larvae in the morning (ZT2 = zeitgeber time 2, that is 2hr after lights on). Behavior was then monitored in a square-welled 96-well plate for 24–48 hr on a 14 hr:10 hr light:dark cycle. (B) Heart-injected HiLyteTM Fluor 647-labeled Aβ42 (fAβ) penetrated the whole larval brain as visualized by confocal microscopy (optical sections, dorsal view) taken 2 hr after injection. Anterior is to the top. (C) Aβ prepared under increasing temperatures adopted longer oligomeric lengths, as measured by transmission electron microscopy. Each dot is a single oligomer (N = number measured), and the bars show the median. Data was taken from five randomly selected micrographs from two independent experiments. **p≤0.01, ****p≤1×10-7 Kruskal-Wallis, Tukey-Kramer post-hoc test. (D, E) Exemplar 24 hr traces post-injection comparing the effect of Aβshort (blue) on average waking activity (D) and sleep (E) versus Aβrev controls (grey). Ribbons represent ±the standard error of the mean (SEM). Light and dark bars indicate the lights ON and lights OFF periods, respectively. N = the number of larvae in each condition. (D’, E’) The effect of Aβshort relative to Aβrev on waking (D’) and sleep (E’) during the first day is shown, pooled from n = 5 independent experiments. Each dot represents a single larva normalized to the mean of the Aβrev control, and error bars indicate ± SEM. The mean difference effect size and 95% confidence interval is plotted to the right. *p<0.05, Tp <0.1, one-way ANOVA. (F, G) Exemplar 24 hr traces post-injection comparing the effect of Aβlong (green) on average waking activity (F) and sleep (G) versus Aβrev controls (grey). (F’, G’) The effect of Aβlong relative to Aβrev on waking (F’) and sleep (G’) during the first day is shown, pooled from n = 4 independent experiments. *p<0.05, **p<0.01, one-way ANOVA. (H, I) Exemplar 24 hr traces post-injection comparing the effect of Aβv_long (magenta) on average waking activity (H) and sleep (I) versus Aβrev peptide controls (grey). (H’, I’) The effect of Aβv_long relative to Aβrev on waking (H’) and sleep (I’) during the first day is shown, pooled from n = 3 independent experiments. (J) The effect of different Aβ preparations on the number of sleep bouts relative to Aβrev controls. The difference effect size and 95% confidence interval is plotted below. The asterisks indicate statistically significant different effects among the preps (***p<0.001, one-way ANOVA). See also Figure 1—figure supplements 1–3.
Figure 1—figure supplement 3.
Aβ-injected larvae recover after 24 hr and do not exhibit seizure-like or sickness behavior.
(A–B) The effects of Aβshort (A) and Aβlong (B) on waking activity (top) and sleep (bottom) return to baseline after 24 hr. Shown in A and B are traces for 48 hr post-injection on a 14 hr:10 hr light:dark cycle (indicated by the white and black bars). The ribbons represent ±the SEM. Plotted on the right are the percent change induced by Aβ relative to Aβrev for day 1 versus day 2, demonstrating that these parameters return to baseline (*p≤0.01, paired t-test). Each line represents a single larva, the thicker line represents the mean ± SEM. (C) Activity traces of Aβshort (blue), Aβlong (green), and Aβrev (black) during and after a ten minute dark pulse are indistinguishable. Traces are for a 10 min:10 min:10 min light:dark:light window (indicated by the white and black bars). The ribbons represent ±the SEM. (D) The effects of Aβrev (black), convulsant PTZ (10 mM, orange), Aβshort (blue), and Aβlong (green) on sub-second larval bout structures. Shown are delta pixel movement of one representative larva in each group for ~1 min (see Figure 1—video 1). Unlike PTZ treated larvae, Aβ injected larvae have normal bout structures. Representative larvae were chosen to also highlight that, while overall Aβlong injected larvae are less active, individual animals can have sustained periods of heightened activity. Similarly, individual Aβshort injected animals can exhibit periods of relatively dampened activity. (E) The effects of Aβrev (black), convulsant PTZ (10 mM, orange), Aβshort (blue) and Aβlong (green) on high-frequency bouts (HFB) in a 5 min interval. Each dot represents a single larva. PTZ-induced HFB’s is non-existent or very rare in the other groups (n = 24 for all groups).
Aβ oligomers exert dose-dependent, short-term effects on zebrafish sleep.
(A) Same images from Figure 1B, highlighting the region of interest in the telencephalon for fluorescence intensity measurements in B. Anterior is to the top, dorsal view. (B) Heart-injected fluorescently-tagged Aβ (black) penetrates the brain within 1 hr and peaks in concentration 2–3 hr post-injection. Cyan shows background fluorescence of a negative control. The shaded area shows ± standard deviation from three independent injections. (C) Electron micrographs of Aβ oligomers formed after 24 hr incubation at 4°C, 25°C, and 37°C. Aβarctic was incubated at 25°C for 2 hr as a positive control. The color code is used throughout the main and supplementary figures. Scale bar = 100 nm (D) The Aβshort (blue) and Aβlong (green) have opposing, dose-dependent effects on average waking activity, normalized to Aβrev injections. The error bars represent ±the SEM. doseXprep interaction *p≤0.05, ****p≤0.0001 two-way ANOVA, Fisher’s least significant difference post hoc test. p≤0.001, prep effect (plotted in F). (E) Aβshort (blue) and Aβlong (green) have opposing, dose-dependent effects on sleep. doseXprep interaction, two-way ANOVA, *p≤0.05, Fisher’s least significant difference post hoc test. p≤0.05, prep effect (plotted in G). Based on the data in D-E, 10 nM was chosen as the concentration for all subsequent Aβ injection experiments. (F) The waking activity for each larva in D, normalized to Aβrev injections and plotted to emphasize the significant effect of the preparation irrespective of dose (p<0.001, two-way ANOVA). (G) Sleep for each larva in E normalized to Aβrev injections and plotted to emphasize the significant effect of the preparation (p<0.001, two-way ANOVA). (H) Sleep plot of untreated WT (black), anesthetized only (red), mock injected (blue) and PBS injected (green) fish on a 14 hr:10 hr light:dark cycle (indicated by the white and black bars). The ribbons represent ±the SEM. (I) Sleep for each larva in H (WT (black), anesthetised only (red), mock injected (blue) and PBS injected (green)) shows that there is no statistical difference in sleep due to any of the manipulations (p>0.05, one-way ANOVA). (J) Sleep plot after vehicle injection (PBS, magenta trace) and immediate tracking compared to larvae that had acclimated to the apparatus for 24 hr (black trace). The ribbons represent ±the SEM. Gold stars flag significantly different timepoints (p<0.05, repeated measures ANOVA) and were used to determine the window for calculating the evening-only effects of Aβ injections. (K) Calculating Aβ injection effects across the whole day or only in the evening window (data from Figure 1) has minimal effect on the analysis of Aβshort or Aβlong. The only exception (red shading) is for the reduction in sleep by Aβshort, due to a flooring effect.
Aβ exposure does not increase neuronal cell death and does not alter survival into adulthood.
(A) Dorsal and ventral views of representative 5 dpf larval brains stained for Caspase-3 activation (purple) to map apoptosis. Exposure to the topoisomerase inhibitor camptothecin (CPT, 1 µM), which induces apoptosis, serves as a positive control. DAPI stains nuclei in white for reference. Anterior is to the left. Scale bar = 100 µm (B,C) Quantification of the number of Caspase-3-positive cells after exposure to 1 µM CPT or Aβ oligomer injections (n = 5 brains for each condition, B-dorsal, C-ventral). Only CPT significantly increased apoptosis relative to Aβrev. ns, p>0.05, one-way ANOVA, Tukey’s post-hoc test. (D) Survival curves to adulthood after 5dpf injection of Aβ oligomers. There are no significant differences among survival curves, p>0.05, Kaplan-Meier log rank test.
Aβ-injected larvae recover after 24 hr and do not exhibit seizure-like or sickness behavior.
(A–B) The effects of Aβshort (A) and Aβlong (B) on waking activity (top) and sleep (bottom) return to baseline after 24 hr. Shown in A and B are traces for 48 hr post-injection on a 14 hr:10 hr light:dark cycle (indicated by the white and black bars). The ribbons represent ±the SEM. Plotted on the right are the percent change induced by Aβ relative to Aβrev for day 1 versus day 2, demonstrating that these parameters return to baseline (*p≤0.01, paired t-test). Each line represents a single larva, the thicker line represents the mean ± SEM. (C) Activity traces of Aβshort (blue), Aβlong (green), and Aβrev (black) during and after a ten minute dark pulse are indistinguishable. Traces are for a 10 min:10 min:10 min light:dark:light window (indicated by the white and black bars). The ribbons represent ±the SEM. (D) The effects of Aβrev (black), convulsant PTZ (10 mM, orange), Aβshort (blue), and Aβlong (green) on sub-second larval bout structures. Shown are delta pixel movement of one representative larva in each group for ~1 min (see Figure 1—video 1). Unlike PTZ treated larvae, Aβ injected larvae have normal bout structures. Representative larvae were chosen to also highlight that, while overall Aβlong injected larvae are less active, individual animals can have sustained periods of heightened activity. Similarly, individual Aβshort injected animals can exhibit periods of relatively dampened activity. (E) The effects of Aβrev (black), convulsant PTZ (10 mM, orange), Aβshort (blue) and Aβlong (green) on high-frequency bouts (HFB) in a 5 min interval. Each dot represents a single larva. PTZ-induced HFB’s is non-existent or very rare in the other groups (n = 24 for all groups).
Figure 1—video 1.
Aβ does not induce seizures.
We then assessed how each Aβ preparation affected sleep and wake behavior in zebrafish relative to an Aβ42–1 ‘reverse’ peptide control (Aβrev) using automated video-monitoring (Prober et al., 2006; Rihel et al., 2010). In initial experiments, we determined the appropriate Aβ injection dose by injecting 1 nL of a 1–1000 nM dose series for both Aβshort and Aβlong and assessing subsequent waking activity and sleep, which is defined in zebrafish larvae as a period of inactivity lasting longer than one minute, which are associated with an increased arousal threshold and other features of behavioral sleep (Prober et al., 2006). Unexpectedly, these oligomeric species had opposing behavioral effects (Figure 1—figure supplement 1D–G). Aβshort increased waking activity and decreased sleep relative to Aβrev peptide, while Aβlong decreased waking and increased sleep (prep waking effect, p<0.001; prep sleep effect p<0.05, two-way ANOVA). These effects were generally consistent across doses, although some dose-responses elicited stronger differential effects than others (Figure 1—figure supplement 1D,E), with the maximal difference between the Aβshort and Aβlong preparations at 10 nM (p<0.01 doseXprep interaction, two-way ANOVA). We estimate this dose yields a final concentration that falls within the lower range of physiological concentrations reported for Aβ42 in human CSF of 100 pM-5nM (Bateman et al., 2007). For example, assuming that all injected Aβ goes into the brain, the highest possible concentration would be 1500 pg/ml or 300 pM (45 ng/ml x 1 nl in 30.4 nl brain = 1.5 ng/ml = 1500 pg/ml). At the lower end, assuming equal distribution of Aβ over the whole body yields a final concentration estimate of 150 pg/ml or 30 pM (45 ng/ml x1 nl in 300 nl of body = 150 pg/ml). We therefore continued with 10 nM injections for all subsequent experiments, as it combines the maximal differentially observed behavioral effects between Aβshort and Aβlong with physiologically reasonable concentrations.
Aβ affects sleep and wake in opposing directions as a function of oligomer size and independently of neural death
To explore the effect of Aβ oligomeric size on sleep, we then systematically tested the behavior effects of each Aβ species relative to a Aβrev control for n = 3–5 independent experiments each. As in the dose response experiments, Aβ affected sleep and wake in opposing directions depending on its oligomeric state (Figure 1D–I’). In the day following injection, Aβshort significantly increased waking activity by +12.8% and reduced total sleep relative to Aβrev by 15.5% (Figure 1D–E’). The magnitude of the sleep effect is likely partially masked by a flooring effect due to generally reduced sleep during the day; we therefore favor reporting effect sizes and confidence intervals as recommended (Amrhein et al., 2019; Ho et al., 2019). Indeed, if we were to combine all the additional control Aβshort experiments subsequently reported in this manuscript (n = 160 Aβrevn = 164 Aβshort, see Figure 3G and H), the effect size remains robust at −15.9% and the result is statistically significant (p<0.05, one-way ANOVA). These effects were reversible, as there were no significant differences in sleep (Figure 1E, black bar) or waking activity (Figure 1D, black bar) between Aβshort and reverse peptide in the night following injection, and the behavior of Aβshort-injected larvae returned to baseline levels in the subsequent day (Figure 1—figure supplement 3A).In contrast, while injection of longer Aβ fibers (Aβv_long) had no effect on behavior, (Figure 1H–I’), injection of the intermediate Aβlong oligomers significantly increased sleep during the post-injection day by +47.2% and reduced waking activity by 11.3% (Figure 1F–G’). The increased sleep induced by Aβlong was due to a significant increase in the average number of sleep bouts but not an increase in sleep bout length (Figure 1J), indicating higher sleep initiation is responsible for the change in sleep rather than an increased sleep consolidation. This increased sleep effect by Aβlong was not observed in the night following injection (Figure 1F and G, black bar), and behavior returned to baseline by the following morning (Figure 1—figure supplement 3B).This data is consistent with Aβshort increasing wakefulness and Aβlong decreasing wakefulness and increasing sleep. Additional control experiments ruled out experimental artefacts, as larvae undergoing no treatment, anesthesia only, mock injection, or PBS only injections had indistinguishable effects on sleep/wake (Figure 1—figure supplement 1H–J). Next, we recalculated the behavioral analysis only for the evening period before lights off, when vehicle-injected larvae were statistically indistinguishable from larvae that had been acclimated to the tracking rig for 24 hr (Figure 1—figure supplement 1J). Except for an even more severe flooring effect in the Aβshort injection experiments, the results from evening-only analysis were indistinguishable from calculations across the whole day (Figure 1—figure supplement 1K). We therefore used full day analysis for all subsequent experiments.We next considered if the dual-effects of Aβ on sleep and wake are due to either neuronal damage or generalized toxic effects, such as the induction of seizure, paralysis, or sickness behavior.First, injection with either long or short forms of Aβ had no effect on apoptosis, as detected by staining for activation of Caspase-3 (Figure 1—figure supplement 2A–C). In addition, Aβ injected animals raised to adulthood showed no major differences in their general health or in their survival rates (Figure 1—figure supplement 2D). Moreover, injected animals recovered fully in the long term, returning to baseline sleep and activity levels within 24 hr (Figure 1—figure supplement 3A,B). Second, both Aβshort and Aβlong injected larvae responded normally to salient stimuli such as a light:dark pulse, demonstrating that these larvae were not paralyzed, in a coma, or undergoing sickness behavior (Figure 1—figure supplement 3C). Finally, we considered if the changes in motility in Aβ-injected larvae were seizure-like behaviors. Wild type (WT) zebrafish larvae display ‘burst-and-glide’ movements characterized by single short forward or turn movement followed by a short pause (Figure 1—figure supplement 3D and Figure 1—video 1). In contrast, epileptogenic drugs like the GABA-receptor antagonist PTZ induce electrophysiological and behavioral seizures (Baraban et al., 2005), which are observed as dramatic rearrangements in zebrafish bout structure (Figure 1—figure supplement 3D). The bout structure of Aβrev, Aβshort, and Aβlong injected fish was highly similar to WT behavior (Figure 1—figure supplement 3D,E and Figure 1—video 1), and the high-frequency bouts (HFB) indicative of seizures (Reichert et al., 2019) were only found in PTZ exposed fish but not Aβ injected larvae (Figure 1—figure supplement 3D,E). Together these experiments indicate that exposure to Aβ modulates normal sleep/wake behavior without inducing toxic states.
Figure 1—figure supplement 2.
Aβ exposure does not increase neuronal cell death and does not alter survival into adulthood.
(A) Dorsal and ventral views of representative 5 dpf larval brains stained for Caspase-3 activation (purple) to map apoptosis. Exposure to the topoisomerase inhibitor camptothecin (CPT, 1 µM), which induces apoptosis, serves as a positive control. DAPI stains nuclei in white for reference. Anterior is to the left. Scale bar = 100 µm (B,C) Quantification of the number of Caspase-3-positive cells after exposure to 1 µM CPT or Aβ oligomer injections (n = 5 brains for each condition, B-dorsal, C-ventral). Only CPT significantly increased apoptosis relative to Aβrev. ns, p>0.05, one-way ANOVA, Tukey’s post-hoc test. (D) Survival curves to adulthood after 5dpf injection of Aβ oligomers. There are no significant differences among survival curves, p>0.05, Kaplan-Meier log rank test.
We conclude that the changes in behavior after Aβ exposure are due to acute signalling events and therefore sought to identify the neuronal and molecular substrates through which Aβ signals to modulate sleep/wake behavior.
Aβshort and Aβlong induce opposing changes in neuronal activity and differentially engage sleep-promoting neurons
If Aβ oligomers alter behavior through acute signaling in the brain, the differential effects of Aβshort and Aβlong should be reflected at the level of neuronal activity. In situ hybridization (ISH) for expression of the immediate early gene, c-fos, identified several discrete areas of the larval brain that are upregulated after injection of Aβshort relative to Aβrev, including the posterior hypothalamus and the dorsal and ventral telencephalon (Figure 2A), areas that are also upregulated in mutants with extended wakefulness (Ashlin et al., 2018). Comparing the Aβshort induced c-fos patterns to WT brains collected at zeitgeber time 1 (ZT1, ZT0 = lights ON), when larvae are maximally awake, reveals at least nine populations of c-fos-positive neurons in both Aβshort and waking brains (Figure 2A,C). In contrast, c-fos expression following Aβlong injections was globally dampened relative to Aβrev (Figure 2B) in a manner consistent with the low expression of c-fos in WT brains collected at ZT19, when larvae are maximally asleep (Figure 2C).
Figure 2.
Aβ oligomers differentially alter neuronal activity in the larval zebrafish brain.
(A) As detected by ISH, the immediate early gene c-fos is upregulated in many larval brain areas following Aβshort injection, including the dorsal and ventral telencephalon (tel) and the posterior hypothalamus (black arrowheads), relative to Aβrev control injections. Other upregulated areas in the midbrain and hindbrain are indicated (white arrowheads). hyp- hypothalamus; hb- hindbrain. D = dorsal, p=Posterior, R = Right. n = blind counts of brains with the shown expression pattern/total brains. 24/43 stringently counts only brains with the major areas upregulated. (B) Compared to Aβrev injections, Aβlong oligomers induce less c-fos expression. The Aβrev and Aβlong treated brains were stained longer than in (A) to ensure detection of weaker c-fos expression. n = blind counts of number of brains with the shown expression/total brains. (C) c-fos is upregulated in many larval brain areas at 10 am (ZT1) awake fish, including the dorsal and ventral telencephalon and the posterior hypothalamus (black arrowheads), and other discrete regions of the mid and hindbrain (white arrowheads). c-fos expression is downregulated in later timepoints (ZT13) and is very low in ZT19 brains, when larvae are predominantly asleep. N = 10 fish/timepoint. (D, D’) Brain expression of the neuronal activity correlate pERK/tERK comparing Aβshort (n = 6) to Aβrev (n = 5) injected larvae identified areas upregulated (green) and downregulated (magenta) by Aβshort. Data are shown as a thresholded maximum projection overlaid on the Z-Brain Atlas tERK reference (gray). White arrowheads indicate regions in the ventral telencephalon and posterior hypothalamus that are upregulated similar to c-fos in (A). Dorsal view in (D), lateral view in (D’). (E, E’) pERK/tERK expression after Aβlong injections (n = 7) shows widespread downregulation of neuronal activity (magenta) compared to Aβrev controls (n = 7), consistent with c-fos data in (B). Dorsal view in (E), lateral view in (E’). (F) As detected by ISH, the number and intensity of hypothalamic galanin-positive neurons are downregulated following Aβshort injection and upregulated following Aβlong injection, relative to Aβrev control injections. Representative images from N = 22–24 per condition. (G) Normalized, blinded counts of hypothalamic galanin-positive cell numbers 4–6 hr after Aβshort and Aβlong injections, relative to Aβrev. Error bars indicate ± SEM. The mean difference effect size and 95% confidence interval is plotted at the bottom. **p<0.01, one-way ANOVA. See also Figure 2—source datas 1 and 2.
Aβ oligomers differentially alter neuronal activity in the larval zebrafish brain.
(A) As detected by ISH, the immediate early gene c-fos is upregulated in many larval brain areas following Aβshort injection, including the dorsal and ventral telencephalon (tel) and the posterior hypothalamus (black arrowheads), relative to Aβrev control injections. Other upregulated areas in the midbrain and hindbrain are indicated (white arrowheads). hyp- hypothalamus; hb- hindbrain. D = dorsal, p=Posterior, R = Right. n = blind counts of brains with the shown expression pattern/total brains. 24/43 stringently counts only brains with the major areas upregulated. (B) Compared to Aβrev injections, Aβlong oligomers induce less c-fos expression. The Aβrev and Aβlong treated brains were stained longer than in (A) to ensure detection of weaker c-fos expression. n = blind counts of number of brains with the shown expression/total brains. (C) c-fos is upregulated in many larval brain areas at 10 am (ZT1) awake fish, including the dorsal and ventral telencephalon and the posterior hypothalamus (black arrowheads), and other discrete regions of the mid and hindbrain (white arrowheads). c-fos expression is downregulated in later timepoints (ZT13) and is very low in ZT19 brains, when larvae are predominantly asleep. N = 10 fish/timepoint. (D, D’) Brain expression of the neuronal activity correlate pERK/tERK comparing Aβshort (n = 6) to Aβrev (n = 5) injected larvae identified areas upregulated (green) and downregulated (magenta) by Aβshort. Data are shown as a thresholded maximum projection overlaid on the Z-Brain Atlas tERK reference (gray). White arrowheads indicate regions in the ventral telencephalon and posterior hypothalamus that are upregulated similar to c-fos in (A). Dorsal view in (D), lateral view in (D’). (E, E’) pERK/tERK expression after Aβlong injections (n = 7) shows widespread downregulation of neuronal activity (magenta) compared to Aβrev controls (n = 7), consistent with c-fos data in (B). Dorsal view in (E), lateral view in (E’). (F) As detected by ISH, the number and intensity of hypothalamic galanin-positive neurons are downregulated following Aβshort injection and upregulated following Aβlong injection, relative to Aβrev control injections. Representative images from N = 22–24 per condition. (G) Normalized, blinded counts of hypothalamic galanin-positive cell numbers 4–6 hr after Aβshort and Aβlong injections, relative to Aβrev. Error bars indicate ± SEM. The mean difference effect size and 95% confidence interval is plotted at the bottom. **p<0.01, one-way ANOVA. See also Figure 2—source datas 1 and 2.Immediate early gene expression is an imperfect readout of changes in neuronal activity and brain state, as baseline c-fos is expressed in low amounts in zebrafish and has a relatively slow time course of 15–30 min for transcription of mRNA (Baraban et al., 2005). We therefore also quantified changes in the more rapid (<5 min) neuronal activity marker, phosphorylated ERK (p-ERK), using the larval zebrafish MAP-Mapping technique (Randlett et al., 2015). This method identifies the relative quantitative changes in brain region-specific levels of p-ERK relative to total ERK between Aβ injections and reverse peptide control conditions. Consistent with c-fos induction, Aβshort upregulated P-ERK in the ventral telencephalon and posterior hypothalamus (Figure 2D and D’, Figure 2—source data 1), while Aβlong resulted in a widespread reduction in p-ERK levels throughout most of the brain (Figure 2E and E’, Figure 2—source data 2). These brain activity states are consistent with the induction of wakefulness by Aβshort and sleep by Aβlong.Finally, if the behavioral states induced by Aβ are bona fide sleep/wake states, we reasoned that known zebrafish sleep/wake regulatory neurons should be engaged. Galanin-expressing neurons of the preoptic area and hypothalamus are active and upregulate galanin transcription during zebrafish sleep (Reichert et al., 2019). Similarly, ISH for galanin 4–6 hr post-injection of Aβ oligomers revealed that wake-promoting Aβshort slightly decreased (−6%, blinded counts), while sleep-promoting Aβlong slightly increased (+12%, blinded counts), the number of galanin-positive cells in the hypothalamus compared to Aβrev injected larvae (Figure 2F–G). The differential effects on galanin neurons are consistent with that the induction of wakefulness by Aβshort and sleep by Aβlong.
Aβ binding targets are required for behavioral responses to Aβ
Many candidate Aβ binding partners have been implicated in mediating the signalling effects of Aβ on synapses, with some targets showing preferences for Aβ dimers, such as Adrenergic Receptor β2 (ADRB2) (Wang et al., 2010), or low molecular weight (50–75 kDa) species, such as the Progesterone Membrane Receptor Component 1 (PGRMC1) (Izzo et al., 2014b), while other targets preferentially bind to longer oligomers/protofibrils, such as the Prion Protein (PrP) (Laurén et al., 2009; Nicoll et al., 2013). We therefore used Crispr/Cas9 to make genetic lesions in several zebrafish candidate Aβ receptors, choosing examples with reported affinities for various sized Aβ oligomers (Figure 3—figure supplement 1 and Figure 4—figure supplement 1). We isolated a pgrmc1 allele with a 16 bp deletion that leads to a frameshift and early stop codon that truncates the protein before a conserved Cytochrome b5-like Heme/Steroid binding domain (Figure 3—figure supplement 1A–D). We also isolated an adrb2a allele with an 8 bp deletion that leads to a severely truncated protein lacking all transmembrane domains (Figure 3—figure supplement 1E–G). We also obtained a prp1 double mutant (Fleisch et al., 2013; Leighton et al., 2018) that lacks both zebrafishPrp proteins with conserved Aβ binding sites (Figure 4—figure supplement 1). The third zebrafishprion gene product, Prp3, does not have the conserved Aβ binding domains present in Prp1 and Prp2 (Figure 4—figure supplement 1). Except for a mild increase in daytime sleep in adrb2a-/- mutants (Figure 3—figure supplement 2D'–F’), none of these mutants exhibited changes in baseline sleep and wake on a 14 hr:10 hr light:dark cycle as compared to wild type and heterozygous siblings (Figure 3—figure supplement 2A–F’; Figure 4—figure supplement 2A–F’). Under baseline conditions, we also detected no significant differences in day or night sleep and waking activity in prp1 double mutants compared to prp+/+ siblings generated from either prp1 or prp1 in-crosses (Figure 4—figure supplement 2A–F’). The mild baseline phenotypes allowed us to test the effect of Aβ oligomers in these mutants without complex behavioral confounds.
Figure 3—figure supplement 1.
Crispr/Cas9 targeting of zebrafish adrb2a and pgrmc1.
(A) Human PGRMC1and zebrafish Pgrmc1 contain a conserved Transmembrane (TM) domain (yellow) and a Cytochrome b5-like Heme/Steroid binding domain (blue). (B) Protein alignment of zebrafish Pgrmc1 to human PGRMC1. Identical residues are marked in black, similar residues in grey. (C) Crispr-Cas9 targeting of pgrmc1 generated an allele with a 16 bp deletion. The PAM sequence is indicated in red. (D) The predicted translation of pgrmc1 Δ16 leads to a premature stop codon. (E) Protein alignment of zebrafish Adrb2a and Adrb2b to human ADRB2. Identical residues are marked in black, similar residues in grey. The N-terminal region (pink) is the putative Aβ binding region. The C-terminal region is in green. (F) Crispr-Cas9 targeting of adrb2a generated an allele with an 8 bp deletion. The PAM sequence is indicated in red. (G) The predicted translation of adrb2aΔ8 leads to a premature stop codon lacking all functional domains.
Figure 4—figure supplement 1.
Relationship among zebrafish prp genes with Aβ binding sites.
(A) Schematic comparing zebrafish Prp1-3 proteins to human PrP. SP, signal peptide (dark grey); R, repetitive region (blue); HD, hydrophobic domain (yellow); N, glycosylation sites (black lines); GPI anchor residue (triangle); hydrophobic tail (coral). Aβ oligomer binding regions are shown in red. Breakpoints at repetitive regions indicate length variation. Adapted from Cotto et al., 2005. (B) Protein alignments of zebrafish Prp1, Prp2, and Prp3 proteins to human and mouse PrP proteins. Identical residues are marked in black, similar residues in grey. Aβ oligomer binding sites are indicated in red. The site of truncation mutations in prp1 and prp2 mutants are indicated with a triangle.
Figure 3—figure supplement 2.
adrb2a and pgrmc1 mutations have small effects on baseline sleep:wake parameters.
(A–C’) Sleep and waking activity plots for larvae from pgrmc1 in crosses. (A,A’) show representative 48 hr traces for the indicated genotypes. The ribbon represents ± SEM. (B–C’) Sleep and waking activity for each larva for all genotypes are plotted. The error bars represent the mean ± SEM. There is a trend to decreased waking activity in pgrmc1-/- mutants compared to wild-type siblings. p=0.07, Kruskal-Wallis, Tukey-Kramer post-hoc. (D–F’) Sleep and waking activity plots for larvae from adrb2a in crosses. (D,D’) show 48 hr traces for all three genotypes. The ribbon represents ± SEM. (E–F’) Sleep and waking activity for the day and night are plotted for each larva. The error bars represent the mean ± SEM. Compared to both wild type and heterozygous siblings, adrb2a-/- mutants have increased sleep during the day. *p≤0.05, Kruskal-Wallis, Tukey-Kramer post-hoc.
Figure 4—figure supplement 2.
prp double mutants do not affect baseline sleep or wake across the day:night cycle.
(A-C’) Sleep and waking activity plots for larvae from prp1 in crosses. (A,A’) show representative 48 hr traces for the indicated genotypes. The ribbon represents ± SEM. (B–C’) Sleep and waking activity for each larva for all genotypes are plotted. The error bars represent the mean ± SEM. (D–F’) Sleep and waking activity plots for larvae from prp1 in crosses. (D, D’) show 48 hr traces for all three genotypes. The ribbon represents ± SEM. (E–F’) Sleep and waking activity for the day and night are plotted for each larva. The error bars represent the mean ± SEM.
We first tested the effects of Aβshort injection on mutant behavior. Unlike the wild type controls, neither the adrb2a nor the pgrmc1 mutants increased waking activity (Figure 3A–C and E) or suppressed sleep as observed in wild-type controls (Figure 3A’–C’ and G). Injection of Aβshort into adrb2a-/- animals even significantly increased sleep (+83.7%) instead of reducing it as in wild-type larvae (Figure 3B’ and G). In contrast, Aβshort injected into mutants that lack both zebrafishPrp orthologs (prp1) elicited slightly stronger increases in waking activity and significantly large (−45%) reductions in sleep (Figure 3D,D’, F and H). Thus, the wake-promoting activity of Aβshort requires intact Adrb2a and Pgrmc1 but not functional Prp1 and Prp2.
Figure 3.
Wake induction by Aβshort requires Adrb2a and Pgrmc1, but not the Prion Protein.
(A-D’) Exemplar 24 hr traces comparing the effects of Aβshort oligomers on average waking activity (A-D) and sleep (A’-D’) versus Aβrev injected into wild type (A,A’), adrb2a-/- (B,B’), pgrmc1-/- (C,C’), and prp1-/-;prp2-/- mutants (D,D’). (E-H) The effect of Aβshort relative to Aβrev on normalized waking activity (E and F) and sleep (G and H) during the first day is shown. Each dot represents a single larva normalized to the mean of the Aβrev control, and error bars indicate ± SEM. The mean difference effect size and 95% confidence interval are plotted below. N = the number of larvae. The wake inducing and sleep suppressing effects of Aβshort are absent in (E,G) adrb2a-/- and pgrmc1-/- but enhanced in prp1-/-;prp2-/- mutants (F,H). nsp>0.05, *p≤0.05, **p≤0.01, ***p≤0.0001, ****p≤10–5 one-way ANOVA. Data is pooled from n = 2 independent experiments for adrb2a-/-and pgrmc1-/- and n = 3 for prp1-/-;prp2-/-. See also Figure 3—figure supplements 1 and 2.
(A) Human PGRMC1and zebrafish Pgrmc1 contain a conserved Transmembrane (TM) domain (yellow) and a Cytochrome b5-like Heme/Steroid binding domain (blue). (B) Protein alignment of zebrafish Pgrmc1 to human PGRMC1. Identical residues are marked in black, similar residues in grey. (C) Crispr-Cas9 targeting of pgrmc1 generated an allele with a 16 bp deletion. The PAM sequence is indicated in red. (D) The predicted translation of pgrmc1 Δ16 leads to a premature stop codon. (E) Protein alignment of zebrafish Adrb2a and Adrb2b to human ADRB2. Identical residues are marked in black, similar residues in grey. The N-terminal region (pink) is the putative Aβ binding region. The C-terminal region is in green. (F) Crispr-Cas9 targeting of adrb2a generated an allele with an 8 bp deletion. The PAM sequence is indicated in red. (G) The predicted translation of adrb2aΔ8 leads to a premature stop codon lacking all functional domains.
(A–C’) Sleep and waking activity plots for larvae from pgrmc1 in crosses. (A,A’) show representative 48 hr traces for the indicated genotypes. The ribbon represents ± SEM. (B–C’) Sleep and waking activity for each larva for all genotypes are plotted. The error bars represent the mean ± SEM. There is a trend to decreased waking activity in pgrmc1-/- mutants compared to wild-type siblings. p=0.07, Kruskal-Wallis, Tukey-Kramer post-hoc. (D–F’) Sleep and waking activity plots for larvae from adrb2a in crosses. (D,D’) show 48 hr traces for all three genotypes. The ribbon represents ± SEM. (E–F’) Sleep and waking activity for the day and night are plotted for each larva. The error bars represent the mean ± SEM. Compared to both wild type and heterozygous siblings, adrb2a-/- mutants have increased sleep during the day. *p≤0.05, Kruskal-Wallis, Tukey-Kramer post-hoc.
Wake induction by Aβshort requires Adrb2a and Pgrmc1, but not the Prion Protein.
(A-D’) Exemplar 24 hr traces comparing the effects of Aβshort oligomers on average waking activity (A-D) and sleep (A’-D’) versus Aβrev injected into wild type (A,A’), adrb2a-/- (B,B’), pgrmc1-/- (C,C’), and prp1-/-;prp2-/- mutants (D,D’). (E-H) The effect of Aβshort relative to Aβrev on normalized waking activity (E and F) and sleep (G and H) during the first day is shown. Each dot represents a single larva normalized to the mean of the Aβrev control, and error bars indicate ± SEM. The mean difference effect size and 95% confidence interval are plotted below. N = the number of larvae. The wake inducing and sleep suppressing effects of Aβshort are absent in (E,G) adrb2a-/- and pgrmc1-/- but enhanced in prp1-/-;prp2-/- mutants (F,H). nsp>0.05, *p≤0.05, **p≤0.01, ***p≤0.0001, ****p≤10–5 one-way ANOVA. Data is pooled from n = 2 independent experiments for adrb2a-/-and pgrmc1-/- and n = 3 for prp1-/-;prp2-/-. See also Figure 3—figure supplements 1 and 2.
Crispr/Cas9 targeting of zebrafish adrb2a and pgrmc1.
(A) Human PGRMC1and zebrafishPgrmc1 contain a conserved Transmembrane (TM) domain (yellow) and a Cytochrome b5-like Heme/Steroid binding domain (blue). (B) Protein alignment of zebrafishPgrmc1 to humanPGRMC1. Identical residues are marked in black, similar residues in grey. (C) Crispr-Cas9 targeting of pgrmc1 generated an allele with a 16 bp deletion. The PAM sequence is indicated in red. (D) The predicted translation of pgrmc1 Δ16 leads to a premature stop codon. (E) Protein alignment of zebrafishAdrb2a and Adrb2b to humanADRB2. Identical residues are marked in black, similar residues in grey. The N-terminal region (pink) is the putative Aβ binding region. The C-terminal region is in green. (F) Crispr-Cas9 targeting of adrb2a generated an allele with an 8 bp deletion. The PAM sequence is indicated in red. (G) The predicted translation of adrb2aΔ8 leads to a premature stop codon lacking all functional domains.
adrb2a and pgrmc1 mutations have small effects on baseline sleep:wake parameters.
(A–C’) Sleep and waking activity plots for larvae from pgrmc1 in crosses. (A,A’) show representative 48 hr traces for the indicated genotypes. The ribbon represents ± SEM. (B–C’) Sleep and waking activity for each larva for all genotypes are plotted. The error bars represent the mean ± SEM. There is a trend to decreased waking activity in pgrmc1-/- mutants compared to wild-type siblings. p=0.07, Kruskal-Wallis, Tukey-Kramer post-hoc. (D–F’) Sleep and waking activity plots for larvae from adrb2a in crosses. (D,D’) show 48 hr traces for all three genotypes. The ribbon represents ± SEM. (E–F’) Sleep and waking activity for the day and night are plotted for each larva. The error bars represent the mean ± SEM. Compared to both wild type and heterozygous siblings, adrb2a-/- mutants have increased sleep during the day. *p≤0.05, Kruskal-Wallis, Tukey-Kramer post-hoc.Because the size of oligomeric species in our Aβlong preparation (20–400 nm) falls into the size range that exhibits high-affinity binding to mammalianPrion Protein (PrP) (20–200 nm) and thereby acts to modulate synapses (Gimbel et al., 2010; Laurén et al., 2009; Nicoll et al., 2013; Um et al., 2012), we tested whether PrP is instead required for Aβlong-induced sleep. After injection of Aβlong, prp1 null mutants failed to increase sleep compared to wild-type controls (Figure 4A–D). The modest reduction of wakefulness induced by Aβlong was even reversed in prp1 mutants, with Aβlong instead significantly increasing wakefulness (Figure 4C). Thus, while Prps are not required for the wake-inducing effects of Aβshort, functional Prp1 and Prp2 are essential for sleep induced by Aβlong. Moreover, since prp double mutants have exacerbated wakefulness in response to Aβshort injections, the sleep-inducing Prp pathway is likely co-activated along with the wake-promoting pathway by Aβ to partially dampen the behavioral response of wild-type larvae (Figure 3D and H).
Figure 4.
Sleep induction by Aβlong requires signalling through Prion Protein.
(A-B’) Exemplar 24 hr traces comparing the effects of Aβlong oligomers on average waking activity (A,B) and sleep (A’-B’) versus Aβrev on wild type (A,A’), and prp1 mutant (B,B’) backgrounds. (C-D) The effect of Aβlong relative to Aβrev on normalized waking (C) and sleep (D) on wild type and prp1 mutant backgrounds (mixed prp3 background) during the first day is shown. The activity reducing (C) and sleep promoting (D) effects of Aβlong are blocked in prp1 mutants. **p≤0.01, ****p≤10–5 one-way ANOVA. Data is pooled from n = 3 independent experiments. See also Figure 4—figure supplements 1 and 2.
(A) Schematic comparing zebrafish Prp1-3 proteins to human PrP. SP, signal peptide (dark grey); R, repetitive region (blue); HD, hydrophobic domain (yellow); N, glycosylation sites (black lines); GPI anchor residue (triangle); hydrophobic tail (coral). Aβ oligomer binding regions are shown in red. Breakpoints at repetitive regions indicate length variation. Adapted from Cotto et al., 2005. (B) Protein alignments of zebrafish Prp1, Prp2, and Prp3 proteins to human and mouse PrP proteins. Identical residues are marked in black, similar residues in grey. Aβ oligomer binding sites are indicated in red. The site of truncation mutations in prp1 and prp2 mutants are indicated with a triangle.
(A-C’) Sleep and waking activity plots for larvae from prp1 in crosses. (A,A’) show representative 48 hr traces for the indicated genotypes. The ribbon represents ± SEM. (B–C’) Sleep and waking activity for each larva for all genotypes are plotted. The error bars represent the mean ± SEM. (D–F’) Sleep and waking activity plots for larvae from prp1 in crosses. (D, D’) show 48 hr traces for all three genotypes. The ribbon represents ± SEM. (E–F’) Sleep and waking activity for the day and night are plotted for each larva. The error bars represent the mean ± SEM.
Sleep induction by Aβlong requires signalling through Prion Protein.
(A-B’) Exemplar 24 hr traces comparing the effects of Aβlong oligomers on average waking activity (A,B) and sleep (A’-B’) versus Aβrev on wild type (A,A’), and prp1 mutant (B,B’) backgrounds. (C-D) The effect of Aβlong relative to Aβrev on normalized waking (C) and sleep (D) on wild type and prp1 mutant backgrounds (mixed prp3 background) during the first day is shown. The activity reducing (C) and sleep promoting (D) effects of Aβlong are blocked in prp1 mutants. **p≤0.01, ****p≤10–5 one-way ANOVA. Data is pooled from n = 3 independent experiments. See also Figure 4—figure supplements 1 and 2.
Relationship among zebrafish prp genes with Aβ binding sites.
(A) Schematic comparing zebrafishPrp1-3 proteins to humanPrP. SP, signal peptide (dark grey); R, repetitive region (blue); HD, hydrophobic domain (yellow); N, glycosylation sites (black lines); GPI anchor residue (triangle); hydrophobic tail (coral). Aβ oligomer binding regions are shown in red. Breakpoints at repetitive regions indicate length variation. Adapted from Cotto et al., 2005. (B) Protein alignments of zebrafishPrp1, Prp2, and Prp3 proteins to human and mousePrP proteins. Identical residues are marked in black, similar residues in grey. Aβ oligomer binding sites are indicated in red. The site of truncation mutations in prp1 and prp2 mutants are indicated with a triangle.
prp double mutants do not affect baseline sleep or wake across the day:night cycle.
(A-C’) Sleep and waking activity plots for larvae from prp1 in crosses. (A,A’) show representative 48 hr traces for the indicated genotypes. The ribbon represents ± SEM. (B–C’) Sleep and waking activity for each larva for all genotypes are plotted. The error bars represent the mean ± SEM. (D–F’) Sleep and waking activity plots for larvae from prp1 in crosses. (D, D’) show 48 hr traces for all three genotypes. The ribbon represents ± SEM. (E–F’) Sleep and waking activity for the day and night are plotted for each larva. The error bars represent the mean ± SEM.
Mutants lacking Aβ targets have altered brain activity in response to Aβ consistent with behavioral effects
If Aβshort interacts with Adrb2a and Pgrmc1 to drive changes in wakefulness, the increased neuronal activity we observed in wild-type larvae after Aβshort injections (Figure 2A) should also be abolished in the adrb2a-/- and pgrmc1-/- mutant backgrounds. Consistently, lack of either Adrb2a or Pgrmc1 abolished the neuronal activity-inducing effect of Aβshort (Figure 5A), as detected by in situ hybridization for c-fos. In particular, the neuronal activity observed in the posterior hypothalamus and the dorsal and ventral telencephalon after Aβshort into WT controls was not detected after injection into either adrb2a or pgrmc1 mutants (Figure 5A). This result is consistent with Aβshort failing to induce wakefulness in these mutants. Similarly, although Aβlong dampens neuronal activity when injected into wild-type larvae, Aβlong injections into the prp1 double mutants elicited no reduction in c-fos expression (Figure 5B). Instead, c-fos expression in the telencephalon and hypothalamus was upregulated relative to reverse injected controls (Figure 5B), consistent with the increased behavioral wakefulness observed in the prp mutants (Figure 4C). Together, these data are consistent with Aβshort acutely upregulating neuronal activity and behavioral wakefulness through interactions with Adrb2a and Pgrmc1, while Aβlong interactions with Prp drive increased sleep and a global reduction in neuronal activity.
Figure 5.
Neuronal activity after exposure to Aβ preparations is altered in mutants of Aβ binding targets.
(A) After Aβshort injection into WT larvae (top right), c-fos is detected in many larval brain areas, including the dorsal and ventral telencephalon and posterior hypothalamus (black arrowheads), but not after injection of Aβ reverse controls (left). In contrast, Aβshort injections into either adrb2a (middle right) or pgrmc1 mutants (bottom right) do not induce c-fos expression. The brains in the middle and lower panels were stained longer than the WT (+/+) brains to ensure detection of weaker expression. D = dorsal, p=Posterior. n = blinded counts of brains with expression pattern/total brains. (B) Compared to Aβrev injections, Aβlong oligomers induce less c-fos expression in WT larvae (top panels). In contrast, Aβlong induced relatively increased c-fos expression in the telencephalon and posterior hypothalamus (black arrows) in the prp1 double mutants. These Aβrev and Aβlonginjectedbrains were stained longer to ensure detection of weaker c-fos expression. D = dorsal, p=Posterior.
Neuronal activity after exposure to Aβ preparations is altered in mutants of Aβ binding targets.
(A) After Aβshort injection into WT larvae (top right), c-fos is detected in many larval brain areas, including the dorsal and ventral telencephalon and posterior hypothalamus (black arrowheads), but not after injection of Aβ reverse controls (left). In contrast, Aβshort injections into either adrb2a (middle right) or pgrmc1 mutants (bottom right) do not induce c-fos expression. The brains in the middle and lower panels were stained longer than the WT (+/+) brains to ensure detection of weaker expression. D = dorsal, p=Posterior. n = blinded counts of brains with expression pattern/total brains. (B) Compared to Aβrev injections, Aβlong oligomers induce less c-fos expression in WT larvae (top panels). In contrast, Aβlong induced relatively increased c-fos expression in the telencephalon and posterior hypothalamus (black arrows) in the prp1 double mutants. These Aβrev and Aβlonginjectedbrains were stained longer to ensure detection of weaker c-fos expression. D = dorsal, p=Posterior.
Pharmacological blockade of the Prp-mGluR5-Fyn kinase signaling cascade prevents sleep induction by Aβlong
One of the advantages of using the zebrafish model system is the ability to perturb Aβ signalling cascades with small molecule inhibitors added directly to the water (Kokel et al., 2010; Rihel et al., 2010). To further dissect the Aβlong-PrP sleep-inducing pathway, we focused on disrupting the putative signalling cascade downstream of Aβ-Prp interactions that lead to synaptic changes in neuronal culture (Um et al., 2012; Figure 6A). Consistent with a role for direct Aβlong-Prp interactions in sleep, soaking the larvae in Chicago Sky Blue 6B, a small molecule reported to disrupt Aβ-PrP interactions (Risse et al., 2015), significantly abolished the sleep-inducing effect of Aβlong (Figure 6B and C, S7A and Figure 6—figure supplement 1A,B). Similarly, pharmacological inhibition of either of the putative Aβ-Prp downstream signalling components Metabotropic Glutamate Receptor 5 (mGluR5) or Fyn kinase (Um et al., 2013; Um et al., 2012) significantly blocked the sleep-inducing properties of Aβlong (Figure 6D and E, Figure 6—figure supplement 1C,D). Both the mGluR5 inhibitor MPEP and the Src-kinase inhibitor saracatinib even resulted in significant sleep reductions after exposure to Aβlong. Overall, these results are consistent with the effect of genetic ablation of prp1 and prp2. Thus, both genetic and pharmacological interference with several steps of the Aβ-Prp-mGluR5-Fyn kinase signaling cascade prevents the ability of Aβlong to increase sleep behavior.
Figure 6.
Pharmacological blockade of the Aβlong-Prp-mGluR5-Fyn Kinase signaling cascade prevents increases in sleep.
(A) Schematic showing how Aβ–Prp interactions signal through mGluR5 to activate Fyn kinase, leading to synaptic changes (Nygaard et al., 2014). Small molecules that block each step in the pathway are indicated. (B) Representative traces of sleep behavior after Aβlong versus Aβrev injections in the absence (left) or presence (right) of the Aβ-Prion binding disruptor, Chicago Sky Blue 6B (3 nM). Ribbons represent ± SEM. (C) The effect of Aβlong relative to Aβrev on normalized sleep during the first day in the in the absence or presence of 3 nM Chicago Sky Blue 6B. The data is pooled from n = 2 independent experiments **p≤0.01, one-way ANOVA. (D) Representative traces of sleep behavior after Aβlong versus Aβrev injections in the presence of mGluR5 inhibitor MPEP (5 uM, left) and Fyn Kinase inhibitor saracatinib (300 nM, right). Ribbons represent ± SEM. (E) The effect of Aβlong relative to Aβrev on normalized sleep during the first day in the absence or presence of 5 uM MPEP (left) and 300 nM saracatinib (right). Each dot represents a single larva normalized to the mean Aβrev. Data is pooled from two independent experiments. **p≤0.01, ****p≤10–5 one-way ANOVA. (F) The effect of a 1:1 mixture of Aβlong to Aβshort relative to single injections of Aβrev, Aβshort, and Aβlong on normalized sleep during the first day. The data is pooled from n = 4 independent experiments. (G) A bi-directional model for sleep/wake regulation by Aβ. In wild-type animals (centre), injection of Aβshort species signal through Adrb2a/Pgrmc1 to drive wakefulness while Aβlong oligomers signal via Prp to induce sleep. In mutants that lack Prp (left), only Aβshort species (as shown by the overlapping distributions) remain to inhibit sleep with no residual Aβlong oligomers to stimulate the sleep-inducing pathway to counteract wake-inducing signals. Thus prp1 mutants have enhanced wakefulness in response to Aβ. Conversely, mutants that lack Adrb2a/Pgrmc1 (right), retain only the sleep-promoting Aβ pathway and fail to increase wakefulness in response to Aβshort. See also Figure 6—figure supplement 1.
(A) Representative traces of waking activity after Aβlong versus Aβrev injections in wild type larvae in the absence (left) or presence (right) of the Aβ-Prp binding disruptor, Chicago Sky Blue 6B (3 nM). The data are from the same injections as in Figure 6B. Ribbons represent ± SEM. Light and dark bars indicate the lights ON and lights OFF periods, respectively. (B) The change in normalized waking activity induced by Aβlong versus Aβrev control injections in the absence or presence of 3 nM Chicago Sky Blue 6B. Each dot represents a single larva and error bars indicate ± SEM. The mean difference effect size and 95% confidence interval is plotted at the bottom. N = the number of larvae in each group. **p≤0.01, Kruskal-Wallis, Tukey-Kramer post hoc. (C) Representative traces of sleep behavior after Aβlong versus Aβrev injections (left) in the presence of the mGluR5 inhibitor, MPEP (5 μM) and (right) Src-kinase inhibitor, saracatinib (300 nM). Ribbons represent ± SEM. The data are from the same injections as in Figure 6D. (D) The change in sleep induced by Aβlong relative to Aβrev control injections in the presence of MPEP (5 μM) and (300 nM) saracatinib. *p≤0.05, **p≤0.01, Kruskal-Wallis, Tukey-Kramer post hoc.
Figure 6—figure supplement 1.
Pharmacological blockade of the ABlong-Prp-MgluR5-Fyn Kinase signalling cascade prevents reductions in waking activity.
(A) Representative traces of waking activity after Aβlong versus Aβrev injections in wild type larvae in the absence (left) or presence (right) of the Aβ-Prp binding disruptor, Chicago Sky Blue 6B (3 nM). The data are from the same injections as in Figure 6B. Ribbons represent ± SEM. Light and dark bars indicate the lights ON and lights OFF periods, respectively. (B) The change in normalized waking activity induced by Aβlong versus Aβrev control injections in the absence or presence of 3 nM Chicago Sky Blue 6B. Each dot represents a single larva and error bars indicate ± SEM. The mean difference effect size and 95% confidence interval is plotted at the bottom. N = the number of larvae in each group. **p≤0.01, Kruskal-Wallis, Tukey-Kramer post hoc. (C) Representative traces of sleep behavior after Aβlong versus Aβrev injections (left) in the presence of the mGluR5 inhibitor, MPEP (5 μM) and (right) Src-kinase inhibitor, saracatinib (300 nM). Ribbons represent ± SEM. The data are from the same injections as in Figure 6D. (D) The change in sleep induced by Aβlong relative to Aβrev control injections in the presence of MPEP (5 μM) and (300 nM) saracatinib. *p≤0.05, **p≤0.01, Kruskal-Wallis, Tukey-Kramer post hoc.
Pharmacological blockade of the Aβlong-Prp-mGluR5-Fyn Kinase signaling cascade prevents increases in sleep.
(A) Schematic showing how Aβ–Prp interactions signal through mGluR5 to activate Fyn kinase, leading to synaptic changes (Nygaard et al., 2014). Small molecules that block each step in the pathway are indicated. (B) Representative traces of sleep behavior after Aβlong versus Aβrev injections in the absence (left) or presence (right) of the Aβ-Prion binding disruptor, Chicago Sky Blue 6B (3 nM). Ribbons represent ± SEM. (C) The effect of Aβlong relative to Aβrev on normalized sleep during the first day in the in the absence or presence of 3 nM Chicago Sky Blue 6B. The data is pooled from n = 2 independent experiments **p≤0.01, one-way ANOVA. (D) Representative traces of sleep behavior after Aβlong versus Aβrev injections in the presence of mGluR5 inhibitor MPEP (5 uM, left) and Fyn Kinase inhibitor saracatinib (300 nM, right). Ribbons represent ± SEM. (E) The effect of Aβlong relative to Aβrev on normalized sleep during the first day in the absence or presence of 5 uM MPEP (left) and 300 nM saracatinib (right). Each dot represents a single larva normalized to the mean Aβrev. Data is pooled from two independent experiments. **p≤0.01, ****p≤10–5 one-way ANOVA. (F) The effect of a 1:1 mixture of Aβlong to Aβshort relative to single injections of Aβrev, Aβshort, and Aβlong on normalized sleep during the first day. The data is pooled from n = 4 independent experiments. (G) A bi-directional model for sleep/wake regulation by Aβ. In wild-type animals (centre), injection of Aβshort species signal through Adrb2a/Pgrmc1 to drive wakefulness while Aβlong oligomers signal via Prp to induce sleep. In mutants that lack Prp (left), only Aβshort species (as shown by the overlapping distributions) remain to inhibit sleep with no residual Aβlong oligomers to stimulate the sleep-inducing pathway to counteract wake-inducing signals. Thus prp1 mutants have enhanced wakefulness in response to Aβ. Conversely, mutants that lack Adrb2a/Pgrmc1 (right), retain only the sleep-promoting Aβ pathway and fail to increase wakefulness in response to Aβshort. See also Figure 6—figure supplement 1.
Pharmacological blockade of the ABlong-Prp-MgluR5-Fyn Kinase signalling cascade prevents reductions in waking activity.
(A) Representative traces of waking activity after Aβlong versus Aβrev injections in wild type larvae in the absence (left) or presence (right) of the Aβ-Prp binding disruptor, Chicago Sky Blue 6B (3 nM). The data are from the same injections as in Figure 6B. Ribbons represent ± SEM. Light and dark bars indicate the lights ON and lights OFF periods, respectively. (B) The change in normalized waking activity induced by Aβlong versus Aβrev control injections in the absence or presence of 3 nM Chicago Sky Blue 6B. Each dot represents a single larva and error bars indicate ± SEM. The mean difference effect size and 95% confidence interval is plotted at the bottom. N = the number of larvae in each group. **p≤0.01, Kruskal-Wallis, Tukey-Kramer post hoc. (C) Representative traces of sleep behavior after Aβlong versus Aβrev injections (left) in the presence of the mGluR5 inhibitor, MPEP (5 μM) and (right) Src-kinase inhibitor, saracatinib (300 nM). Ribbons represent ± SEM. The data are from the same injections as in Figure 6D. (D) The change in sleep induced by Aβlong relative to Aβrev control injections in the presence of MPEP (5 μM) and (300 nM) saracatinib. *p≤0.05, **p≤0.01, Kruskal-Wallis, Tukey-Kramer post hoc.
Aβshort and Aβlong affect sleep through distinct neuronal/molecular pathways
Although long and short oligomers require different receptors to affect behavior, they may act within the same neuronal circuit signalling cascade. If so, one phenotype should predominate over the other when the two oligomers are co-administered. Alternatively, oligomers may signal through parallel signalling circuits to bi-directionally modulate sleep in an additive manner. To test this, we co-injected Aβshort and Aβlong in a 1:1 ratio and compared the sleep phenotype to injection of either oligomer alone. As expected, Aβshort alone reduced sleep and Aβlong alone increased sleep. In contrast, co-injection of both Aβshort and Aβlong resulted in an intermediate phenotype that is indistinguishable from control injections of Aβrev (Figure 6F), suggesting that the effects of Aβshort and Aβlong are additive and likely act through distinct neuronal circuits or signaling cascades to modulate sleep.Considering this result is aligned with the genetic and pharmacological data, we propose a bi-directional model of Aβ sleep regulation in which Aβshort and Aβlong act through distinct receptors and neuronal pathways to independently modulate behavioral state (Figure 6G). In this model, the presence of both oligomers leads a balance of signaling through sleep-promoting and sleep-inhibiting pathways, resulting in little or no change in behavior. Tipping the balance from one oligomeric state to the other leads to either the sleep activating or the sleep inhibiting pathway to predominate.
Discussion
Previous studies have suggested that changes in sleep during AD may further accelerate Aβ accumulation and neuronal damage, creating a vicious cycle that leads to further neuronal dysregulation and increased sleep-wake cycle abnormalities (Roh et al., 2012). Our results show that, depending on its oligomeric form, Aβ can acutely increase or decrease sleep and wake behaviors and brain states through behaviorally relevant molecular targets and independently of neuronal cell death. The exogenous application of Aβ oligomers in our experiments limit the conclusions we can draw about endogenous functions of Aβ, which in vivo may present with different structure, local concentrations, and kinetics. However, the bi-directional Aβ modulation of sleep and wakefulness (Figure 6G) predicts that alterations to the relative concentrations of different Aβ oligomeric forms during healthy aging and AD disease progression will have opposing consequences on sleep and wake behavior.
Distinct molecular pathways for Aβ sleep-wake regulation
We found that Aβshort-triggered wakefulness required intact Adrb2a and Pgrmc1, while Aβlong-induced sleep required functional Prp signalling. These data are consistent with a model in which Aβ directly binds to these targets to modulate downstream signaling cascades that ultimately affect neuronal circuits that regulate behavioral state. Our results match well with previous reports demonstrating binding preferences of Aβ dimers, trimers, and 56 kDa oligomers for different targets in vitro. For example, Aβ dimers, which have been detected in the brains of ADpatients ( Vázquez de la Torre et al., 2018), have been shown to directly bind humanADRB2 with high-affinity, causing increased calcium influx and neuronal hyper-activation in rat prefrontal cortical slices (Wang et al., 2010). PGRMC1 can be activated by AD brain extracts (Izzo et al., 2014b) and also has shown preferential binding for 50–75 kDa Aβ species in vitro (Izzo et al., 2014a). Both types of shorter Aβ species that bind to ADRB2 and PGRMC1 fall within the size ranges that induce Adrb2a- and Pgrmc1-dependent wakefulness in zebrafish larvae. Our results are also consistent with studies that have identified PrP as a direct binding partner (Laurén et al., 2009) for longer Aβ-oligomers of 20–200 nm in length (Nicoll et al., 2013), the size range of our sleep-inducing Aβlong preparation. In neuronal culture and slice preparations, longer Aβ-oligomers trigger reduction of synaptic strength (Laurén et al., 2009) via a Prp signaling cascade through mGluR5 and Fyn kinase activation (Um et al., 2012). Similarly, we found that pharmacological blockade of either the direct Aβ-Prp interaction (with Chicago Sky Blue 6B), mGluR5 signalling (with MPEP), Fyn kinase activity (with saracatinib), or by mutation of the Prp receptors prevented the widespread reduction of neuronal activity and increase in sleep that was induced by longer Aβ-oligomers.Although triggering neuronal and behavioral changes through distinct molecular pathways, several aspects of Aβ’s effects on sleep-wake regulation remain to be elucidated. For example, the elimination of either Adrb2a or Pgrmc1 is sufficient to fully prevent Aβshort-induced wakefulness. This suggests that Adrb2a and Pgrmc1 function in the same molecular pathway, and signaling by Aβ on either alone is insufficient to modulate behavior. Not much is known about how these two receptors interact with one another, but at least one study (Roy et al., 2013) has suggested they can directly physically interact. Whether Aβshort binds both receptors to affect behavior or whether one receptor is an obligate component of the other’s ability to transmit Aβ signals is currently unclear. It also remains unclear if the Aβshort-Adrb2a/Pgrmc1 wake pathway and the Aβlong-Prp sleep pathway occur in the same or different sets of neurons to modulate behavior, as these receptors have widespread expression in zebrafish (Cotto et al., 2005; Málaga-Trillo et al., 2009; Steele et al., 2011; Thisse and Thisse, 2004; Wang et al., 2009), although our co-injection experiment suggests they act on parallel neuronal circuits. Numerous wake- and sleep-promoting neuronal populations that could serve as neuronal targets for these signalling cascades to drive changes in behavioral state have been uncovered in zebrafish (Barlow and Rihel, 2017). Future experiments will be needed to tease out the neuronal components involved, for example by replacing functional receptors into candidate neurons in otherwise mutant animals and rescuing the responses to Aβ, or by mutating receptors selectively in cell types with conditional genetics.
Altered Aβ oligomeric ratio—implications for sleep in health and AD
Our model investigates alterations in sleep/wake behavior due to acute changes in exogenously delivered Aβ levels. Thus, it is possible that the sleep/wake effects observed in our study may be different from those observed when Aβ fluctuates over 24 hr or when it is chronically accumulating as in AD. However, our model predicts that alterations to the ratio of Aβ oligomeric forms present in the brain could have differential effects on sleep-wake regulation, as the balance between sleep- and wake- promoting Aβ signals is tilted to favour one pathway over the other (Figure 6G).Given the natural daily increase in Aβ secretion during wakefulness and increased levels of Aβ clearance during sleep (Xie et al., 2013), changes in extracellular Aβ levels could sculpt behavior over the normal 24 hr circadian cycle. As Aβ burden is acutely increased by sleep deprivation (Shokri-Kojori et al., 2018), perturbations to the normal sleep-wake cycle may feedback on behavior through altered Aβ signaling. Other phenomena have been reported to alter Aβ generation and fibrilization over short time-scales. For example, temperature changes in the physiological range (35–42°C) have been reported to significantly affect Aβ oligomerization (Ghavami et al., 2013), suggesting that either the natural daily fluctuation in body temperature (in humans, up to 2°C) or the induction of a fever can promote changes in amyloidogenic Aβ generation (Szaruga et al., 2017). In addition, Aβ can act as an antimicrobial peptide (Kumar et al., 2016; Soscia et al., 2010), and microbial infection can trigger Aβ fibrilization (Eimer et al., 2018). Considering that infection and fever are also potent drivers of sleep (Imeri and Opp, 2009), the sleep-inducing Aβ-Prp signaling pathway we identified here could mediate recovery sleep during illness-- a hypothesis for future investigation.On longer timescales, the amount and type of Aβ oligomeric species (including dimers, cross-linked dimers, trimers, and 56 kDa oligomers) found in healthy brains change across the human life cycle (Lesné et al., 2013) and are heterogeneous and elevated in ADpatients (Izzo et al., 2014a; Kostylev et al., 2015). Although the precise makeup of Aβ species present in healthy and AD brains has remained difficult to quantify (Benilova et al., 2012), some studies have indicated that short (dimers, trimers) Aβ oligomers are more enriched in the early, mild cognitive impairment (MCI) stages of AD, while longer oligomers predominate in the CSF at later clinical stages of AD (De et al., 2019). Similarly, AD progression is associated with increasingly large disruptions in sleep patterns, with patients exhibiting high levels of sleep fragmentation, a lack of circadian rhythm, night-time insomnia and irregular daytime napping throughout the day (Videnovic et al., 2014). One possibility consistent with our data is that sleep symptoms of both normal aging and AD may reflect changes in Aβ burden that lead to an altered balance in sleep- and wake-promoting signaling cascades. These signaling molecules might therefore be potential therapeutic targets for treating disrupted sleep early in AD progression, which may in turn slow disease progression.
Materials and methods
See the Key Resources Table (Appendix 1—key resources table) for details of reagents.
Zebrafish strains and husbandry
Zebrafish (Danio rerio) were raised under standard conditions at 28°C in a 14:10 light:dark cycle and all zebrafish experiments and husbandry followed standard protocols of the UCL Zebrafish Facility. AΒ, TL and AΒxTup wild-type strains were used in this study. prp1 (ua5003/ua5003), prp2 (ua5001/5001), adrb2a (u511/u511) and pgrmc1 (u512/u512) mutants were outcrossed multiple times, and pgrmc1 F2 and adrb2a F2 and later generations were used for behavior. Ethical approval for zebrafish experiments was obtained from the Home Office UK under the Animal Scientific Procedures Act 1986 with Project licence numbers 70/7612 and PA8D4D0E5 to JR.
Aβ preparations
HFIP treated Aβ42 peptide (JPT Peptide Technologies) and Aβ42–1 reversed peptide (Sigma) were dissolved in DMSO, vortexed occasionally for 12 min at room temperature and sonicated for 5 min to obtain 100 μM solution. The stock solutions were aliquoted as 5 μl in individual tubes and are kept are −80°C. 1 μl of the 100 μM stock was diluted in (Phosphate buffered saline) PBS to yield 10 μM solutions which were incubated at 4°C, 25°C or 37°C for 24 hr (Kusumoto et al., 1998; Orbán et al., 2010; Whitcomb et al., 2015). 1 hr before injecting, this stock was diluted to 10 nM using 1:10 serial dilutions in PBS and kept at the respective temperature (4°C, 25°C, 37°C) until injecting.
Transmission Electron Microscopy (TEM)
1 μl of (4°C, 25°C or 37°C incubated) 10 μM Aβ solution was loaded onto formvar/carbon coated 300 mesh grids from Agar Scientific. The grid was washed twice in 20 mM phosphate buffer for 10 s and negatively stained in 2% aqueous uranyl acetate for 30 s. After drying for 2–3 days, samples were imaged using a Phillips TEM. At least five micrographs were used for each condition to blindly measure the length of the Aβ42 oligomeric structures using at least 30 measurements/condition. Using FIJI, 30–50 measurements were taken for each condition by drawing a free-hand line on the fibril, which was then scaled using the scale bar.
Heart injections
Injections were carried out blindly with a Pneumatic PicoPump (WPI) and glass capillary needles (Science Products Gmbh) prepared with a Micropipette Puller (Shutter Instruments). Five dpf larvae were anesthetized using 4% Tricaine (42 mg/L, Sigma) 30 min before injections. Larvae were immobilized in 1.8% low melting point agarose (ThermoFischer) in fish water on their sides on a slide. 1 nL of Aβ (10 nM starting concentration) was injected into the heart chamber of the fish along with a high molecular weight fluorescent dye (2000 kDa dextran-conjugated FITC (3 mg/ml, Sigma). We estimate that 1 nl of a 10 nM Aβ injection into a ~ 3.01 (±0.16) x108 µm3(285–317 nL) 5dpf larva yields a final monomeric brain/CSF concentration of ~28–32 pM. The success of the injection was checked under a standard fluorescent scope by the presence of fluorescence in the heart of the animal. Larvae were transferred to fresh fish water for 20 min to recover from Tricaine and transferred to sleep/wake behavior box. For drug blocking experiments, zebrafish larvae were soaked into 3 nM Chicago Sky Blue 6B (Sigma), 5 μM MPEP (Cambridge Biosciences), or 300 nM Saracatinib (Generon) 1 day before the injections (from 4 to 5 dpf). Fluorescently tagged HiLyte Fluor 647-labeled Aβ42 (Eurogentech LTD) was injected at 10 µM.
Behavioral experiments
Larval zebrafish behavioral experiments were performed and analysed as described (Rihel et al., 2010). Briefly, 5 dpf larvae were transferred to 96 square-well plates and continuously illuminated with IR and white lights from 9 am to 11 pm in a Zebrabox (Viewpoint life sciences) for 24–48 hr. The movement of each larva was measured and duration of movement was recorded with an integration time of 10 s. Data were processed according to Rihel et al., 2010, and statistical tests were performed using MATLAΒ. Mutant larval zebrafish experiments were performed on siblings from heterozygous in-crosses, differing only in the mutation of the specific gene and genotyped at the end of the experiment.
Dark pulse experiments
Larvae were placed in the behavior tracking boxes, and two or three dark pulses for 10 min with a 2–4 hr interval were introduced in four independent experiments. For data analysis, only the dark pulses after the acclimatization period in the late afternoon were combined for each genotype.
In situ hybridization
RNA in situ hybridization (ISH) to detect c-fos and galanin was performed as described (Thisse and Thisse, 2008). Zebrafish larvae were fixed in 4% paraformaldehyde in PBS at 4°C overnight. A template for in vitro transcription was generated by PCR using a reverse primer that contains a T7 promoter sequence 5’-TAATACGACTCACTATAGGG-3’ from cDNA. A digoxygenin (DIG)-labelled antisense RNA probe was synthesized using the DIG labelling kit (Roche) and T7 RNA polymerase according to the manufacturer’s recommendations. The probe was detected with anti-DIG-AP antibody (1:2,000, Roche) and nitro-blue tetrazolium chloride (NBT)/5-bromo-4-chloro-3′-indolyphosphate (BCIP) substrate (Roche) according to published protocols. To detect the differences in expression between the mutant backgrounds and WTs after Aβshort and Aβlong injection, larvae were incubated and washed in the same tubes throughout the ISH procedure to avoid staining artefacts. To do this, larvae from different genotypes were marked by cutting the tail to allow identification after ISH. The brains were exposed by dissection, keeping the brain and spinal cord intact. Embryos were stored in 60% glycerol/PBS for imaging.
Baseline c-fos ISH
Zebrafish larval siblings were kept in 14:10 day/night normal or reverse-cycle incubators. 50 larvae were collected at each time point (ZT1, ZT13, and ZT19) and fixed in 4% paraformaldehyde in PBS overnight. RNA in situ hybridization (ISH) to detect c-fos was performed as described (Thisse and Thisse, 2008).
KASP genotyping
For rapid genotyping of mutant zebrafish harbouring the adrb2aΔ8 and pgrmc1Δ16 alleles, a mutant allele-specific forward primer, a wild-type allele-specific forward primer and a common reverse primer were used (LGC Genomics). The primer sequences were targeted against the following:adrb2a5’TTTTACTACTTACTGTTTGCACAAACCTATGTTAACTGTGTTAACGTGTTTTCTTCTGCTTTTCTTTCTTGATCTCTGTCAGGTCATGGGAAACATAAGGTCCTCAATACCTTATCTGTCCAAACAATACTAATGCCTCCACCAAAAGCGAACTACAGATGACAGTGCTGGGCACACTCATGTCCATTCTTGTCTTGATCATCGTCTTTGGCAATGTGATGGTGATTACAGCCA-3’pgrmc15’ATGGCTGAAGAAGCAGTCGAGCAAACTTCTGGAATCCTTCAGGAAATTTTCACGTCGCCACTGAACATCAGTTTGCTATGTCTTTGTTTGTTCCTACTTTACAAAATCATCCGCGGAGACAAGCCGYTGAGGAGCCGCTGCCCAAACTCAAGAAAAGAGATTTYACTTTAGCAGATCTGCAAGAGTACGATGGACTGAAAAACCCAAGAATCCTGATGGCTGTCAACGGG-3’where [x/-] indicates the indel difference in [WT/mutant]. PCR amplification was performed using KASP Master mix (LGC Genomics) according to the manufacturer’s instructions. Fluorescence was read on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad) and the allelic discrimination plot generated using Bio-Rad CFX Manager Software.
Time lapse confocal microscopy
Three Casper larvae at five dpf were mounted dorsally on a slide in 1.5% agarose. 10 nl of Aβ42-Hi488 was intra-cardiac injected to embryos, control fish were untreated. Fish were imaged for 6 min taking 2-μm-thick stacks through the whole brain using a confocal microscope (Leica SP8). Each fish was imaged every 20 min for 8 hr.
pERK/tERK staining and activity Mapping
Larvae were fixed overnight at 4°C in 4% paraformaldehyde (PFA) and 4% sucrose in PBS; permeabilized 45 min in 0.05% trypsin-EDTA on ice; blocked 6 hr at room temperature (RT) in phosphate buffered saline plus 0.05% Triton (PBT) plus 2% normal goat serum, 1% BSA, and 1% DMSO; and then incubated over sequential nights at 4°C in primary antibodies (Cell Signaling Technology 4370 and 4696; 1:500) and secondary antibodies conjugated with Alexa fluorophores (Life Technologies; 1:200) in PBT plus 1% BSA and 1% DMSO.Larvae were mounted in 1.5% low melt agarose and imaged with a custom two-photon microscope (Bruker; Prairie View software) with a 203 water immersion objective (Olympus).Images were noise filtered using a custom MATLAB (The MathWorks) scripts and registered into Z-Brain using the Computational Morphometry Toolkit (http://www.nitrc.org/projects/cmtk/) with the command string: -a -w -r 0102 l af -X 52 C 8 G 80 R 3 -A ‘–accuracy 0.4 –auto-multi-levels 4’ -W ‘–accuracy 1.6’ -T 4. Registered images were prepared using a custom MATLAB/MIJ (http://bigwww.epfl.ch/sage/soft/mij/) script to downsize, blur, and adjust the maximum brightness of each stack to the top 0.1% of pixel intensities to preserve dynamic range. Activity maps were generated using MATLAB scripts (Randlett et al., 2015).
Crispr/Cas9 mutant generation
The CRISPR design tool CHOPCHOP (http://chopchop.cbu.uib.no) was used to identify a target region in zebrafishadrb2a and pgrmc1 (Labun et al., 2019). The gene-specific oligomers were ordered from Thermofisher including the 5’ and 3’ tags:For adrb2a:5’ATTTAGGTGACACTATAGTTTGGACAGATAAGATCTTGTTTTAGAGCTAGAAATAGCAAG-3’For pgrmc1:5’ATTTAGGTGACACTATATGCAGACTATGGCCCGGTTGGTTTTAGAGCTAGAAATAGCAAG-3’Constant oligomer:5’AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCT AGCTCTAAAAC-3’The constant oligomer and the gene-specific oligomer were annealed on a PCR machine and filled in using T4 DNA polymerase (NEB) (Gagnon et al., 2014). The template was cleaned up using a PCR clean-up column (Qiaquick) and the product was verified on a 2% agarose gel. The sgRNA was transcribed from this DNA template using Ambion MEGAscript SP6 kit (Gagnon et al., 2014). Cas9 mRNA and the purified sgRNA were co-injected into one-cell stage embryos at a concentration of 200 ng and 100 ng per embryo, respectively.
Caspase-3 staining
5dpf larvae that were injected with Aβ oligomers or soaked in Camptothecin (1 µM; Sigma Aldrich) were fixed 5 hr after injection/drug treatment in 4% PFA and kept overnight at 4°C. Brains were dissected and dehydrated the next day and were washed three times in PDT buffer (0.3 Triton-X in PBST with 1% DMSO) and incubated with Caspase-3 antibody (1:500; BD Biosciences) at 4°C. The brains were incubated with Alexa Fluor 568 goat anti-rabbit antibody (1:200; Invitrogen) next day at 4°C overnight and imaged using a confocal microscope.
Statistical analyses
For data analyses, we used a Gardner-Altman estimation plot, which visualizes the effect size and displays an experimental dataset’s complete statistical information (Ho et al., 2019). The bootstrapped 95% confidence interval (CI) was calculated from 10,000 bootstrapped resamples (Ho et al., 2019).Details of statistics used in each panel are also described in the figure legend. For multiple comparisons, data was first tested for normality by the Kogloromov-Smirnov (KS) statistic and extreme outliers were discarded by Grubb’s test (p≤0.01). Those that violated normality were analysed with the non-parametric Kruskal-Wallis test, with either Tukey-Kramer or Bonferonni post hoc testing; otherwise, data was analysed with one-way ANOVA followed by Tukey’s post-hoc testing. For dose response curves, a two-way ANOVA was performed to test the interaction effects between preparation type and dose. For return to baseline statistics, paired t-tests were performed. Survival curves were analysed with Kaplan-Meier log rank test. All statistical tests and graphs were generated in MATLAB (R2015a) loaded with the Statistical Toolbox. Injection and tracking experiments were performed blinded.In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.Acceptance summary:This manuscript provides new insight into mechanisms by which oligomers of amyloid beta might affect sleep. While Alzheimer's Disease is linked to sleep disruption, the nature of the interaction is still unclear. Using a zebrafish model, the authors show that short and long amyloid oligomers interact with different binding partners to decrease or increase sleep respectively.Decision letter after peer review:Thank you for submitting your article "Bi-directional modification of sleep and wake by amyloid beta oligomers" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Michael Eisen as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Erik Musiek (Reviewer #3).The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.The reviewers found the manuscript of interest and considered it a potentially important conceptual advance. However, they had a few concerns, which would need to be addressed for further consideration at eLife:The model is based on intracardiac injection of Aβ, so the phenotypes result from exogenous expression/overexpression. Given this, the authors should refrain from drawing conclusions about endogenous Aβ. At the same time, the manuscript would benefit from minimal characterization of the endogenous molecules. For instance, is there a rhythm of Aβ expression over the sleep:wake cycle?The fish undergo anesthesia and heart perforation and are recorded a few hours later. What are the controls for handling, surgical stress, and confounds of prior anesthesia? On a related note, can the authors exclude toxicity, which could affect motion? They address this point by showing c-fos and ERK staining, but many different patterns are observed and none are compared to staining under baseline sleep:wake conditions. It is also disturbing that the c-fos expression is so widespread. The reversibility of the effect is important and the role of specific molecules is interesting, but these still do not demonstrate impact on wake or sleep regulation per se.Given that AD brains likely have oligomers of all sizes, it would be good to know what happens when short and long oligomers are infused together.Reviewer 1:There is a growing appreciation about the fundamental bidirectional link between sleep and Alzheimer's disease. Here Rihel and colleagues use a zebrafish model coupled to the injection of amyloid beta oligomers (the initiating pathogenic species for AD) to examine the link between Aβ and sleep. They demonstrate that the length of the oligomers determines whether Aβ induces wake (short Aβ) or sleep (long Aβ), providing novel insights into the role of different forms on sleep/wake. Importantly, they extend their findings to reveal novel molecular insights into the mechanisms into how Aβ exerts these sleep/wake effects. Overall, the findings make an important advance that will be of interest to the broad eLife readership.I have one significant concern relating to claims that these studies reveal novel functions for the endogenous Aβ. A key missing experiment in this regard is manipulation of the endogenous Aβ gene/protein (or even assessment of endogenous Ab) and thus it is unclear if exogenous (intracardiac) injection of Aβ faithfully reproduces how an endogenous neuronal pathway would deliver Aβ in terms of location, local concentrations and kinetics.I think the findings are significant and important on their own without having to make this claim which in this case is highly speculative. I would suggest either addressing experimentally or rewording and de-emphasizing this point in the text to make clear the speculative possibilities. In any case, these shortcomings should be more forthrightly noted.Reviewer 2:The use of zebrafish to investigate the role of beta amyloid polymers on sleep/wake regulation is potentially interesting as ADpatients suffer from insomnia. Here Ozcan and colleagues inject oligomers synthesized in vitro into the fish neonate hearts and fish motion was then recorded and used as a proxy for sleep and wake states. The authors found a correlation between the polymer length and the impact on fish motor and brain activity.While the findings are potentially interesting, several points are unclear if concerning to the reviewer:1) First, all the experiments and interpretations rely on overexpression of Aβ polymers, there is no description or investigation in this study of the normal baseline of Aβ accumulation in this species. One would expect to see such data in Figure 1 and Figure 1—figure supplement 1 for example. Is there in fish a night vs. day, sleep vs. night rhythm of Aβ accumulation/expression?2) The fish undergo anesthesia and heart perforation and are recorded a few hours later. How do handling, surgical stress, and confounds of prior anesthesia can be eliminated from "sleep-wake" data interpretation?3) It is hard for the reader to distinguish a specific effect on sleep/wake. Increased or decreased motion could be due to toxicity or specific stimulation of neuronal circuits due to non-physiological presence of exogenous oligomers. The authors try to tackle this issue with c-fos and ERK staining, but Figure 2 shows at least 6 different staining patterns, none of them compared to a sleep/wake baseline of staining. It is quite worrisome to see such a broad over expression of c-fos throughout the brain when Aβ is accumulated. Are the fish having a seizure?Toxicity could lead to reduced motion and even if it's reversible it can still be transient toxicity until oligomers are washed out. Hyperactivity could be due to aspecific overstimulation of neurons as illustrated by c-fos and ERK staining.4) Injections in mutant backgrounds indeed show some specificity in binding/interaction but still it does not demonstrate that the impact is on wake or sleep regulation per se. Again only motion or broad brain staining (at one time point…) are shown. An alternative interpretation is that adrb2a, pgrmc, prp1 can indeed bind Aβ but relay the toxic or aspecific impact of oligomers over expression in a brain that normally does not accumulate such molecules.This study has the potential to be extremely interesting but many controls and demonstration of endogenous Aβ role on sleep-wake cycle are needed.Reviewer 3:The authors report the use of a novel model of intracardiac infusion of Aβ peptides in zebrafish larvae to study the effects of Aβ on sleep and neuronal activity. They provide convincing data that preparations of shorter Aβ oligomers induce neuronal activity and decrease sleep, while longer oligomers suppress neuronal activity and decrease sleep. They then delete known Aβ receptor proteins, and show that the effects of Aβ-short can be block by deletion of Adrb2 and Pgrmc1, while the effects of Aβ-long are blocked by prion protein deletion, or specific drugs. This is a unique system and method for administering Aβ that is quite powerful, and the experiments are rigorous and generally use multiple converging approaches (for instance genetic+pharmacologic) to support their findings. The reversibility of the effect, as well as blockade with specific pharmacological agents suggests that these are not non-specific toxic events. The findings provide a framework with which to potentially test other neurodegenerative proteins (such as a-syn), and to inform similar studies in mammalian systems.1) While the experiments are well performed and the data intrinsically consistent, the applicability to mammals (and humans) is a consideration. Infusion of Aβ into the heart of larvae is a highly artificial system, and events that occur during sudden changes in Aβ levels may be different that those observed when Aβ is chronically present (as in AD). For example, infusion of Aβ peptide into the brain of mice or rats can induce acute, local neurodegeneration that is not observed in APP transgenic mice with chronically elevated Aβ levels. This is a fundamental shortcoming of the model, and there is little that can be done to address it, but it should be perhaps mentioned in the Discussion.2) The implications of this bidirectional effect of short and long oligomers for sleep phenotypes in AD are also a bit unclear, as oligomers of all sizes are likely present in AD brain (though perhaps in different ratios as the disease progresses). It would be helpful to determine which pathway is dominant when both short and long oligomers are infused together, perhaps in different ratios. This is the only experiment I would request.The reviewers found the manuscript of interest and considered it a potentially important conceptual advance. However, they had a few concerns, which would need to be addressed for further consideration at eLife:The model is based on intracardiac injection of Aβ, so the phenotypes result from exogenous expression/overexpression. Given this, the authors should refrain from drawing conclusions about endogenous Aβ.We have modified the text throughout to be clearer about this limitation of our methodology. We address this in our detailed responses to each reviewer’s comments.At the same time, the manuscript would benefit from minimal characterization of the endogenous molecules. For instance, is there a rhythm of Aβ expression over the sleep:wake cycle?This point is extremely difficult to address in zebrafish currently. To our knowledge, a daily rhythm of Aβ has only been detected in measurement of the ISF/CSF (Holth et al., 2019; Kang et al., 2009; Roh et al., 2012), but this rhythm is not detected in whole tissue homogenates in mammals e.g.(Kang et al., 2009). Since the total CSF in one zebrafish larval brain is only ~6.5 nl (Fame et al., 2016), and typical experiments can only remove 1-2 nl of fluid per animal, it was not feasible to extract CSF from 900-5000 larvae to obtain ~5 μl of CSF for a single timepoint analysis, let alone the numbers that would be needed across 24hr. We therefore attempted to detect Aβ using whole tissue homogenates, but the sensitivity even for this method was not sufficient for us to detect Aβ in fish (Author response image 1). Potentially higher sensitivity kits were to be tried, but the global pandemic prevented those from being delivered before we were ordered shut.
Author response image 1.
A Western blot against Aβ42 is unable to detect a band in homogenates from 35-50 zebrafish larvae or from an adult brain.
The fish undergo anesthesia and heart perforation and are recorded a few hours later. What are the controls for handling, surgical stress, and confounds of prior anesthesia?We address this with further experiments, but first wish to communicate that from our perspective the controls for these elements were already a strength of the original submission.To control for the effects of both experimental handling artefacts and exogenous protein confounds, we have included in every experiment a reverse Aβ peptide control that is injected into sibling larvae at the same time as the experimental oligomers, under the same handling and surgical stress and injected at the same concentrations to account for generalized response to proteins, and then tracked the reverse peptide injected and oligomer injected larvae side by side in the same video tracking set-up. Thus, the only difference between the controls and experiments shown in every panel is the inclusion Aβ oligomers vs. a control peptide.Nevertheless, we have added additional experiments with anaesthesia only, mounting only and injection only controls (new Figure 1—figure supplement 1H-I). Our results demonstrate that the initial placement of fish into behavior boxes at the beginning of the video-tracking is responsible for differences between our experimental setup and other tracking experiments (e.g. Figure 1—figure supplement 1J-K) and is not due to heart-injection, anaesthesia, or mounting.On a related note, can the authors exclude toxicity, which could affect motion? They address this point by showing c-fos and ERK staining, but many different patterns are observed and none are compared to staining under baseline sleep:wake conditions. It is also disturbing that the c-fos expression is so widespread. The reversibility of the effect is important and the role of specific molecules is interesting, but these still do not demonstrate impact on wake or sleep regulation per se.To exclude toxicity and to demonstrate the effect of Aβ is on bona-fide sleep and wake, we made 4 new experiments. First, we now compare the c-fos patterns induced by oligomers to untreated larvae across the sleep:wake cycle and show that the c-fos expression pattern of baseline sleep-wake states match the Aβ induced sleep-wake states closely (Figure 2A-C). Second, we show that Aβ engage galanin positive neurons, a known key sleep regulator in fish and humans (Reichert et al., 2019) in a manner consistent with inducing normal sleep and wake states (Figure 2F). Third, we show the bout structures of injected fish are indistinguishable from WT fish and are clearly distinct from seizures (Figure 1—figure supplement 3D-E and Figure 1—video 1). Finally, we show that injected fish respond to acute stimuli the same way as their WT siblings, showing they have rapid state reversibility (Figure 1—figure supplement 3C). All of the new 4 experiments support our interpretation that Aβ-induced behavioral states are bona fide sleep/wake states.Given that AD brains likely have oligomers of all sizes, it would be good to know what happens when short and long oligomers are infused together.We have now added this experiment to Figure 6F. Because short and long oligomers are additive, we conclude that not only do they act on different receptor molecules but also likely act on separate signalling pathways/neurons (e.g. instead of in series with each other) to affect sleep. We have added some discussion about this point.Reviewer 1:[…] I have one significant concern relating to claims that these studies reveal novel functions for the endogenous Aβ. A key missing experiment in this regard is manipulation of the endogenous Aβ gene/protein (or even assessment of endogenous Ab) and thus it is unclear if exogenous (intracardiac) injection of Aβ faithfully reproduces how an endogenous neuronal pathway would deliver Aβ in terms of location, local concentrations and kinetics.We agree that endogenous manipulation of Aβ levels would be ideal, but we know of no experimental methodology that would allow for the acute manipulation of only endogenous Aβ that can also control for oligomer type. For example, genetic manipulation of APP, either through mutation or overexpression of multiple, mutated copies as is done in mouseAD research, will also affect the formation of other APP cleavage products, many of which are known to regulate biological processes, and these effects will accumulate over time, with little to no temporal control over the process. This consideration dictated our methodological choice from the start, and we built in several controls to ensure that the delivery of Aβ would be at very low concentrations and not would damage the brain (heart injections).However, the reviewer raises a critical point about the characterization of endogenous Aβ in zebrafish. To address the point experimentally, we tested three different antibodies to detect endogenous levels of Aβ in zebrafish. We were able to detect very faint bands with the commonly used 4G8 -Aβ antibody (4G8 maps to residues 18–23, conserved between zebrafishAppa and human amyloid beta). However, the sensitivity was not enough to reliably detect endogenous Aβ in either larval or adult zebrafish (Author response image 1). We then ordered a high sensitivity immunoassay kit (V-PLEX Plus Aβ42 Peptide (4G8), which has a dynamic range of 0.516-1271 pg/mL. However, we did not receive it and could not continue our experiments due to the Covid-19 outbreak.This outcome is consistent with the zebrafish literature. There are many papers using zebrafish for AD research; however, there are no reports of detection of endogenous amyloid beta in larval zebrafish. One paper claims to measure endogenous Aβ levels in larval zebrafish using Westerns (Nery et al., 2017), but bands under 20 kDa are not labelled with a protein ladder making it unclear whether these really correspond to the Aβ band at 4 kDa (or dimers and trimers at ~8 and ~12 kDa or some other species). Wilson and Lardelli developed an assay to measure y-secretase activity in zebrafish but used an artificially modified form of App instead of the endogenous zebrafish App (Wilson and Lardelli, 2013). One study of brain-wide proteomic changes in bace-1 mutant vs. wild type zebrafish found that zebrafishAppa and Appb proteins accumulate to higher levels in the bace-1 mutants, suggesting that App processing in the zebrafish is conserved (Hogl et al., 2013). Thus, we believe that detection of zebrafish Aβ is not due to a difference of App processing between species but rather due to the lack of sensitivity of the antibodies.Although a precise quantification of Aβ in the zebrafish brain remains elusive, the Hogl et al., 2013, proteomics analysis does allow for an estimate of zebrafishAppa and Appb protein levels, as well as the amount they are processed by Bace-1. Benchmarking their reported intensity‐Based Absolute Quantification (iBAQ), which scales proportionally to Molar concentration, for Appa and Appb against one of the most abundant fish brain proteins, Ependymin (estimated at 16 mM in fish ECF), allows for a rough estimate of protein concentration. We estimate from this that Appa is present at 1.7µM and Appb at 3.2µM. Since bace-1 mutants accumulate 2-fold more Appa and 3-fold more Appb, this suggests that 50-66% of all zebrafish App is processed by bace-1. Thus, our estimate of 30-300 pM for the oligomer injections is 4-5 orders of magnitude lower than the concentrations of App, consistent with our other estimates. We recognize that this is only an indirect estimate and does not replace the need for measuring endogenous levels of Aβ and its oligomers at various sites in the zebrafish brain. We do believe it reinforces our contention that the concentrations we have injected are very low and reasonable, especially when compared to other typical in vivo and in vitro studies.I think the findings are significant and important on their own without having to make this claim which in this case is highly speculative. I would suggest either addressing experimentally or rewording and de-emphasizing this point in the text to make clear the speculative possibilities. In any case, these shortcomings should be more forthrightly noted.We agree that our findings are important without having to make a strong claim about endogenous processes. We have therefore followed the advice of reviewer 1 and modified our text to tone down the claim that injection of Aβ would reveal endogenous functions of Aβ. Specifically, we changed the following in the text:The Summary now reads: “Our data indicate that Aβ can trigger a bi-directional sleep/wake switch”The Introduction now reads: “the various biological effects of Aβ – in health or disease – remain obscure.”The Introduction now reads: “Aβ may directly modulate sleep-regulatory pathways”The Introduction now reads: “Isolating the specific biological effects of Aβ has been experimentally difficult.”The Discussion now reads: “Although the exogenous application of Aβ oligomers in our experiments limit the conclusions we can draw about endogenous functions of Aβ, which in vivo may present with different structure, local concentrations, and kinetics, our bi-directional Aβ modulation of sleep and wakefulness (Figure 6G) predicts that alterations to the relative concentrations of different Aβ oligomeric forms during healthy aging and AD disease progression may have opposing consequences on sleep and wake behavior.”Finally, we have added the following sentence to the Discussion: “Our model investigates alterations in sleep/wake behavior due to acute changes in exogenously delivered Aβ levels. Thus, it is possible that the sleep/wake effects observed in our study may be different than those observed when Aβ fluctuates over 24hr or when it is chronically accumulating as in AD.”Reviewer 2:The use of zebrafish to investigate the role of beta amyloid polymers on sleep/wake regulation is potentially interesting as ADpatients suffer from insomnia. Here Ozcan and colleagues inject oligomers synthesized in vitro into the fish neonate hearts and fish motion was then recorded and used as a proxy for sleep and wake states. The authors found a correlation between the polymer length and the impact on fish motor and brain activity.We thank the reviewer for finding our work potentially interesting. For clarity, we would like to highlight some points about measuring sleep and wake states in zebrafish. While fish motion is indeed recorded as a proxy for sleep and wake states, it is well established that inactive bouts in larval fish lasting longer than 1 minute have all of the behavioral criteria for being bona fide sleep, including circadian and homeostatic regulation, characteristic sleep postures, and changes in arousal thresholds in response to stimuli across multiple modalities (Barlow and Rihel, 2017; Prober et al., 2006; Rihel et al., 2010; Zhdanova et al., 2001). Importantly, these bouts are regulated by pharmacology, genes, and neural circuits that are conserved from human to fish (Berridge et al., 2012; Carter et al., 2012; Prober et al., 2006; Zhdanova et al., 2001). We would also like to stress that waking activity (during active bouts, how active is a larva—e.g. taking a stroll or running sprints) is experimentally separable from sleep duration (e.g. see (Rihel et al., 2010).While the findings are potentially interesting, several points are unclear if concerning to the reviewer:1) First, all the experiments and interpretations rely on overexpression of Aβ polymers, there is no description or investigation in this study of the normal baseline of Aβ accumulation in this species. One would expect to see such data in Figure 1 and Figure 1—figure supplement 1 for example. Is there in fish a night vs. day, sleep vs. night rhythm of Aβ accumulation/expression?Please see the response to reviewer 1 about the challenges we faced to quantify the level of Aβ in zebrafish. However, even if we were successful in detecting Aβ, it would have been extremely difficult to detect a sleep/wake rhythm of Aβ in zebrafish. To our knowledge, a daily rhythm of Aβ has only been detected in measurement of the ISF/CSF (Holth et al., 2019; Kang et al., 2009; Roh et al., 2012), but this rhythm is not detected in whole tissue homogenates in mammals (e.g.(Kang et al., 2009)). Since the total CSF in one zebrafish larval brain is only ~6.5 nl (Fame et al., 2016), and typical experiments can only remove 1-2 nl of fluid per animal, it was not feasible to extract CSF from 900-5000 larvae to obtain ~5 μl of CSF for a single timepoint analysis, let alone the numbers that would be needed across 24hr.2) The fish undergo anesthesia and heart perforation and are recorded a few hours later. How do handling, surgical stress, and confounds of prior anesthesia can be eliminated from "sleep-wake" data interpretation?To control for the effects of both experimental handling artefacts and exogenous protein confounds, we have included in every experiment a reverse Aβ peptide control that was treated prior to injection the same as the Aβ oligomers, then injected into sibling larvae at the same time as the experimental oligomers, under the same handling and surgical stress, and tracked the reverse peptide injected and oligomer injected larvae side by side in the same boxes. To be clear, in every figure, we display a matching set of reverse peptide controls for comparison. Thus, while we cannot rule out synergistic effects between the Aβ oligomers and stress/anesthesia, the effects we describe must be due to the Aβ oligomer type, because this is the only variable that is different from the controls.Nevertheless, we wanted to know how our handling was affecting the initial behavior. In the original manuscript (Figure 1—figure supplement 1J), we demonstrated that there is a handling effect that lasts for several hours after injection, as seen by comparing PBS injected larvae to larvae placed in the boxes on a prior day. However, we found that our experimental results are unchanged if we omit or include these first 5 hours in our analysis (Figure 1—figure supplement 1K).To further dissect the effects of anaesthesia, mounting/unmounting, and injecting into the heart, we have added additional experiments (anaesthesia only; mounting only; injection only) to the figure (Figure 1—figure supplement 1H-I). Since each of these produce a similar subsequent behavioral effect that is statistically indistinguishable from each other, we conclude the effects on behavior is due to initial placement of larvae into tracking systems at the beginning of the video-tracking and not the heart-injection, anaesthesia, or mounting.3) It is hard for the reader to distinguish a specific effect on sleep/wake. Increased or decreased motion could be due to toxicity or specific stimulation of neuronal circuits due to non-physiological presence of exogenous oligomers. The authors try to tackle this issue with c-fos and ERK staining, but Figure 2 shows at least 6 different staining patterns, none of them compared to a sleep/wake baseline of staining. It is quite worrisome to see such a broad over expression of c-fos throughout the brain when Aβ is accumulated. Are the fish having a seizure?Toxicity could lead to reduced motion and even if it's reversible it can still be transient toxicity until oligomers are washed out. Hyperactivity could be due to aspecific overstimulation of neurons as illustrated by c-fos and ERK staining.We thank the reviewer for raising important points. We now show by 4 new experiments that sleep/wake states induced by Aβ are indeed specific, acutely reversible (e.g. not paralysis/coma) and engage endogenous sleep-wake active neurons and peptides.A) The reviewer points out that the c-fos patterns induced by various Aβ oligomers were not compared to baseline staining during sleep/wake states, making their interpretation more difficult. We now provide c-fos staining for larvae just after light ON (ZT1, or 10am, when they are maximally awake), ZT13, when they are awake an hour before lights OFF, and in the middle of the night (ZT 19, or 4am), when larvae are mostly asleep. This data demonstrates that the Aβshort injected fish brain activity pattern is highly similar to the day (baseline awake) samples collected at ZT1 (Figure 2A, C). Although c-fos is upregulated in many regions, including the posterior hypothalamus and the dorsal and ventral telencephalon, these areas are also upregulated in the awake larvae at ZT1. We now point to 9 discrete populations that are c-fos positive in both sets. This is different to the massive, non-specific upregulation of c-fos seen in seizures (Baraban et al., 2005; Reichert et al., 2019). Similarly, c-fos expression following Aβlong injections, which was globally dampened relative to Aβrev, is consistently low, similar to the low level of c-fos observed in ZT19 sleeping brains.B) The reviewer asks whether Aβ injected fish have seizures. Seizures in zebrafish can be induced with the epileptogenic drug, PTZ, and are readily detected in larval zebrafish from behavioral analysis (Baraban et al., 2005). WT fish display characteristic “burst-and-glide” swimming movements that are characterized by a short single forward or turning movement followed by a short pause. This bout structure is not detected in animals having seizures, which have uncoordinated bout structures. We now provide tracking data and representative videos for Aβrev, Aβshort and Aβlong injected fish, which all have similar bout structures to uninjected wild type larvae (Figure 1—figure supplement 3D, and Figure 1—video 1). They do not display bouts that resemble seizures (compare to the PTZ treated larvae in Figure 1—figure supplement 3D). Following the analysis of Reichert et al., 2019, we quantified seizure behavior as the presence of high frequency bouts (HFB), which are present in 10 mM PTZ exposed larvae but not untreated larvae, and found that HFBs are not detected in Aβ injected fish, as in uninjected controls (Figure 1—figure supplement 3E).C) The reviewer suggests that reduced motion seen after injecting Aβ long could reflect toxicity. To test this, we asked whether the inactive states of these larvae were acutely reversible to the same degree as wild type larvae. Larvae in natural sleep states can be aroused into wakefulness by strong salient stimuli, such as a sudden switch in lighting (Prober et al., 2006). Conversely, animals that are paralyzed, in a coma, or displaying sickness behavior (e.g. various toxic effects) do not easily reverse into waking states. We tested this by using 10 min-dark pulses which induces a characteristic response in WT larvae-- rapidly heightened activity when the lights turn off and reversal to baseline activity when the lights turn on. We observe that Aβshort and Aβlong injected fish show a response indistinguishable from WT siblings (Figure 1—figure supplement 3C), indicating that they have not lost their ability to respond to salient stimuli as might be expected from a state of generalized toxicity.D) If the behavioral states induced by Aβ are indeed real sleep/wake states, oligomers should engage known sleep/wake regulatory pathways. Galanin-expressing neurons are active and galanin expression is increased during sleep in larval zebrafish (Reichert et al., 2019). Thus, we tested whether Aβ injections alter the number of strongly galanin expressing neurons in the hypothalamus, which correlates with sleep state (Reichert et al., 2019). We did in situ hybridization (ISH) for galanin 4-6 hours post-injection. All staining steps for different groups was done in the same tube to eliminate variations in ISH procedure, and subsequent neuron counts were done blindly. Consistent with Aβlong inducing sleep and Aβshort inducing wakefulness, we observed a slight decrease (-6%) in hypothalamic galanin cell number in Aβshort injected fish and a slight increase (+12%) in Aβlong injected animals compared to Aβrev injected fish (Figure 2F-G). From blinded counts, galanin cell numbers between Aβshort and Aβlong injected fish were significantly different from each other (p<0.01, Kruskal-Wallis). We have included represented images and analysis of these galanin changes in Figure 2F-G.4) Injections in mutant backgrounds indeed show some specificity in binding/interaction but still it does not demonstrate that the impact is on wake or sleep regulation per se. Again only motion or broad brain staining (at one time point…) are shown. An alternative interpretation is that adrb2a, pgrmc, prp1 can indeed bind Aβ but relay the toxic or aspecific impact of oligomers over expression in a brain that normally does not accumulate such molecules.Please see our points addressing comment 3 that detail our attempts to demonstrate the impact on sleep/wake regulation per se, especially the induction of wild type sleep/wake c-fos patterns and effects on sleep circuits like galanin. The c-fos patterns induced by oligomers is similar to changes in WT c-fos patterns over 24 hours, which is consistent with an interpretation that oligomers induce normal brain state changes. Additionally, Aβlong engages known sleep-regulatory pathways such as galanin, and galanin expression is reduced in Aβshort injected animals, which is also consistent with these changes being sleep/wake states. Together, these observations suggest that the induced states are not general toxicity but rather acute signalling events.However, we take the point that it is difficult to completely rule out “toxicity” – for example even engagement of sleep circuits could be due to these circuits being the site of “toxic” effects. Even so, given the changes in Aβ composition in Alzheimer’s Disease patients, the demonstration of acute effects on sleep-regulating circuits should still be of wide interest.We have added some more caveats to our interpretation to the Discussion section. Specifically, we added: “Although the exogenous application of Aβ oligomers in our experiments limit the conclusions we can draw about endogenous functions of Aβ, which in vivo may present with different structure, local concentrations, and kinetics, our bi-directional Aβ modulation of sleep and wakefulness (Figure 6G) predicts that alterations to the relative concentrations of different Aβ oligomeric forms during healthy aging and AD disease progression may have opposing consequences on sleep and wake behavior.” and “Our model investigates alterations in sleep/wake behavior due to acute changes in exogenously delivered Aβ levels. Thus, it is possible that the sleep/wake effects observed in our study may be different than those observed when Aβ fluctuates over 24hr or when it is chronically present as in AD”.This study has the potential to be extremely interesting but many controls and demonstration of endogenous Aβ role on sleep-wake cycle are needed.Reviewer 3:[…] 1) While the experiments are well performed and the data intrinsically consistent, the applicability to mammals (and humans) is a consideration. Infusion of Aβ into the heart of larvae is a highly artificial system, and events that occur during sudden changes in Aβ levels may be different that those observed when Aβ is chronically present (as in AD). For example, infusion of Aβ peptide into the brain of mice or rats can induce acute, local neurodegeneration that is not observed in APP transgenic mice with chronically elevated Aβ levels. This is a fundamental shortcoming of the model, and there is little that can be done to address it, but it should be perhaps mentioned in the Discussion.We would like to point out that we cannot detect any increase in neurodegeneration in our study (Figure 1—figure supplement 2), unlike the examples mentioned from injections in the brain of mice and rats. However, we agree our method has shortcomings relative to endogenous manipulations. We have made many changes to the text to make this shortcoming clearer. Please see responses to reviewer 1 and 2 for detailed examples of these changes.2) The implications of this bidirectional effect of short and long oligomers for sleep phenotypes in AD are also a bit unclear, as oligomers of all sizes are likely present in AD brain (though perhaps in different ratios as the disease progresses). It would be helpful to determine which pathway is dominant when both short and long oligomers are infused together, perhaps in different ratios. This is the only experiment I would request.Thank you for the suggestion for this experiment, which we believe also provides insight into whether the Aβshort and Aβlong are signalling onto the same or distinct neuronal circuit pathways or signalling cascades. To address which molecular pathway dominates if both short and long oligomers are present, we injected Aβrev, Aβshort and Aβlong alone or the short and long oligomers mixed in a one to one ratio (Aβmix). Confirming our previous results, the short and long oligomers gave opposite sleep phenotypes (p<0.01, Kruskall-Wallis) in 4 new independent experiments. The sleep-wake phenotype of the Aβmix lies between the Aβshort and Aβlong injected animals (Figure 6F), consistent with an additive effect of the two oligomers. This suggests that the long and short oligomers affect independent neuronal pathways/signalling cascades in addition to acting through distinct receptors (Adrb2a/Pgrmc1 vs. Prp). Future experiments will be needed to map the specific circuits involved, for example by testing whether systematic replacement of the receptors into subsets of neuronal circuits on mutant backgrounds can rescue the effects of Aβ oligomers.We have added the following lines to describe this new data: “Co-injection of both Aβshort and Aβlong resulted in an intermediate phenotype that is indistinguishable from control injections of Aβrev (Figure 6F), suggesting that the effects of Aβshort and Aβlong are additive and likely act through distinct neuronal circuits or signalling cascades to modulate sleep. Considering this result together with the genetic and pharmacological data, we propose a bi-directional model of Aβ sleep regulation in which Aβshort and Aβlong act through distinct receptors and neuronal pathways to independently modulate behavioral state (Figure 6G).”References:Berridge, C.W., Schmeichel, B.E., Espana, R.A., 2012. Noradrenergic modulation of wakefulness/arousal. Sleep Med Rev 16, 187-197.Carter, M.E., Brill, J., Bonnavion, P., Huguenard, J.R., Huerta, R., de Lecea, L., 2012. Mechanism for Hypocretin-mediated sleep-to-wake transitions. Proc Natl Acad Sci U S A 109, E2635-2644.Fame, R.M., Chang, J.T., Hong, A., Aponte-Santiago, N.A., Sive, H., 2016. Directional cerebrospinal fluid movement between brain ventricles in larval zebrafish. Fluids Barriers CNS 13, 11.Hogl, S., van Bebber, F., Dislich, B., Kuhn, P.H., Haass, C., Schmid, B., Lichtenthaler, S.F., 2013. Label-free quantitative analysis of the membrane proteome of Bace1 protease knock-out zebrafish brains. Proteomics 13, 1519-1527.Holth, J.K., Fritschi, S.K., Wang, C., Pedersen, N.P., Cirrito, J.R., Mahan, T.E., Finn, M.B., Manis, M., Geerling, J.C., Fuller, P.M., Lucey, B.P., Holtzman, D.M., 2019. The sleep-wake cycle regulates brain interstitial fluid tau in mice and CSF tau in humans. Science 363, 880-884.Nery, L.R., Silva, N.E., Fonseca, R., Vianna, M.R.M., 2017. Presenilin-1 Targeted Morpholino Induces Cognitive Deficits, Increased Brain Aβ1-42 and Decreased Synaptic Marker PSD-95 in Zebrafish Larvae. Neurochem Res 42, 2959-2967.Reichert, S., Pavon Arocas, O., Rihel, J., 2019. The Neuropeptide Galanin Is Required for Homeostatic Rebound Sleep following Increased Neuronal Activity. Neuron 104, 370-384.e375.Rihel, J., Prober, D.A., Schier, A.F., 2010. Monitoring sleep and arousal in zebrafish. Methods Cell Biol 100, 281-294.Wilson, L., Lardelli, M., 2013. The development of an in vivo gamma-secretase assay using zebrafish embryos. J Alzheimers Dis 36, 521-534.Zhdanova, I.V., Wang, S.Y., Leclair, O.U., Danilova, N.P., 2001. Melatonin promotes sleep-like state in zebrafish. Brain Res 903, 263-268.
Appendix 1—key resources table
Reagent type (species) or resource
Designation
Source or reference
Identifiers
Additional information
Gene (Danio rerio)
prp1
Leighton et al., 2018PMID:29903907
ZFIN ID: ZDB-GENE-041221-2
Gene (Danio rerio)
prp2
Fleisch et al., 2013PMID:23523635
ZFIN ID: ZDB-GENE-041221-3
Gene (Danio rerio)
adrb2a
This paper
ZFIN ID: ZDB-GENE-100414-3
Gene (Danio rerio)
pgrmc1
This paper
ZFIN ID: ZDB-GENE-041114-91
Strain background (Danio rerio)
AB
UCL Fish Facility
Strain background (Danio rerio)
TL
UCL Fish Facility
Strain background (Danio rerio)
ABxTup
UCL Fish Facility
Strain (Danio rerio)
prp1 (ua5003/ua5003) mutant
Leighton et al., 2018PMID:29903907
ZFIN ID: ZDB-ALT-181113-1
Strain (Danio rerio)
prp2 (ua5001/5001) mutant
Leighton et al., 2018PMID:29903907
ZFIN ID: ZDB-ALT-130724-2
Strain (Danio rerio)
adrb2a (u511/u511) mutant
This paper
Allele will be added to ZFIN upon publication acceptance
Strain (Danio rerio)
pgrmc1 (u512/u512) mutant
This paper
Allele will be added to ZFIN upon publication acceptance
Antibody
anti-DIG-AP antibody (Sheep) polyclonal
Roche
Cat # 14608125; RRID:AB_2734716
(1:2000)
Antibody
anti-Active Caspase 3 (Rabbit)
BD Biosciences
Cat # 559565; RRID:AB_397274
(1:500)
Antibody
p44/42 MAP Kinase (L34F12) Mouse mAb
Cell Signaling
Cat # 4696; RRID:AB_390780
(1:500)
Antibody
Phospho-p44/42 MAPK(Erk1/2)(Thr202/Tyr204) Rabbit mAb
Authors: Andrew J Nicoll; Silvia Panico; Darragh B Freir; Daniel Wright; Cassandra Terry; Emmanuel Risse; Caroline E Herron; Tiernan O'Malley; Jonathan D F Wadsworth; Mark A Farrow; Dominic M Walsh; Helen R Saibil; John Collinge Journal: Nat Commun Date: 2013 Impact factor: 14.919
Authors: Owen Randlett; Caroline L Wee; Eva A Naumann; Onyeka Nnaemeka; David Schoppik; James E Fitzgerald; Ruben Portugues; Alix M B Lacoste; Clemens Riegler; Florian Engert; Alexander F Schier Journal: Nat Methods Date: 2015-11 Impact factor: 28.547
Authors: Chitra Lal; Indu Ayappa; Najib Ayas; Andrew E Beaudin; Camilla Hoyos; Clete A Kushida; Marta Kaminska; Anna Mullins; Sharon L Naismith; Ricardo S Osorio; Craig L Phillips; Ankit Parekh; Katie L Stone; Arlener D Turner; Andrew W Varga Journal: Ann Am Thorac Soc Date: 2022-08
Authors: Richard Kanyo; Md Ruhul Amin; Laszlo F Locskai; Danika D Bouvier; Alexandria M Olthuis; W Ted Allison; Declan W Ali Journal: Sci Rep Date: 2021-06-01 Impact factor: 4.379