Kindlin-1, -2, and -3 directly bind integrin β cytoplasmic tails to regulate integrin activation and signaling. Despite their functional significance and links to several diseases, structural information on full-length kindlin proteins remains unknown. Here, we report the crystal structure of human full-length kindlin-3, which reveals a novel homotrimer state. Unlike kindlin-3 monomer, which is the major population in insect and mammalian cell expression systems, kindlin-3 trimer does not bind integrin β cytoplasmic tail as the integrin-binding pocket in the F3 subdomain of 1 protomer is occluded by the pleckstrin homology (PH) domain of another protomer, suggesting that kindlin-3 is auto-inhibited upon trimer formation. This is also supported by functional assays in which kindlin-3 knockout K562 erythroleukemia cells reconstituted with the mutant kindlin-3 containing trimer-disrupting mutations exhibited an increase in integrin-mediated adhesion and spreading on fibronectin compared with those reconstituted with wild-type kindlin-3. Taken together, our findings reveal a novel mechanism of kindlin auto-inhibition that involves its homotrimer formation.
Kindlin-1, -2, and -3 directly bind integrin β cytoplasmic tails to regulate integrin activation and signaling. Despite their functional significance and links to several diseases, structural information on full-length kindlin proteins remains unknown. Here, we report the crystal structure of human full-length kindlin-3, which reveals a novel homotrimer state. Unlike kindlin-3 monomer, which is the major population in insect and mammalian cell expression systems, kindlin-3 trimer does not bind integrin β cytoplasmic tail as the integrin-binding pocket in the F3 subdomain of 1 protomer is occluded by the pleckstrin homology (PH) domain of another protomer, suggesting that kindlin-3 is auto-inhibited upon trimer formation. This is also supported by functional assays in which kindlin-3 knockout K562erythroleukemia cells reconstituted with the mutant kindlin-3 containing trimer-disrupting mutations exhibited an increase in integrin-mediated adhesion and spreading on fibronectin compared with those reconstituted with wild-type kindlin-3. Taken together, our findings reveal a novel mechanism of kindlin auto-inhibition that involves its homotrimer formation.
Integrin-mediated cell–cell and cell–extracellular matrix interactions are crucial for many physiological and pathological processes. Recently, the 4.1 protein, ezrin, radixin and moesin (FERM)-domain–containing kindlin family of proteins has emerged as key players involved in integrin activation. The 3 members are kindlin-1, kindlin-2, and kindlin-3 [1] (Fig 1A). The importance of kindlins is underscored by their link to Kindler syndrome (a disorder within the spectrum of hereditary epidermolytic blistering diseases), leukocyte adhesion deficiency (LAD) III (a hereditary primary immunodeficiency with platelet dysfunction disease), and cancer [2,3]. The sequence homology between kindlin-1 and kindlin-2 is 62%, and those between kindlin-1 and kindlin-3, as well as kindlin-2 and kindlin-3 are 54% and 52%, respectively (44% for all 3). In addition to sequence similarity, all kindlins share atypical FERM domain organization comprising the F1, F2, and F3 subdomains (Fig 1A
and
S1 Fig). Studies have revealed that the poly-lysine-containing loop in the F1 subdomain of kindlins is important for interactions with membrane lipids [4,5]. The F2 subdomain is bisected by a pleckstrin homology (PH) domain, which is involved in binding membrane phosphatidylinositol lipids [6]. In particular, the PH domain has an essential role for kindlin-3 in integrin-mediated B cell adhesion and migration [6]. The F3 subdomain binds to the highly conserved membrane distal NxxY/F motif in the integrin β cytoplasmic tail [7].
Fig 1
Domain organization of kindlins and the overall structure of human full-length kindlin-3.
(a) Domain organization of human kindlins. Domains F0, F1, the F1 inserted loop, domains F2, PH, and F3 are colored pale cyan, blue, aquamarine, deep teal, violet, and purple blue, respectively. Domains and the F1 loop are colored the same throughout the paper. (b) Crystal structure of human full-length kindlin-3. The secondary structure elements are labeled. FERM, 4.1 protein, ezrin, radixin and moesin; NLS, nuclear localization sequence; PH, pleckstrin homology.
Domain organization of kindlins and the overall structure of human full-length kindlin-3.
(a) Domain organization of human kindlins. Domains F0, F1, the F1 inserted loop, domains F2, PH, and F3 are colored pale cyan, blue, aquamarine, deep teal, violet, and purple blue, respectively. Domains and the F1 loop are colored the same throughout the paper. (b) Crystal structure of human full-length kindlin-3. The secondary structure elements are labeled. FERM, 4.1 protein, ezrin, radixin and moesin; NLS, nuclear localization sequence; PH, pleckstrin homology.Integrins are bidirectional signal transducers that mediate both inside-out and outside-in signaling [8]. Integrin activation involves conformational changes [9], which are regulated by interaction between their cytoplasmic tails and cytoplasmic proteins [10]. Kindlins cooperate with talin to positively regulate integrin activation [11]. Kindlins do not directly interact with talin. Instead, both molecules can simultaneously associate with a single integrin β cytoplasmic tail [12]. There are 2 well-defined motifs that are part of a canonical recognition sequence for phosphotyrosine-binding (PTB) domains in the β tails of integrin: the membrane proximal and distal motifs NPxY and NxxY (x: other amino acids), respectively [13]. Talin binds the membrane proximal NPxY motif, whereas kindlin binds the membrane distal NxxY motif [11]. Despite clear functional evidence of kindlins serving as positive regulators of integrin activation, the detailed mechanism remains to be determined.Structural characterization of kindlins would provide important insights into the mechanisms by which kindlins interact with integrins and other binding partners. Despite a number of biochemical and structural studies on kindlins, their full-length structure is still unknown [14-18]. Nonetheless, the structure of a truncated mousekindlin-2 suggests a mechanism by which kindlin-2 forms homodimer that promotes integrin clustering [18]. However, it should be noted the strategy employed in the aforementioned study in order to facilitate crystallization involved removing the PH domain, resulting in artificially linking the 2 sides of the F2 domain as well as deleting the long loop within the F1 domain. These modifications could potentially generate global perturbations in the native kindlin-2 structure, which, in turn, may explain the extremely slow process of dimerization reported in the same study.Here, we report the crystal structure of human full-length kindlin-3. Structural, biophysical, and functional studies provide evidence of kindlin-3 homotrimer population both in vitro and in vivo. Unlike kindlin-3 monomer, the trimer does not bind integrin β1A cytoplasmic tail, suggesting an auto-inhibitory mechanism mediated by trimer formation. This is supported by cell-based functional studies in which cells expressing a mutant kindlin-3 containing disrupting mutations in its trimer interface exhibited overt β1 integrin-mediated cell adhesion and spreading as compared with cells expressing wild-type kindlin-3. Taken together, our data reveal a regulatory mechanism of kindlin-3 involving its trimer formation in integrin signaling.
Results
Structure of kindlin-3 monomer
To gain mechanistic insights into the functions of kindlins, characterization of their full-length structure at atomic resolution is required. Full-length kindlins contain disordered regions that are intrinsically recalcitrant to crystallization. Through extensive and time-consuming efforts of large-scale preparation of highly homogeneous kindlins and subsequent crystallization trials, we were ultimately able to crystallize human full-length kindlin-3 that was expressed as a single monomeric species in bacterial Escherichia coli BL21 system. Consequently, we determined the first structure of human full-length kindlin-3, using the selenine (Se)–single-wavelength anomalous diffraction (SAD) phasing method in combination with Phenix program (Paul Adams, Randy Read, Jane & Dave Richardson, Tom Terwilliger; https://www.phenix-online.org/) [19,20] (Fig 1B, S2–S4 Figs). Unexpectedly, we observed 3 molecules of kindlin-3 forming a homotrimer in an asymmetric unit of the crystal with each protomer dovetailing the next. Each kindlin-3 monomer adopts a cloverleaf-like overall conformation. Except for the F2 domain, which is an α-bundle, the other 4 domains are composed of an α/β barrel. The overall structure of humankindlin-3 monomer is similar to that of truncated mousekindlin-2 [18]; however, the relative positioning of the PH domain can be resolved in the former.The N-terminal F0 domain adopts a ubiquitin-like fold comprising 5 β-stands and 2 helices (α1F0 and α2F0), forming a classical α/β barrel. The F1 domain contains an α/β barrel similar to that of the F0 domain, but it has a long loop (residues 145–228) that is conserved amongst kindlins and functionally important [5]. Except for residues 146–174, most components of this 83-residues-long region can be modeled, with the loop 181–187, the loop 196–207, and its subsequently connecting helices α2F1 and α3F1 interacting with domains PH, F2, and F3, respectively (Fig 1B). Similar to kindlins, talin also contains a F1 loop but shorter in length (31 residues). The positively charged F1 loop binds the negatively charged membrane, which is required for the regulatory functions on integrins [5,21,22]. The F1 domain resides at the center of the kindlin-3 structure with the F1 loop wrapped around its α/β barrel and interacting with other domains. This arrangement may contribute, in part, to the functional difference between kindlins and talin, given the different lengths of their F1 loops [22].The F2 domain is composed of 5 helices that form a compact α-bundle (Fig 1B). The first 2 helices α1F2 and α2F2 cross one another. The remaining 3 helices form an “arch” arrangement and pack against the α2F2 helix. The PH domain, which is inserted between α2F2 and α3F2, comprises 7 β-strands and 2 α-helices. The 7 β-strands are assembled in 2 perpendicular antiparallel β-sheets (the first 4 orthogonal to the remaining 3), which forms a compact β-barrel. One end of this barrel is blocked by the C-terminal α-helices (α1PH and α2PH), and the opposite end of the barrel is rich in positively charged residues and exposed, suggesting that it may be involved in membrane lipid binding [17]. In parallel with these 2 α-helices (α1PH and α2PH), a loop between α2F2 and β1PH was modeled at the N-terminus of the PH domain (Fig 1B). Given the limited electron density map and a lack of a molecular model, this loop appears to be a helix interacting with α2PH to stabilize the entire domain (S5 Fig). The PH domain, widely distributed in other protein families (the 11th most common domain family in human proteome), has been implicated in diverse biological processes, including intracellular signaling, cytoskeleton constitution, intracellular membrane trafficking, and membrane phospholipids modification [23,24].The F3 domain, located at the opposite side of the PH domain, is composed of 2 perpendicular antiparallel β-sheets (β1F3–β4F3 against β5F3–β7F3). These form a β-barrel followed by 2 α-helices that block one end of the barrel. These 2 α-helices are held in position by contacts with both the F3 barrel and the F1 domain (Fig 1B). The F3 domain also contains a PTB-like region involving a cleft surrounded by the last α-helix and the β-sheet (β5F3-β7F3), which is the site for integrin β cytoplasmic tail binding.
Kindlin-3 homotrimer
A salient feature of the kindlin-3 crystal structure is the presence of 3 molecules of kindlin-3 forming a homotrimer in an asymmetric unit (Fig 2A–2C). Kindlin-3 trimer adopts a triangular prism-like structure along the noncrystallographic 3-fold symmetry axis with the following dimensions: an outer-side length of approximately 110 Å, an inner cavity width of approximately 60 Å, and a height of approximately 90 Å. Our crystal structure data of kindlin-3 trimer were obtained using homogenous kindlin-3 monomers expressed and purified from E. coli. To exclude the possibility of crystallization artefacts, it is important to determine whether kindlin-3 trimer exists in eukaryotic cells. To this end, human full-length kindlin-3 was expressed and purified from a clonal isolate of Spodoptera frugiperdaSf21 cells (Sf9) insect cells. We were able to isolate both kindlin-3 monomer and trimer forms, based on their molecular weights calibrated by analytical gel filtration chromatography (Fig 2D). Furthermore, the particle size of a kindlin-3 trimer was approximately 10–12 nm based on negative staining electron microscopy (EM) (S6 Fig), which is comparable in size with that observed in the crystal structure. In addition, we performed disuccinimidyl sulfoxide (DSSO: a mass spectrometry-cleavable crosslinker) crosslinking of kindlin-3 monomer and trimer followed by analytical gel filtration and mass spectrometry (MS) analysis. Compared with DSSO-untreated monomer kindlin-3, DSSO-treated monomer kindlin-3 exhibited a clear band above 200k Da (approximately equivalent to molecular weight of 3 folds of monomeric kindlin-3) on denaturing SDS-PAGE and a clear curve shift forward in analytical gel filtration profile (S7A and S7B Fig). This indicated that monomer kindlin-3 was crosslinked to trimer kindlin-3. In addition, DSSO-treated trimer kindlin-3 also exhibited a clear band above 200 k Da on denaturing SDS-PAGE (S7C Fig). Both 2 crosslinked trimeric bands were sent for MS fragmentation analysis. There were 4 pairs of identified crosslinked residues, among which 3 have very high confidence (S8 Fig
and
S1 Data). Interestingly, 2 lysine residues from α1PH (LASKGR) of one protomer and β2F3’ (KDEILGIANNR) of another protomer were crosslinked by DSSO, and it is consistent with their near distance in the crystal structure of the kindlin-3 trimer. It should be noted that circular dichroism (CD) spectra analysis of kindlin-3 monomers from both expression systems revealed minimal to no difference in terms of secondary structures (S9 Fig).
Fig 2
Trimer formation of kindlin-3.
(a) “Top” view of the kindlin-3 homotrimer. One protomer is represented with domain shown in the same color scheme as in Fig 1A, the other 2 protomers are colored yellow and green, respectively. The prime ′ and double prime ″ refer to protomers B and C (same as below) in the trimer, respectively. (b) “Side” view of the kindlin-3 homotrimer. (c) Close-up view of the detailed interactions along the trimer interface between the PH domain of one protomer and the F3 domain of the neighboring protomer. The H-bonds and salt bridges are shown with dashed lines. (d) Analytical gel filtration chromatography profiles of native and mutant kindlin-3 purified from insect cells. K3FWT monomer (black) and trimer (red): the native kindlin-3 expressed in Sf9 insect cells could be prepared as both monomer and trimer; K3FAFA monomer (blue): the kindlin-3 with triple mutations Q471A, A475F, and S478A in trimer interface exhibits monomeric state. Note that molecular weight markers for analytical gel filtration chromatography are indicated by black arrows. AFA, triple mutations Q471A, A475F and S478A; PH, pleckstrin homology; Sf9, Spodoptera frugiperda 9; WT, wild type.
Trimer formation of kindlin-3.
(a) “Top” view of the kindlin-3 homotrimer. One protomer is represented with domain shown in the same color scheme as in Fig 1A, the other 2 protomers are colored yellow and green, respectively. The prime ′ and double prime ″ refer to protomers B and C (same as below) in the trimer, respectively. (b) “Side” view of the kindlin-3 homotrimer. (c) Close-up view of the detailed interactions along the trimer interface between the PH domain of one protomer and the F3 domain of the neighboring protomer. The H-bonds and salt bridges are shown with dashed lines. (d) Analytical gel filtration chromatography profiles of native and mutant kindlin-3 purified from insect cells. K3FWT monomer (black) and trimer (red): the native kindlin-3 expressed in Sf9 insect cells could be prepared as both monomer and trimer; K3FAFA monomer (blue): the kindlin-3 with triple mutations Q471A, A475F, and S478A in trimer interface exhibits monomeric state. Note that molecular weight markers for analytical gel filtration chromatography are indicated by black arrows. AFA, triple mutations Q471A, A475F and S478A; PH, pleckstrin homology; Sf9, Spodoptera frugiperda 9; WT, wild type.The crystal structure of kindlin-3 trimer also reveals that the additional α2PH helix in the PH domain of protomer A directly wedges into a cleft involving the 2 C-terminal helices (α1F3 and α2F3) and the β-sheet (β5F3-β7F3) in the F3 domain of protomer B, thereby forming extensive contacts. The residues Thr467, Ser468, Val470, Gln471, Ala475, and Ser478 in α2PH of protomer A interact with Ser595, Gln599, Trp600, Ser642, Thr643, Leu656, and Gln659 located in β5F3′ and its preceding loop, and α1F3′ of F3 domain in protomer B (the prime ′ refers to protomer B in the trimer), respectively (Fig 2C). In addition, the C-terminus of α1PH and its subsequent loop in the PH domain pack against the 2 C-terminal helices and their connecting loop in the F3 domain of protomer B, through H-bonding (Gln443 in protomer A with main chain of Phe640 in protomer B) and salt bridge (Arg447 in A-Asp653 in B) interactions (Fig 2C). Therefore, we proposed that the triple mutations Q471A, A475F, and S478A (henceforth referred to as AFA) could disrupt the protomer–protomer interface in kindlin-3 trimer. Indeed, the AFA mutant kindlin-3 forms only monomer in solution when expressed in insect cells (Fig 2D).Following a similar manner of protomer–protomer assembly, the kindlin-3 trimer is formed by head-to-tail interactions between protomers in which the PH domain of protomer A interacts with the F3 domain of protomer B; likewise, the PH domain of protomer B interacts with the F3 domain of protomer C; and finally, the PH domain of protomer C interacts with the F3 domain of protomer A. Based on PISA program (E. Krissinel and K. Henrick; https://www.ebi.ac.uk/pdbe/pisa/picite.html) [25], a total surface of approximately 1,850 Å2 is buried for each protomer in the trimer configuration.
Kindlin-3 trimerization inhibits its integrin-binding ability
The structure of mousekindlin-2 in complex with the integrin β1 cytoplasmic tail provides important insight into the mechanism by which kindlin interacts with integrin [18]. We therefore superimposed the structures of human full-length kindlin-3 and mousekindlin-2-integrin cytoplasmic tail complex. Although the F0, F1, and F3 domains occupy similar 3-D spaces in both structures (Fig 3A), there is a key difference in regard to the F3-integrin-binding pocket (Fig 3B). In the kindlin-3 trimer, the F3-integrin-binding site in each protomer is occluded by the α2PH helix of the PH domain from the neighboring protomer, suggesting that trimer formation could inhibit kindlin-3 binding to integrin β cytoplasmic tails (Fig 3C).
Fig 3
Structural comparison of kindlin-2 and kindlin-3.
(a) Superposition of human full-length kindlin-3 and mouse PH-deleted kindlin-2 (gray) monomers. Note that the frames with dashed line indicate kindlin-2. (b) Superimposition of human kindlin-3 trimer and mouse PH-deleted kindlin-2 dimer. (c) The cleft in F3 subdomain that binds integrin β cytoplasmic tail is occluded by the helix α2PH (PH domain) of neighboring protomer in the kindlin-3 trimer. Integrin β tail bound to mouse PH-deleted kindlin-2 (gray) is colored lime green. PH, pleckstrin homology.
Structural comparison of kindlin-2 and kindlin-3.
(a) Superposition of human full-length kindlin-3 and mouse PH-deleted kindlin-2 (gray) monomers. Note that the frames with dashed line indicate kindlin-2. (b) Superimposition of humankindlin-3 trimer and mouse PH-deleted kindlin-2 dimer. (c) The cleft in F3 subdomain that binds integrin β cytoplasmic tail is occluded by the helix α2PH (PH domain) of neighboring protomer in the kindlin-3 trimer. Integrin β tail bound to mouse PH-deleted kindlin-2 (gray) is colored lime green. PH, pleckstrin homology.We therefore performed isothermal titration calorimetry (ITC) measurements to determine the binding affinities of integrin β1 cytoplasmic tail for kindlin-3 monomer and trimer that were purified from the insect cell expression systems, respectively. Although kindlin-3 monomer binds, albeit weakly with the dissociation constant (Kd) of approximately 200 μM, with integrin β1 cytoplasmic tail, kindlin-3 trimer does not show any detectable binding (S10A and S10B Fig). The weak binding between kindlin-3 monomer and integrin β1 cytoplasmic tail is unlikely to be the result of nonoptimal ITC experimental conditions because ITC measurements using insect cell–purified human full-length kindlin-2 (monomer) and integrin β1 cytoplasmic tail yielded a Kd of approximately 13.4 μM (S10C Fig). Furthermore, the binding affinity between kindlin-3 monomer and integrin β1 cytoplasmic tail is consistent with that reported in a previous study [5], suggesting that the binding affinities of kindlins for the same integrin cytoplasmic tail are not similar. In addition, kindlin-2 trimer did not show any detectable binding with integrin β1 cytoplasmic tail (S10D Fig). Taken together, these data provide evidence that kindlin-3 trimer does not bind integrin β1 cytoplasmic tail.
Trimer formation in kindlins
Although the insect cell expression system is a widely used eukaryotic system to overexpress mammalian proteins for structural and functional studies, we extended the study to determine whether kindlin-3 trimer can be detected in a mammalian cell expression system. To this end, we generated a stable humanembryonic kidney (HEK) 293 cell line that expressed N-terminal His6-tagged human full-length kindlin-3 containing a 3xGly linker, and purified kindlin-3 from these cells. In line with our previous data, we detected both trimer and monomer populations of kindlin-3 based on analytical gel filtration chromatography (Fig 4A). These data further validate the existence of kindlin-3 trimer in eukaryotic cells.
Fig 4
Trimer formation in kindlins.
(a) Analytical gel filtration chromatography of kindlin-3 expressed and purified from HEK 293 mammalian cells indicates both monomeric and trimeric states in solution. (b) Analytical gel filtration chromatography of kindlin-2 expressed and purified from Sf9 insect cells indicates both monomeric and trimeric states in solution. (c) SEC-MALS analysis of kindlin-2 and kindlin-3 expressed and purified from Sf9 insect cells. Consistent with the analytical gel filtration chromatography, kindlin-3 forms both monomer (blue) and trimer (red) in solution. Likewise, kindlin-2 also forms monomer (pink) and trimer (purple). All samples were analyzed by SDS-PAGE before loading into the column. HEK, human embryonic kidney; SEC-MALS, size-exclusion chromatography multiangle light scattering; Sf9, Spodoptera frugiperda 9.
Trimer formation in kindlins.
(a) Analytical gel filtration chromatography of kindlin-3 expressed and purified from HEK 293mammalian cells indicates both monomeric and trimeric states in solution. (b) Analytical gel filtration chromatography of kindlin-2 expressed and purified from Sf9 insect cells indicates both monomeric and trimeric states in solution. (c) SEC-MALS analysis of kindlin-2 and kindlin-3 expressed and purified from Sf9 insect cells. Consistent with the analytical gel filtration chromatography, kindlin-3 forms both monomer (blue) and trimer (red) in solution. Likewise, kindlin-2 also forms monomer (pink) and trimer (purple). All samples were analyzed by SDS-PAGE before loading into the column. HEK, humanembryonic kidney; SEC-MALS, size-exclusion chromatography multiangle light scattering; Sf9, Spodoptera frugiperda 9.It is also of interest to determine if kindlin-1 and kindlin-2 can form homotrimers as well. We expressed and purified human full-length kindlin-2 using the insect cell expression system. Similar to kindlin-3, we detected both monomer and trimer populations of kindlin-2 based on analytical gel filtration chromatography (Fig 4B). Furthermore, the 2 populations (monomer and trimer) of kindlin-2 together with that of kindlin-3 were verified by size-exclusion chromatography multiangle light scattering (SEC-MALS) analysis (Fig 4C). These data suggest that trimer formation may be a conserved mechanism in kindlins.In our analyses, we did not detect kindlin-3 or kindlin-2 homodimers. Given that kindlin-2 has been proposed to form a dimer that promotes integrin clustering [18], we compared the interface between protomers in mousekindlin-2 and humankindlin-3 crystal structures. The dimer interface of mousekindlin-2, in which the PH domain was removed and the 2 halves of F2 domain were artificially linked, involves an equivalent helical bundle from F2 of protomer A in the kindlin-3 structure (Fig 3A). This suggests that in full-length kindlins, the assembly of a dimer via the F2 interface may be severely limited by steric clashes (Fig 3B). In accordance, dimer formation of PH-deleted mousekindlin-2 in solution was reported to occur only after several days [18]. Using similar conditions, dimer formation of human full-length kindlin-2 was also not detected by us, implying that the presence of the PH domain possibly interferes with dimer formation. However, given that the PH domain is linked to the F2 domain via flexible loops, the possibility that the PH domain orients away allowing dimer formation via the F2 interface cannot be completely ruled out, and perhaps more studies are needed.It should also be noted that the humankindlin-3 structure reveals a similar F2 fold as the one observed in talin and the monomeric mousekindlin-2 resulting from further mutations that prevent dimer formation (S11 Fig) but different than that of dimeric kindlin-2 (Fig 3B) [18,22], implying a conserved fold of the F2 domain in kindlins and talin, as well as an important role of the inserted PH domain in F2 in the oligomerization of kindlins.
Kindlin-3 trimerization in cells
To exclude the possible artefacts arising from protein aggregation under high concentration conditions in vitro, we further designed a bead-based bimolecular fluorescence complementation (BiFc) approach to detect kindlin-3 trimerization in small scale in transfected cells. Briefly, HEK 293T cells were transfected with 3 expression plasmids. One plasmid contains HA-tagged kindlin-3 cDNA, and each of the other 2 contains cDNAs of either the N-terminal half (M1-A155) or C-terminal half (D156-K239) of enhanced yellow fluorescent protein (eYFP) fused to the N-terminus of kindlin-3. In order to allow the 2 halves of the eYFP to come together forming an intact eYFP in the kindlin-3 trimer, we included a 12 Gly linker between each half of the eYFP and kindlin-3 to span the approximately 110-Å distance separating the F0 domains in the trimer configuration (Fig 5A). In cells transfected with all 3 plasmids, there will be kindlin-3 trimers with different combinations of each fusion protein, but only the combination consisting of one molecule each of HA-kindlin-3, N-eYFP-kindlin-3, and C-eYFP-kindlin-3 will fluoresce under excitation after immunoprecipitation. We also generated relevant expression plasmids for kindlin-3 wild type (WT) and 2 variants to demonstrate trimer formation via the binding interface determined from our crystal structure (Fig 5B). The AFA mutant was designed to potentially disrupt the protomer–protomer interface. The F3 domain–deleted (F3Δ) mutant was chosen because F3 is required for trimer formation through its interaction with the PH domain. Interestingly, the highest fluorescence signal was detected with WT kindlin-3, followed by the AFA and F3Δ mutants captured nanobeads, and the difference was statistically significant (Fig 5C). We inferred that AFA mutations diminished kindlin-3 trimer formation, but the disruption was lesser than that caused by F3 domain deletion. We noted that there is still fluorescence signal detected in the F3Δ sample. This could be due to nonspecific background binding to the beads and low level of self-association between N-eYFP and C-eYFP (a common observation in BiFc experiments) independent of kindlin-3 trimer formation.
Fig 5
Kindlin-3 trimerization in cells.
(a) An illustration of the design and analysis of kindlin-3 trimerization in cells using bead-based BiFc flow cytometry. The system made use of 3 expression plasmids, namely, HA-kindlin-3, N-eYFP(12G)-kindlin-3, and C-eYFP(12G)-kindlin-3. When an HEK 293T cell is transfected with all 3 expression plasmids, there will be trimers that have different combinations of monomers with different tags (i.e., HA, N-eYFP, C-eYFP). One of these combinations will contain one molecule each of HA-kindlin-3, N-eYFP(12G)-kindlin-3, and C-eYFP(12G)-kindlin-3. This combination can also facilitate BiFc via coming together of N-eYFP and C-eYFP. In order to detect this trimer population, immunoprecipitation can be performed using anti-HA antibody and protein G nanobeads, and YFP fluorescence can be detected by flow cytometry analysis. (b) Western blotting of 293T cells cotransfected with all 3 plasmids. Three protein bands corresponding to N-eYFP(12G)-kindlin-3, C-eYFP(12G)-kindlin-3, and HA-kindlin-3 were detected using anti-kindlin-3 antibody. (c) Left panel. Immunoprecipitation of kindlin-3 trimer using anti-HA antibody and protein G nanobeads followed by flow cytometry analysis to detect YFP signal as a result of BiFc. Red histogram: control IgG. Blue histogram: anti-HA antibody. EI = % GP × GM. Right panel. Expression index plot of 3 independent experiments. Two-tailed unpaired t test was performed. Additional information on numerical values and data was provided in S2 Data. AFA, triple mutations Q471A, A475F, and S478A; BiFc, bimolecular fluorescence complementation; EI, expression index; eYFP, enhanced yellow fluorescent protein; F3Δ, F3 domain deleted; GFP, green fluorescent protein; GM, geo-mean fluorescence; GP, percent gated positive; HA, human influenza hemagglutinin; HEK, human embryonic kidney; IgG, immunoglobulin G; I.P., immunoprecipitation; YFP, yellow fluorescent protein.
Kindlin-3 trimerization in cells.
(a) An illustration of the design and analysis of kindlin-3 trimerization in cells using bead-based BiFc flow cytometry. The system made use of 3 expression plasmids, namely, HA-kindlin-3, N-eYFP(12G)-kindlin-3, and C-eYFP(12G)-kindlin-3. When an HEK 293T cell is transfected with all 3 expression plasmids, there will be trimers that have different combinations of monomers with different tags (i.e., HA, N-eYFP, C-eYFP). One of these combinations will contain one molecule each of HA-kindlin-3, N-eYFP(12G)-kindlin-3, and C-eYFP(12G)-kindlin-3. This combination can also facilitate BiFc via coming together of N-eYFP and C-eYFP. In order to detect this trimer population, immunoprecipitation can be performed using anti-HA antibody and protein G nanobeads, and YFP fluorescence can be detected by flow cytometry analysis. (b) Western blotting of 293T cells cotransfected with all 3 plasmids. Three protein bands corresponding to N-eYFP(12G)-kindlin-3, C-eYFP(12G)-kindlin-3, and HA-kindlin-3 were detected using anti-kindlin-3 antibody. (c) Left panel. Immunoprecipitation of kindlin-3 trimer using anti-HA antibody and protein G nanobeads followed by flow cytometry analysis to detect YFP signal as a result of BiFc. Red histogram: control IgG. Blue histogram: anti-HA antibody. EI = % GP × GM. Right panel. Expression index plot of 3 independent experiments. Two-tailed unpaired t test was performed. Additional information on numerical values and data was provided in S2 Data. AFA, triple mutations Q471A, A475F, and S478A; BiFc, bimolecular fluorescence complementation; EI, expression index; eYFP, enhanced yellow fluorescent protein; F3Δ, F3 domain deleted; GFP, green fluorescent protein; GM, geo-mean fluorescence; GP, percent gated positive; HA, human influenza hemagglutinin; HEK, humanembryonic kidney; IgG, immunoglobulin G; I.P., immunoprecipitation; YFP, yellow fluorescent protein.
Disruption of kindlin-3 trimerization exhibits overt integrin activation and increased cell spreading
Our results suggest that, contrary to that of kindlin-2 [18], kindlin-3 oligomerization inhibits its function in terms of binding integrin β cytoplasmic tails. We reasoned that if kindlin-3 trimer represents an auto-inhibited state that is in dynamic equilibrium, as a mode of regulation, with kindlin-3 monomer in cells, then preventing trimer formation could induce overt integrin activation. To test this hypothesis, we performed functional studies in mammalian cells. The erythroleukemiaK562 cell line can endogenously express kindlin-3 and integrin α5β1, and we have shown previously that silencing kindlin-3 expression in K562 cells diminished integrin α5β1-mediated binding to fibronectin [26]. K562 cells also do not express kindlin-1 and kindlin-2, which are useful for interrogating the functions solely attributed by kindlin-3. In order to exclude any contribution from endogenous kindlin-3, CRISPR-Cas9n kindlin-3 gene knockout (KO) was performed, and the expression of kindlin-3 was verified by immunoblotting (Fig 6A). Next, kindlin-3 KO K562 cells were transfected and complemented with either WT (K3 WT) or AFA mutant (K3 AFA) kindlin-3 (Fig 6A). K562 cells expressed primarily β1 integrins. Based on flow cytometry analysis using a β1 integrin-specific monoclonal antibody (mAb), we showed that there was no marked difference in β1 integrin expression between K562 (K3 WT) and K562 (K3 AFA) cells (Fig 6B). Hence, any difference in β1 integrin-mediated cell adhesion and spreading between these cells is not attributed to a difference in β1 integrin expression. We then performed shear flow ligand-binding assay to determine the adhesive properties of these cells on fibronectin. As expected, kindlin-3 KO cells adhered less onto fibronectin compared with WT K562 cells even in the presence of exogenous activating agent MnCl2. Notably, K3 AFA cells adhered significantly higher than that of K3 WT cells with or without MnCl2, suggesting overt β1 integrin activation (Fig 6C). In line with this observation, K3 AFA cells also exhibited increased cell spreading on fibronectin compared with K3 WT cells (Fig 6D). Taken together, these results suggest that kindlin-3 exists as both monomers and trimers in mammalian cells, and that the latter represents an auto-inhibited state. Shifting the equilibrium between these 2 populations of kindlin-3 may be an important regulatory step in kindlin-3 function.
Fig 6
Disruption of kindlin-3 trimerization exhibits overt integrin activation and increased cell spreading.
(a) Western blot analysis of kindlin-3 expression in WT K562 cells (K562-WT), kindlin-3 CRISPR-Cas9n KO cells (K562-K3 KO), and in the cells reconstituted with WT kindlin-3 (K3 WT) and AFA mutant kindlin-3 (K3 AFA). GAPDH was used as loading control. (b) Flow cytometry analysis of integrin β1 expression in aforementioned cells. Red histogram: control IgG. Blue histogram: anti-integrin β1 antibody. (c) Shear flow fibronectin-binding assay at a shear stress of 0.3 dyn/cm2. Mn2+: 0.5 mM MnCl2. Each data point is the mean ± standard deviation from at least 3 independent experiments. Two-tailed unpaired t test was performed. *p < 0.05. (d) Fluorescence microscope images of cells on fibronectin. Green: F-actin staining with Alexa Fluor 488 phalloidin. Blue: nuclei staining with DAPI. Scale bar: 50 μM. Additional information on numerical values and data was provided in S2 Data. AFA, triple mutations Q471A, A475F, and S478A; EI, expression index; F-actin, filamentous actin; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; GM, geo-mean fluorescence; GP, percent gated positive; IgG, immunoglobulin G; KO, knockout; WT, wild type.
Disruption of kindlin-3 trimerization exhibits overt integrin activation and increased cell spreading.
(a) Western blot analysis of kindlin-3 expression in WT K562 cells (K562-WT), kindlin-3 CRISPR-Cas9n KO cells (K562-K3 KO), and in the cells reconstituted with WT kindlin-3 (K3 WT) and AFA mutant kindlin-3 (K3 AFA). GAPDH was used as loading control. (b) Flow cytometry analysis of integrin β1 expression in aforementioned cells. Red histogram: control IgG. Blue histogram: anti-integrin β1 antibody. (c) Shear flow fibronectin-binding assay at a shear stress of 0.3 dyn/cm2. Mn2+: 0.5 mM MnCl2. Each data point is the mean ± standard deviation from at least 3 independent experiments. Two-tailed unpaired t test was performed. *p < 0.05. (d) Fluorescence microscope images of cells on fibronectin. Green: F-actin staining with Alexa Fluor 488phalloidin. Blue: nuclei staining with DAPI. Scale bar: 50 μM. Additional information on numerical values and data was provided in S2 Data. AFA, triple mutations Q471A, A475F, and S478A; EI, expression index; F-actin, filamentous actin; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; GM, geo-mean fluorescence; GP, percent gated positive; IgG, immunoglobulin G; KO, knockout; WT, wild type.
Discussion
Kindlins are crucial regulators of integrin activation and outside-in signaling. Although kindlins have been shown to bind integrin β cytoplasmic tails, there is limited information on its regulation. Phosphorylation of kindlin-3 at Thr482/Ser484 has been shown to be important for kindlin-3-induced integrin activation, but the mode of action remains unclear [27]. Talin adopts a default low-affinity state for integrin-binding in which its “rod” region folds back and masks the integrin-binding pocket (also known as the PTB) in the F3 subdomain of its head region [28]. Conceivably, talin in an auto-inhibited state is important for preventing the deleterious activation of integrins. Unlike talins, kindlins do not possess a “rod” region. The structure of mouse PH-deleted kindlin-2 reveals a cloverleaf-like conformation in which the integrin-binding site in the F3 subdomain is exposed [18]. Hence, it is unlikely that kindlins can adopt an auto-inhibited state, if it exists, via intramolecular interactions. However, it does not rule out the possibility of auto-inhibition via homo-oligomerization.In this study, we solved the structure of human full-length kindlin-3 (Fig 1B). We also showed that humankindlin-3 can form trimer that is incapable of binding the integrin β1A cytoplasmic tail (Figs 2–5 and S2–S10 Figs), suggesting that kindlin-3 can adopt an auto-inhibited state via homo-oligomerization. This could be explained by the observation that the integrin-binding pocket (PTB) in the F3 subdomain of one protomer is occluded by the last helix α2PH of another protomer in the structure of the kindlin-3 trimer. Furthermore, functional investigations of the AFA mutant kindlin-3 in cells through shear flow fibronectin-binding assay and fluorescence microscope imaging are also in support of an auto-inhibited state of kindlin-3 homotrimer (Fig 6C and 6D). Our data appear contrary to a study in which mouse PH-deleted kindlin-2 forms a dimer and promotes integrin clustering [18]. Based on our data, the presence of the PH domain may interfere to a certain degree with dimer formation (Fig 3A and 3B). In line, the presence of full-length kindlin-3 as well as kindlin-2 dimers were not detected in our assays. However, we do not completely rule out the possibility of kindlins forming dimers under certain conditions given that the PH domain is linked to the F2 via flexible loops, allowing movement of the PH domain to possibly accommodate dimer formation. Along this line, we have provided evidence of kindlin-3 and kindlin-2 being able to form trimer, but the conditions leading to the formation or dissociation remains unknown. Taken together, these can be interesting future studies to pursue.Kindlin-3 has been shown to promote integrin clustering [27,29]. Our findings that kindlin-3 trimer does not bind integrin β1A cytoplasmic tail suggest alternative mechanism(s) that need not involve kindlin oligomerization. First, integrin clustering can be induced by kindlins via their interactions with filamentous actin (F-actin) and focal adhesion proteins, including integrin-linked kinase (ILK) and paxillin [30-34]. Second, kindlins assist binding of talin to integrin β cytoplasmic tails. Hence, integrin clustering can be promoted by talin, which is known to form a dimer and bind F-actin [35]. Third, phosphoinositides are dynamically distributed in cells. Phosphatidylinositol(3,4,5)-trisphosphate (PtdIns(3,4,5)P3) is concentrated at the leading edge of neutrophils and Dictyostelium discoideum [36]. Hence, it is possible that the clustering of integrins by kindlins may be induced in part by the binding of kindlins to PtdIns(3,4,5)P3.In conclusion, we resolved the structure of human full-length kindlin-3. Our data support the presence of kindlin-3 homotrimer, although the precise conditions (such as phosphorylation) leading to its formation or dissociation remain to be determined. Our data also suggest a novel mechanism by which the integrin-binding properties of kindlins can be inhibited by trimer formation. In addition to its role in the disease LADIII [37], kindlin-3 plays a crucial role in cancer progression [26,38,39]. Whether there is a link between oligomer formation of kindlin-3 or other kindlins and cancer progression will be of interest in future studies.
Materials and methods
Protein expression and purification
Using the human full-length kindlin-3 cDNA as template, the target gene was amplified by PCR and inserted into pET-24a expression vector (Novagen) between NdeI and XhoI restriction sites, introducing a C-terminal uncleavable 6xHis tag. The plasmid was transformed into E. coli BL21 (DE3) strain chemo-competent cells for protein expression.The cells were grown at 37 °C in 2xYT medium (containing 30 μg/mL kanamycin) and cooled down to 16 °C once OD600 reached approximately 0.8. Protein expression was induced with 0.5 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) for 20 hours. Cells were collected by centrifugation at 4,000 g for 30 minutes and resuspended in lysis buffer: 50 mM Na2HPO4 (pH 8.5), 500 mM NaCl, 10% (v/v) glycerol, 10 mM imidazole, 5 mM mercaptoethanol (β-ME), and protease inhibitor (Thermo Fisher Scientific). Microfluidizer High Pressure Homogenizer LM20 was used to lyse the cell using pressure of 25,000 psi. Cell lysate was clarified by centrifugation at 40,000 rpm (Beckman Ti 45 rotor) for 1.5 hours, and the supernatant was used for protein purification. The target protein was sequentially purified by Ni-affinity (HisTrap HP column, GE Healthcare), ion-exchange (HiTrap Q HP column, GE Healthcare), and size-exclusion chromatography (Hiload16/60 Superdex 200 column, GE Healthcare) using buffer: 20 mM Tris-HCl (pH 7.5), 150 mM NaCl, and 5 mM β-ME. The purified protein was concentrated and frozen in liquid nitrogen.The selenomethionine (SeMet)-labeled kindlin-3 was expressed in E. coli BL21 grown in M9 medium. Amino acid mixture (0.1 ng/mL L-lysine, 0.1 ng/mL L-phenylalanine, 0.1 ng/mL L-threonine, 0.05 ng/mL L-isoleucine, 0.05 ng/mL L-leucine, 0.05 ng/mL L-valine, and 0.025 ng/mL SeMet) was added before induction by IPTG, and the labeled protein was purified in the same manner as the native protein.Similar protein purification protocols were used for native and mutant kindlin-3 expressed in insect cell expression system. The human full-length kindlin-3 gene was amplified by PCR and inserted into cloning vector pFB-LIC-Bse using ligation-independent cloning and introducing an N-terminal cleavable 6xHis tag. Baculovirus containing the target gene was amplified after 2 passages by transposition and transfection in insect cell Sf9. P2 virus was used to infect the Sf9 cell at 27 °C for 48 hours. Site-direct mutagenesis was performed to generate the mutant kindlin-3 (Q471A, A475F, and S478A) protein. The human full-length kindlin-2 was also expressed in insect cells and purified in the same manner.HumanITGB1 (integrin beta tail residues 773–798) cDNA was amplified and inserted into pNH-TrxT vector with a N-terminal cleavable 6xHis thioredoxin tag by ligation-independent cloning. The plasmid was transformed into E. coli BL21 (DE3) Rosetta T1R cells for protein expression. The cells were grown at 37 °C in 2xYT medium with 30 μg/mL kanamycin and 34 μg/mL chloramphenicol, then cooled down to 16 °C once OD600 was approximately 0.8, and protein expression was induced with 0.5 mM IPTG for 20 hours. Cells were collected by centrifugation at 4,000g for 30 minutes and resuspended in lysis buffer (20 mM HEPES [pH 7.5], 500 mM NaCl, 10 mM imidazole, 10% [v/v] glycerol, and 0.5 mM TCEP). Cells were lysed using LM20 (psi 25,000), and the cell lysate was centrifuged at 40,000 rpm (Beckman Ti 45rotor) for 1.5 hours, and the supernatant was used for purification. The target protein was purified by Ni-affinity (HisTrap HP column, GE Healthcare) and SEC (Hiload16/60 Superdex 75 column, GE Healthcare) using buffer: 20 mM HEPES (pH 7.5), 300 mM NaCl, 10% (v/v) glycerol, and 2 mM TCEP.
Crystallization and data collection
Both native and SeMet-labeled kindlin-3 protein expressed in E. coli were concentrated to 9 mg/mL for crystallization trials. To facilitate kindlin-3 crystallization, surface residues mutagenesis with cluster 1 (E153A, K154A, and E155A) and cluster 2 (K513A, K515A, and K517A) was introduced based on Surface Entropy Reduction prediction (SERp) server. Hanging-drop vapor-diffusion method was used for crystallization. Crystals of native kindlin-3 were obtained under conditions containing 3 M sodium formate (pH 7.0), 3% w/v xylitol, and 9% (v/v) glycerol at 13 °C by seeding. SeMet-labeled kindlin-3 crystals were obtained under conditions containing 3 M sodium formate (pH 7.0), 3% (w/v) D-sorbitol, and 6% (v/v) glycerol at 20 °C, or 3 M sodium formate (pH 7.0) and 3% (w/v) D-(+)-trehalose dihydrate at 20 °C by seeding. Seeding was done by transferring 1 crystal into 100-μL reservoir, crushing it down to nuclei, and adding them into the drop. Crystals were flash frozen in liquid nitrogen for data collection at National Synchrotron Radiation Research Center (Taiwan) and Swiss Light Source.Diffraction data from SeMet-labeled and native crystals of kindlin-3 were collected at X06DA-PXIII beamline in the Swiss Light Source (SLS, Switzerland), Switzerland. SAD measurement on SeMet kindlin crystals were performed using a multi-orientation high-multiplicity data collection strategy [40]. Each scan of 360 was collected at different orientation of the crystal with 0.2° of oscillation angle, 0.1-second exposure time on Pilatus 2MF detector at X-ray energy of 12.67 keV (i.e., Se-edge). Twelve phi-scans of 1,800 frames each were collected at different positions of a single crystal. For the native kindlin-3 crystal, datasets were collected at 1.0 Å with oscillation angle 0.200°. Five phi-scans of 1,000 frames each were collected at different positions of a single crystal.
Data processing and structure determination
The data were processed with XDS package [41], and structures were solved with Phenix program [20]. The diffraction patterns of each native dataset were individually processed using XDS and merged using XSCALE with Friedel's Law set to TRUE. The merged data were then converted to MTZ format using XDSCONV and F2MTZ. The SeMet datasets were processed, merged, and converted similarly to the native datasets, with the exception that the Friendel's Law was set to FALSE. The initial search of the heavy atom sites was performed with SHELX combined with phenix.autosol, yielding 30 sites with reasonable occupancy in an asymmetric unit (11 non-START methionine theoretically exists in each kindlin-3 molecule) [19,20]. The phasing statistics are listed in Table 1:
Table 1
Phasing statistics.
Phasing resolution
Space group
Se Sites
Anomalous Completeness
FOM
49.59–3.80
C 2221
31
99.81%
0.25
Initial model building was performed using phenix.autobuild, and 3 copies of the molecule could be recognized from the segments built. Combining with the number of the heavy atom sites, a trimer was assigned to an asymmetric unit. The structure of kindlin-2 from Mus musculus (PDB entry: 5XPZ) was superimposed onto the built segments, and refinement of the fitted trimer was performed using phenix.refine, which revealed empty density near the F1 subdomain. Because the model structure (PDB entry: 5XPZ) lacked the PH domain, we search the map for a PH domain homologue (PDB entry: 5L81) using molecular replacement with phenix.phaser. The model was then refined iteratively using phenix.refine. The refined model was used to perform molecular replacement (phenix.phaser) with the native data. The model sequence was then corrected using Chainsaw, and the model was refined iteratively using phenix.refine and Lorestr [42]. Note that for the native data, we collected 3 highly redundant datasets from 3 isomorphous crystals and merged the data together. The data collection and refinement statistics are summarized in S1 Table. All the structure figures were rendered in PyMol (Schrödinger, LLC).
Analytical gel filtration chromatography
Analytical gel filtration chromatography was carried out with AKTA Explore system (GE Healthcare). Superdex 200 Increase 10/300 GL column (GE Healthcare) pre-equilibrated with the buffer 20 mM Tris-HCl (pH 7.5), and 150 mM NaCl was used for all protein samples. Gel filtration calibration kit HMW (GE Healthcare) containing 5 well-defined proteins with molecular weight ranging from 43k to 669k Da, and Blue Dextran 2000 was used to generate a standard calibration curve.
Negative staining EM imaging and processing
The target protein was diluted to 0.01 mg/mL after gel filtration for negative staining EM. Carbon-coated TEM grid (Electron microscopy sciences, 200 mesh Copper) was used. The grid was glow discharged for 35 seconds just before use, and 4 μl of the sample was loaded on to the grid and incubated for 1 minute before absorbing the solution. Next, 4 μl of 2% uranyl acetate was then slowly pipetted on to grid to cover the protein sample for 1 minute and absorbed. The gird was loaded to a Tecnai T12 (FEI) electron microscope operated at 120 kV. Digital micrographs were recorded at 43,000× magnification with defocus range between −1 and −2 μm using an Eagle 4K x 4K camera. EMAN2 was used for particle visualization [43].
Crosslinking and MS analysis
DSSO was purchased from Thermo Fisher Scientific and used for crosslinker. First, 1 mg DSSO was dissolved into 100 μL DMSO to prepare a 25 mM stock solution before use. Both monomeric and trimeric kindlin-3 purified from insect cells were applied for DSSO treatment. Protein was dissolved in 40 μL of 20 mM HEPES buffer (pH7.5) at 0.2 μM. Next, 0.1 μL of DSSO stock solution was added to the protein sample, and the final reaction buffer was adjusted to 45 μL with a 300-fold molar excess of crosslinker over the protein concentration. A control sample containing the protein without crosslinker was also prepared. Both samples were incubated at room temperature for 1 hour, and the reaction was quenched by adding 1M Tris buffer (pH 8.5) to a final concentration of 20 mM. The crosslinked protein was analyzed by SDS-PAGE and MS.The 2 bands corresponding to kindlin-3 trimers from 2 crosslinking experiments were excised from the SDS-PAGE gel for in-gel digestion. After reduction using DTT, alkylation with IAA, and dehydration by ACN, the protein in the gel matrix was first digested by lys-C for 4 hours followed with overnight trypsin digestion. The peptides were resuspended in 0.1% formic acid and analyzed on a Dionex Ultimate 3000 RSLCnano system coupled to a Q-Exactive tandem mass spectrometer (Thermo Fisher). The LC-MS/MS was operated at an electrospray potential of 1.5 kV. A full MS scan (350–1,600-m/z range) was acquired at a resolution of 70,000 at m/z 200 and a maximum ion accumulation time of 100 milliseconds. Peptide ions with charge state equal or less than 3+ were excluded from MS/MS. The LC-MS/MS raw data files were searched for crosslinked peptides using pLINK2 [44]. The search values included trypsin digestion, DSSO cleavable crosslinker, 10 ppm precursor mass tolerance, and 0.02 Da fragment mass tolerance. We have done 2 replicates, with those consistently observed crosslinked peptides in all experiments/replicates shown in the S8C Fig and S1 Data.The MS crosslinking proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository with the dataset identifier PXD019110 (ftp://ftp.pride.ebi.ac.uk/pride/data/archive/2020/06/PXD019110).
CD spectroscopy measurement
CD experiments were carried out on a calibrated CD spectrometer (Chirascan, Applied Photophysics) at 25 °C in the far UV region (190–260 nm wavelength). Purified protein samples were dissolved in 50 mM sodium phosphate buffer (pH 7.5) at a concentration of 0.1 mg/mL. Next, 200 μL protein solution was loaded into a 1-mm path length quartz glass cuvette (Hellma Analytics) for measurement. The scan rate was set at 0.5 second per point with an approximate 65 seconds scanning in total. Data were analyzed by CDNN software [45].
ITC assay
ITC measurements were carried out on a MicroCal PEAQ-ITC (Malvern) at 25 °C. All protein samples were dissolved in buffer: 50 mM HEPES (pH 7.5) and 150 mM NaCl. The titration processes were performed by injecting 2 μl aliquots of the ITGB1 tail, or for control His-Trx tag (no target protein) at a concentration of 500 μM into monomer or trimer kindlins at a concentration of 50 μM with a stirring speed of 600 rpm. The titration data were analyzed using the MicroCal PEAQ-ITC Analysis Software.
SEC-MALS
The SEC-MALS system was comprised of HPLC system coupled with UV and fluorescence detector (Shimadzu), Dawn Heleos II Multi-Angle Light Scattering detector (Wyatt) and Optilab T-rEX refractive index (RI) detector (Wyatt). Superdex 200 increase 5/150 GL (GE) was used to separate the species in solution. The system was pre-equilibrated with buffer containing 20 mM HEPES (pH 7.5), 500 mM NaCl and the RI detector was purged for 2 column volumes until the dRI value was stable. The dRI value was used for data analysis later. Protein samples were dissolved in 50 μL of the same buffer with at least 2 mg/mL concentration and filtered through 0.1-μm filter before injection. Astra software was used for sample auto-injection and data analysis.
Generation of stable HEK 293 cell line expressing His6-tagged kindlin-3
6xHis-3xGly(linker)-kindlin-3 (WT) in pcDNA3.1-zeo(-) plasmid was generated by PCR using the HA-kindlin-3 pcDNA3.1 expression plasmid[29] as a template and the following primers:5’CTAGCTAGCATGCACCACCACCACCACCACGGTGGTGGTATGGCGGGGATGAAGACAG3’ and 5’CCCAAGCTTTCAGAAGGCCTCATGGCCCCCGGTGAGCTGCAGGAAGAGGTCTTC3’.The PCR product was digested with restriction enzymes NheI and HindIII and ligated into pcDNA3.1-zeo(-) digested with the same enzymes. HEK 293 (American Type Culture Collection [ATCC], Manassas, VA) cells were cultured in DMEM media supplemented with 10% HI-FBS and Penicillin/Streptomycin. Cells (1×106) were seeded into one well of a 6-well plate the day before transfection. Cells were transfected with 3 μg of plasmid by PEI followed by selection in Zeocin (Invitrogen, Waltham, MA) at 200 μg/mL for 2 weeks to establish a stable cell line. The expression of kindlin-3 was verified by western blotting. For purification of kindlin-3, 5 batches of 12 × 10 cm culture dish (approximately 80% cell confluence per dish) of cells were harvested. Purification steps and conditions were the same as for E. coli and insect cell expression.
Bead-based BiFc analysis of kindlin-3 homotrimer
The expression plasmids N-eYFP (M1-A155)-12Gly (linker)-kindlin-3 (WT or AFA mutant) and C-eYFP (D156-K239)-12Gly (linker)-kindlin-3 (WT or AFA mutant) were generated by Gibson assembly. The N-eYFP fragment containing part of the 12 Gly linker was generated by PCR using the peYFP-N1 plasmid (Clontech) as the template and the following primers: 5’TATAGGGAGACCCAAGCTGGATGGTGAGCAAGGGCGAGGAC3’ and 5’CACCGCCTCCTCCGCCACCTCCGCCACCGGCCATGATATAGACGTTGTGGCTG3’.The C-eYFP fragment containing part of the 12 Gly linker was similarly generated but using different primers:5’TATAGGGAGACCCAAGCTGGATGGACAAGCAGAAGAACGGCATCAAGG3’ and 5’CACCGCCTCCTCCGCCACCTCCGCCACCCTTGTACAGCTCGTCCATGCCG3’. Kindlin-3 fragment (WT or AFA mutant) containing part of the 12 Gly linker at its N-terminus was generated by PCR using either kindlin-3 WT or kindlin-3AFA plasmid as the template and the following primers:5’AGGTGGCGGAGGAGGCGGTGGAGGCGGTATGGCGGGGATGAAGACAGCC3’ and 5’GGCTGATCAGCGGTTTAAACTCAGAAGGCCTCATGGCCCC3’.The pcDNA3.1-zeo(-) vector was linearized by restriction enzymes NheI and AlfII. N-eYFP or C-eYFP fragment, kindlin-3 (WT or AFA mutant) fragment, and linearized pcDNA3.1-zeo(-) plasmid were mixed in Gibson assembly master mix (New England Biolabs, Ipswich, MA) and incubated at 50 °C for 50 minutes. The assembled plasmid was transformed into E. coli competent cells for plasmid amplification. The HA-kindlin-3 pcDNA3.1 expression plasmid has been reported previously [29]. To generate F3 deletion (F3Δ), site-directed mutagenesis was performed on N-eYFP (M1-A155)-12Gly (linker)-kindlin-3 WT, C-eYFP (D156-K239)-12Gly (linker)-kindlin-3 WT, and HA-kindlin-3 plasmids using the primers:5’AGTCCCTGCCCGACTTCTGAATCTCCTATGTCATGG3’ and 5’CCATGACATAGGAGATTCAGAAGTCGGGCAGGGACT3’ such that a stop codon was introduced at Gly554.HEK 293T (ATCC) cells (3×106) were cultured in DMEM media supplemented with 10% HI-FBS and penicillin/streptomycin. Cells were cotransfected using polyethylenimine (PEI) with equal amount (ratio 1:1:1) of HA-kindlin-3, N-eYFP (M1-A155)-12Gly (linker)-kindlin-3, and C-eYFP (D156-K239)-12Gly (linker)-kindlin-3 plasmids. The 3 plasmids transfected were WT, AFA, and F3Δ kindlin-3. Next day upon transfection, cells were lysed in lysis buffer (1% NP-40, 150 mM NaCl, and 10 mM Tris [pH 7.4]) containing protease inhibitor (Sigma-Aldrich). A small fraction of the cell lysate was analyzed by western blotting using rat anti-kindlin-3 antibody (1:1,000 dilution) (clone 181A, generated in-house). The remaining cell lysate was separated into 2 equal volumes. One half of the cell lysate was mixed with 3 μg of mouse anti-HA (Sigma-Aldrich) antibody and the other half with 3 μg of mouse serum IgG (Sigma-Aldrich). Thereafter, 40 μg of SureBeads Protein G Magnetic beads (Bio-Rad, Hercules, CA) were added to each sample and incubated at 4 °C for 30 minutes on a roller. Beads were washed in lysis buffer 3 times and resuspended in 300 μL of ice-cold PBS followed by the detection of YFP signal detection on a BD 3-Lasers Fortessa X20 flow cytometer with High-Throughput Sampler (HTS) Becton Dickinson, Franklin Lakes, NJ. FlowJo software (Tree Star, Ashland, OR) was used to analyze the data.
Generation of kindlin-3 KO K562 cells and reconstitution of kindlin-3 expression
The humanerythroleukemia cell line K562 was obtained from the ATCC and maintained in complete RPMI medium containing 10% heat-inactivated fetal bovine serum, 100 IU/mL of penicillin, and 100 μg/mL of streptomycin. Kindlin-3 KO K562 cells were generated by the CRISPR-Cas9n method. The 2 gRNA targeting sequences 5’-GGGCTACCGCCAACACTGGG-3’ and 5’-GGGGCCTTCGTGGGATGCTG-3’ were each subcloned into the pSpCas9n(BB)-2A-GFP (PX461) plasmid (a gift from Feng Zhang, Broad Institute of MIT and Harvard, Addgene plasmid #48140) [46]. K562 cells were cotransfected with both plasmids by electroporation. Transfected GFP-fluorescent cells were sorted on a FACS-Aria cell sorter (Becton Dickinson, Franklin Lakes, NJ) and subcloned (1 cell/well) in 96 well plates. After culture expansion, clones were screened for the complete loss of kindlin-3 expression by western blotting using the anti-kindlin-3 mAb clone 9 [29] and verified by genomic DNA sequencing of the CRISPR-Cas9n targeted region in the kindlin-3 gene. A K562 clone with complete KO of kindlin-3 expression was used in the following reconstitution experiments. Cells were transfected by electroporation with expression plasmid pcDNA3.1(zeo) containing cDNA of either WT kindlin-3 or kindlin-3 Q471A/A475F/S478A (henceforth referred to as AFA mutant) followed by selection in 100 μg/mL Zeocin to generate stable lines. The expression of WT kindlin-3 and kindlin-3AFA mutant in these cells was verified by western blotting.
Flow cytometry analysis
Surface expression of β1 integrins on K562 cells was determined by staining cells with anti-CD29 (β1) antibody (Becton Dickinson-Pharmingen, Franklin Lakes, NJ) or control IgG from rat serum (Sigma Life-Science) and FITC-conjugated anti-Rat IgG (Sigma Life-Science) followed by analysis on a FACSCalibur flow cytometer (Becton Dickinson, Franklin Lakes, NJ). Data were analyzed and presented using the FlowJo software (Tree Star, Ashland, OR).
Shear flow assay
Shear flow assay was performed as previously described [26] with slight modifications. Briefly, μ-slide I0.4 Luer parallel flow chamber (Ibidi GmbH, Germany) was coated with 5 μg/cm2 of humanfibronectin (Sigma Gibco) in PBS overnight at 4 °C followed by blocking of nonspecific binding sites in PBS containing 0.5% (w/v) BSA. The flow chamber was assembled on a microscope stage housed in a 37 °C incubator. Cells were resuspended in Hanks’ Balanced Salt Solution without or with 0.5 mM MnCl2. Cells were infused into the chamber at a shear stress of 0.3 dyn/cm2 shear using a syringe pump. Total number of adherent cells in 4 different fields of the chamber were counted. The average number of cells per field was then calculated.
Fluorescence staining and imaging
Cells were resuspended in culture media containing 0.5 mM MnCl2 and seeded on a coverslip glass-bottom tissue culture dish (MatTek, Ashland, MA) that was precoated with humanfibronectin (Gibco) at concentration of 10 μg/mL. Cells were allowed to adhere on fibronectin under culture conditions for 2 hours. Medium was discarded, and cells were fixed in 3.7% (w/v) paraformaldehyde-PBS solution at RT for 10 minutes. Cells were then incubated in CSK buffer (100 mM NaCl, 300 mM sucrose, 3 mM MgCl2, 1 mM EGTA, 10 mM PIPES [pH 6.8]) containing 0.3% (v/v) Triton at RT for 1 minute. Cells were washed 3 times with PBS and nonspecific sites blocked with PBS containing 5% (w/v) BSA overnight at 4 °C. Fixed cells were stained with DAPI and Alexa Fluor 488phalloidin (Invitrogen Corporation, Carlsbad, CA). Cells were visualized under confocal laser scanning microscope LSM710 (Zeiss, Oberkochen, Germany) at a magnification of 40× and 100× under oil immersion.
Structure-based sequence alignment of human kindlins.
The domains and the F1 loop are highlighted in the same manner as in Fig 1A. Secondary structure motifs and numbering are based on kindlin-3.(TIF)Click here for additional data file.
The anomalous difference Fourier map for total Se atom positions.
(a) The anomalous difference Fourier map is generated using Global Phasing Buster. The map is displayed with Se sites as green spheres and contoured at 3 sigma. Total 31 Se sites were shown in the unit cell. (b) The anomalous difference Fourier map (white mesh) is displayed with the final refined model (semitransparent cartoon rendering). The sulfur atoms on methionines of the final model are shown as green spheres. A zoom-in view of the methionine sites is also presented with 3 methionine side chains shown in stick model. Se, selenine.(TIF)Click here for additional data file.
Representative 2Fo-Fc electron maps.
The representative 2Fo-Fc electron density maps are shown in blue meshes with the ribbon model of the protein. Secondary structure elements are labeled. (a) 2Fo-Fc electron density map of protomer–protomer interface. (b) 2Fo-Fc electron density map of F2 subdomain of one protomer. Fc, calculated structure factor; Fo, observed structure factor.(TIF)Click here for additional data file.
Crystal packing of C-alpha models with unit cell dimensions.
Each trimer is colored identically.(TIF)Click here for additional data file.
Fo-Fc electron density map of the loop between α2F2 and β1PH.
The modeled loop between α2F2 and β1PH appears to be a helix interacting with α2PH to stabilize the entire domain. Fc, calculated structure factor; Fo, observed structure factor; PH, pleckstrin homology.(TIF)Click here for additional data file.
Negative staining electron microscopy of kindlin-3 trimer.
(a) Typical negative stain electron microscopy micrograph of kindlin-3 trimer purified from Sf9 cells. Kindlin-3 particles are highlighted by white squares. (b) Close-up view of kindlin-3 particles. Sf9, Spodoptera frugiperda 9.(TIF)Click here for additional data file.
DSSO crosslinked kindlin-3.
(a) SDS-PAGE of kindlin-3 monomer with or without DSSO treatment. Lane 1 indicates the native kindlin-3 monomer purified from insect cells. Monomeric kindlin-3 in solution gave a band above 70k Da. Lane 2 indicates the kindlin-3 monomer crosslinked by DSSO. Crosslinked trimeric kindlin-3 in solution exhibited a band above 200k Da (labeled by red arrow). (b) Analytical gel filtration chromatography profiles of kindlin-3 monomer with or without DSSO treatment. K3F monomer without DSSO treatment (blue) and K3F monomer with DSSO treatment (red): K3F monomer without DSSO treatment only exhibits monomeric state, whereas K3F monomer with DSSO treatment exhibits both monomeric and trimeric states. Note that molecular weight markers for analytical gel filtration chromatography are indicated by black arrows. (c) SDS-PAGE of kindlin-3 trimers with or without DSSO treatment. Lane 1 indicates the native kindlin-3 trimer purified from insect cells. Trimeric kindlin-3 in solution was denatured into monomeric state to give a band above 70k Da. Lane 2 indicates the kindlin-3 trimer crosslinked by DSSO. Crosslinked trimeric kindlin-3 in solution exhibited a band above 200k Da (labeled by red arrow). DSSO, disuccinimidyl sulfoxide.(TIF)Click here for additional data file.
DSSO crosslinked residue pairs detected by MS.
(a) Lysine–lysine intra- (red) and inter- (blue) molecules crosslinks were mapped onto the kindlin-3 crystal structure. The intermolecular crosslink marked with a blue asterisk is approximately 30 Å. It was identified with very high confidence. The intermolecular crosslink marked with a green asterisk is approximately 34 Å. It was identified with a relatively low confidence but also appears reasonable upon inspection of the structure. Besides, both 2 intramolecular crosslinks were identified with very high confidence. (b) Two domain organization of kindlins showing the identified lysine–lysine crosslinks. K567-K589 and K262-K457 are intramolecular crosslinks. K457-K567 and K252-K457 are intermolecular crosslinks. (c) Annotated MS/MS spectrum showing the b and y fragment ions of intermolecular crosslinked peptides K(252)DEILGIANNR-LASK(457)GR. DSSO, disuccinimidyl sulfoxide; MS, mass spectrometry.(TIF)Click here for additional data file.
Circular dichroism spectra of kindlin-3 monomer from E. coli and Sf9 cells.
The far UV spectrum shows that E. coli–expressed kindlin-3 and Sf9-expressed kindlin-3 have very similar secondary and tertiary structures. E. coli, Escherichia coli; Sf9, Spodoptera frugiperda 9.(TIF)Click here for additional data file.
Binding assay of integrin β1 tail and human full-length kindlins using ITC.
Note that in the individual figure, the upper panel shows binding isotherm, and the lower panel shows data-fitting curve. (a) Binding assay for kindlin-3 Sf9 monomer. The protein tested is the monomer form of native kindlin-3, which is expressed in Sf9 insect cells. ITC measurement demonstrated a moderate binding between integrin β1 tail and monomeric kindlin-3. (b) Binding assay for kindlin-3 Sf9 trimer. The protein used is native kindlin-3 trimer, which is expressed in Sf9 insect cells. In agreement with our structural data (Fig 3C), kindlin-3 trimer shows no binding to integrin β1 tail. (c) Binding assay for kindlin-2 Sf9 monomer. The protein used is native kindlin-2 monomer expressed in Sf9. Compared with monomeric kindlin-3, ITC measurement indicated a much stronger binding between integrin β1 tail and monomeric kindlin-2. (d) Binding assay for kindlin-2 Sf9 trimer. The protein used is native kindlin-2 trimer expressed in Sf9. In agreement with kindlin-3 trimer, kindlin-2 trimer shows no binding to integrin β1 tail. ITC, isothermal titration calorimetry; Sf9, Spodoptera frugiperda 9.(TIF)Click here for additional data file.
Structural comparison of F2 domains.
The F2 domains are from kindlin-3, kindlin-2, and talin, colored deep teal, yellow, gray, respectively.(TIF)Click here for additional data file.
Annotated MS/MS spectra of DSSO crosslinked peptides that are identified with pLink2 software.
DSSO, disuccinimidyl sulfoxide; MS, mass spectrometry.(ZIP)Click here for additional data file.
Additional information on numerical values and data presented in Figs 5C, 6B and 6C.
(ZIP)Click here for additional data file.
Data collection and refinement statistics.
(DOCX)Click here for additional data file.12 Aug 2019Dear Dr Gao,Thank you for submitting your manuscript entitled "Structural basis of human full-length kindlin-3 homotrimer in an auto-inhibited state" for consideration as a Research Article by PLOS Biology.Your manuscript has now been evaluated by the PLOS Biology editorial staff as well as by an academic editor with relevant expertise and I am writing to let you know that we would like to send your submission out for external peer review.However, before we can send your manuscript to reviewers, we need you to complete your submission by providing the metadata that is required for full assessment. To this end, please login to Editorial Manager where you will find the paper in the 'Submissions Needing Revisions' folder on your homepage. Please click 'Revise Submission' from the Action Links and complete all additional questions in the submission questionnaire.*Please be aware that, due to the voluntary nature of our reviewers and academic editors, manuscripts may be subject to delays during the holiday season. Thank you for your patience.*Please re-submit your manuscript within two working days, i.e. by Aug 14 2019 11:59PM.Login to Editorial Manager here: https://www.editorialmanager.com/pbiologyDuring resubmission, you will be invited to opt-in to posting your pre-review manuscript as a bioRxiv preprint. Visit http://journals.plos.org/plosbiology/s/preprints for full details. If you consent to posting your current manuscript as a preprint, please upload a single Preprint PDF when you re-submit.Once your full submission is complete, your paper will undergo a series of checks in preparation for peer review. Once your manuscript has passed all checks it will be sent out for review.Feel free to email us at plosbiology@plos.org if you have any queries relating to your submission.Kind regards,Lauren A Richardson, Ph.DSenior EditorPLOS Biology29 Aug 2019Dear Dr Gao,Thank you very much for submitting your manuscript "Structural basis of human full-length kindlin-3 homotrimer in an auto-inhibited state" for consideration as a Research Article at PLOS Biology. Your manuscript has been evaluated by the PLOS Biology editors, an Academic Editor with relevant expertise, and by independent reviewers.The reviews of your manuscript are appended below. You will see that the reviewers find the work potentially interesting. However, based on their specific comments and following discussion with the academic editor, I regret that we cannot accept the current version of the manuscript for publication. We remain interested in your study and we would be willing to consider resubmission of a comprehensively revised version that thoroughly addresses all the reviewers' comments. We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript would be sent for further evaluation by the reviewers.You will see that the reviewers find the work potentially interesting. However, based on their specific comments and following discussion with the academic editor, I regret that we cannot accept the current version of the manuscript for publication. We remain interested in your study and we would be willing to consider resubmission of a comprehensively revised version that thoroughly addresses all the reviewers' comments. We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript would be sent for further evaluation by the reviewers.Having discussed the reviews with the academic editor, we think that the data supporting the formation and function of the kindlin-3 trimer must be improved. The reviewers recommend a number of different assays and techniques that should be applied. Additionally, we agree with Reviewer #2 and believe that better in vivo support of trimer formation and auto-inhibition is needed. Lastly, the Academic Editor highlights that the quality of the X-ray structures should be improved or at the very least, the limitations of the resolution should be addressed.We appreciate that these requests represent a great deal of extra work, and we are willing to relax our standard revision time to allow you six months to revise your manuscript. Please email us (plosbiology@plos.org) to discuss this if you have any questions or concerns, or think that you would need longer than this. At this stage, your manuscript remains formally under active consideration at our journal; please notify us by email if you do not wish to submit a revision and instead wish to pursue publication elsewhere, so that we may end consideration of the manuscript at PLOS Biology.Your revisions should address the specific points made by each reviewer. Please submit a file detailing your responses to the editorial requests and a point-by-point response to all of the reviewers' comments that indicates the changes you have made to the manuscript. In addition to a clean copy of the manuscript, please upload a 'track-changes' version of your manuscript that specifies the edits made. This should be uploaded as a "Related" file type. You should also cite any additional relevant literature that has been published since the original submission and mention any additional citations in your response.Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.Before you revise your manuscript, please review the following PLOS policy and formatting requirements checklist PDF: http://journals.plos.org/plosbiology/s/file?id=9411/plos-biology-formatting-checklist.pdf. It is helpful if you format your revision according to our requirements - should your paper subsequently be accepted, this will save time at the acceptance stage.Please note that as a condition of publication PLOS' data policy (http://journals.plos.org/plosbiology/s/data-availability) requires that you make available all data used to draw the conclusions arrived at in your manuscript. If you have not already done so, you must include any data used in your manuscript either in appropriate repositories, within the body of the manuscript, or as supporting information (N.B. this includes any numerical values that were used to generate graphs, histograms etc.). For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.For manuscripts submitted on or after 1st July 2019, we require the original, uncropped and minimally adjusted images supporting all blot and gel results reported in an article's figures or Supporting Information files. We will require these files before a manuscript can be accepted so please prepare them now, if you have not already uploaded them. Please carefully read our guidelines for how to prepare and upload this data: https://journals.plos.org/plosbiology/s/figures#loc-blot-and-gel-reporting-requirements.Upon resubmission, the editors will assess your revision and if the editors and Academic Editor feel that the revised manuscript remains appropriate for the journal, we will send the manuscript for re-review. We aim to consult the same Academic Editor and reviewers for revised manuscripts but may consult others if needed.If you still intend to submit a revised version of your manuscript, please go to https://www.editorialmanager.com/pbiology/ and log in as an Author. Click the link labelled 'Submissions Needing Revision' where you will find your submission record.Thank you again for your submission to our journal. We hope that our editorial process has been constructive thus far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.Sincerely,Lauren A Richardson, Ph.DSenior EditorPLOS Biology*****************************************************ReviewsReviewer #1:This is potentially significant manuscript showing that kindlin-3 might form homotrimer in an autoinhibited state to prevent integrin binding and activation. Previous structural studies on homologous kindlin-2 showed a crystal structure with deletion of PH domain and the protein undergoes monomer/dimer transition although the dimer formation was extremely slow (takes several days). The monomeric structure in this manuscript is convincing but I have major concerns in the trimer study that is the core of the manuscript.Major points:1. The authors claimed that they observed pure monomer of kindlin-3 in E. Coli system but monomer/trimer equilibrium in insect cell system (sf9). However, the whole manuscript did not describe any experimental conditions about how they observed trimer by gel-filtration. The trimer claim in Fig 2d is not convincing at all since this is supdex 200 with no molecular marker indicated. I can argue that that peak is a dimer or an oligomer or aggregate. Oligomer or aggregate is actually possible since negative staining in Fig. 2f showed a 10 nm particle size that is unrealistically big for a 228 kD trimer. Much more convincing evidence for the trimerization is needed by some definitive techniques such as analytic ultracentrifugation and light scattering.2. The claimed trimer from insect cells contradicts from a previous biophysical study using the same system, which showed only monomer (ref 16). Therefore, the authors’ explanation that only insect cell system produces trimer is not correct. Is it possible that the authors observed some concentration-dependent oligomerization or aggregation? Again, no experimental conditions were provided for how they detected trimer vs monomer.3. The ITC studies on the trimer vs monomer binding to integrin are not convincing since ITC is more reliable on strong binding Kd<10 microM). The monomer kindlin-3 binds to integrin at ~200 microM here, which is extremely weak and usually not detectable by ITC. Some alternative method is crucial for confirm the integrin binding studies by ITC. For example, how about GST pull down to show the difference? The authors claim the trimer formation is conserved among kindlins. Since kindlin-1/2 bind much tighter to integrins, which may be easier to be measured, the authors should use one of them (preparation of these kindlins is well established in literatures) to demonstrate this crucial point, i.e., monomer binds better to integrin than trimer. The experiment may provide evidence for their conclusion that the trimer based autoinhibition is conserved among kindlins. This is very important for this manuscript!4. From the crystallographic site, the authors reported the crystal SG of C2221, where z equals 8, resulting in several options of monomer numbers per the asymmetric unit. Based on the reported crystal parameters, the authors determine three molecules in the asymmetric unit, resulting in quite outlier values of Matthews probability and solvent content (Vm=3.47 A**3/Da; Solvent=64.58%). Have the authors ever tested to analyze four molecules (as dimer of dimer) in the asymmetric unit, where more feasible values could be accountable (Vm=2.60 A**3/Da; Solvent=52.77%)? Have the authors encountered potential pseudo-symmetry problem? The current resolution (3.6A) in the manuscript is low, which may cause ambiguity of the trimer determination. In this regard, the Rmerge was not reported in the statistic table but is required for crystal structure report. The authors need to state the Rmerge or equivalent statistic value during data collection and processing (R-meas if XDS program utilized). If not clear, the entire log file of CORRECT.LP needs to be supplemented. As a rule of thumb, the cut-off of I/sI in the outer shell must be satisfied ≥ 2.0 unless specific reason being provided. CC(1/2) in the outer shell must be also ≥ 70%. If the above criteria can affect the high-resolution cut-off, the authors may need to correct the resolution limit followed by structure refinement.5. The detailed phasing statistics need to be provided in the method section. Anomalous difference Fourier map for total Se atom positions is also required in the supplementary figure. Representative electron density maps (2Fo-Fc) need to show in the supplementary figure. Crystal packing of C-alpha models with unit cell dimensions need to be presented in the supplementary figure.Minor points:1. Line 105-106, please provide the technical details to convince readers about the expression, purification and sample preparation as to how the trimer vs monomer was obtained and crystallized.2. Line 142-144, please discuss why authors ascertain which K3 molecule the PH domain belongs to after all the limited electron density connecting PH domain to F2 domain.3. Line 239-240, the authors proposed that S484 phosphorylated Kindlin-3 monomer is the ultimate activation state, however S484A K3 monomer mutant only exhibited 1M Kd on ITC. Please discuss how such weak interaction can be biologically significant.4. Typo on line 240, week � weak.5. Line 244-246, residue S484 didn’t show in Fig 2C to support the sentence.6. Line 248-249, it is confusing that S484 phosphorylation does not play the major role in kindlin-3 trimer formation, but somehow affect the kindlin-3 function. Does PH domain play the major role, such as PH domain recruitment to the membrane lipid?7. Line 266-269, the statements here are unsubstantiated because i. the K3-AFA mutant interaction with integrin b1 has not been tested; ii. the authors need to reveal the technical details of how they obtained monomer and trimer K3 in sf9 cells, and confirm the K3-AFA is a monomer even expressed in the buffer condition for trimer.8. Fig. 2d and S6, a molecular weight marker should be included.9. Fig. 2e, please box a larger area to include more particles.---------------Reviewer #2:The submitted manuscript discusses the structure of full length kindlin-3. A new mechanism of kindlin-3 regulation is proposed, namely the inactivation of kindlin-3 (inability to bind integrins) via homotrimerization.I would like to say that as a non-structural biologist I was able to enjoy the manuscript as it was very well written and easy to follow. The structural data appears sound although others are likely much more competent to comment. I found it surprising however that monomeric kindlin-3 from insect cells bound to beta1 integrin tails with a surprisingly high KD of 200 micromolar (and no interaction of E. coli-derived kindlin-3). We have previously found kindlin 1-3 to consistently and strongly bind to integrin cytoplasmic tail peptides in pulldown experiments suggesting a lower KD.One of the main conclusions from the structural data is that kindlin-3 forms homotrimers in vivo. The manuscript unfortunately is a little bit light on the in vivo corroboration of this idea. In fact, I don't think there is any in vivo data presented that would strongly support the idea of kindlin trimers occurring in vivo. A kindlin-3 mutant induces increased adhesion which is in line with the authors hypothesis however no proof that trimers exist in vivo.Therefore, I was wondering whether the authors are able to generate some in vivo evidence of trimer formation along the lines of FRET or proximity ligation methods? Also, this may help address the question of when, where and how trimers are formed in vivo.The data presented is definitely worth publishing and it will be up to the editors to decide how much in vivo corroboration is required for this journal. I do think that a little bit more in vivo data would significantly improve the manuscript. They authors talk about developing cancer drugs based on these new findings in the discussion. Prior to taking this leap I would encourage them to further test their idea of homotrimer formation in vivo and make sure that these indeed exist and are important regulators of integrin activity.Minor points include referring to Kindler syndrome as a skin atrophy disease. This terminology does not exist in dermatology. I would refer to Kindler syndrome as a disorder within the spectrum of hereditary epidermolytic blistering diseases. Likewise I would refer to LAD-III as a primary immunodeficiency with platelet dysfunction.---------------Reviewer #3:Kindlins play important role in the integrin activation and clustering. Currently the main information on the kindlin structure is based on the fragment with the deleted F2 loop and PH domain. The manuscript for the first time reports the structure of a complete kindlin3. While showing similar overall fold to the truncated version, the structure does not have the F2 domain swap dimerisation. Instead, it forms a trimer where PH domain interacts with the F3 lobe and partially occlude the integrin binding site. In solution kindlin3 exists as a mixture of stable monomer and trimer that can be separated by gel filtration. The trimeric form does not bind integrin, as expected from the crystal structure, while the monomer has a very weak with integrin. Disruption of the trimeric interface by structure-based mutations promotes integrin activation in cells. The authors propose a model where kindlin activity is modulated through trimerisation that is, possibly, disrupted by phosphorylation. Dimerisation reported earlier for the truncated form has not been detected in the full-length kindlin3 and kindlin2 by the authors.The structure of the full-length kindlin is clearly important for the adhesion field, and the proposed model of kindlin regulation is intriguing. However, the presented experimental support for the regulation model and the role of phosphorylation is rather tentative.1. The lack of inter-conversion between the monomer and the trimer is puzzling. No structural rearrangement is required, so the equilibrium is expected to be dynamic. The extremely slow inter-conversion suggests that an additional factor may be involved that induces trimer formation. This has an implication for the regulation mechanism that the authors should considered and discuss.2. The authors concluded that non-phosphorylated form does not bind integrin from the ITC data (Fig S3) and detection of pS484 in sf9, but not in e.coli. The ITC titrations of S3a and d look very similar, except for a larger buffer mismatch in S3a. However, the binding curve of S3d is not fitted correctly, because it shows systematic deviations from the experimental data. The values of the dltH axis of S3d do not seem to correspond to the titration data – the heat changes are similar to those in S3a, so the dltH values are also expected to be similar. The theoretical curve should be fitted correctly and the values checked. From the shape of the curve and the raw data, the binding constant is expected to be similar in S3a and d, which invalidates the conclusion about the effect of phoshorylation on the binding.3. The ITC experiments should also be conducted on the kindlin2 monomers expressed in e.coli and sf9. The reported integrin interaction is stronger for kindlin2, which will make any potential differences easier to detect.4. The lack of interaction for e.colikindlin3 monomer is hard to explain by phosphorylation anyway, because S484 distant from the integrin binding site. Perhaps the real cause of the difference is the C-terminal tag of e.coli construct that somehow reduces the binding because of its proximity to the integrin binding site. According to methods, the tag was not removed. The authors should repeat the binding experiment with the tag removed.5. MS data do not show how large is the fraction of the phosphorylated protein. This is expected to be too low to have any significant effect on the interactions measured in vitro.6. The clustering part of the model in fig.5 is a pure speculation and is not based on any of the presented data. It should be removed from the figure as potentially misleading.7. Description of the preparation of the monomeric and trimeric forms should be included in the methods.8. The manuscript has a number of somewhat awkward and not fully clear sentences. Further editing and refinement of the text is recommended.17 Feb 2020Submitted filename: Rebuttal_Letter__YGAO_PBIOLOGY-D-19-02291R1.docClick here for additional data file.26 Mar 2020Dear Dr Gao,Thank you very much for submitting a revised version of your manuscript "Structural basis of human full-length kindlin-3 homotrimer in an auto-inhibited state" for consideration at PLOS Biology. This revised version of your manuscript has been evaluated by the PLOS Biology editors, the Academic Editor and the original reviewers. We apologize again for the delay while our reviewers, Academic Editors and editorial staff deal with COVID-19-related disruptions.As you can see, Reviewers 2 and 3 are satisfied with the revision and Reviewer 3 has only one further minor request. Reviewer 1 however still has technical concerns and doesn't feel his/her previous points have been adequately addressed. The concerns continue to relate to the physiological relevance of kindlin-3 trimerization and discrepancy with previous work. The Academic Editor has very carefully evaluated these comments. He/she acknowledges that this is a difficult system to study and that previous work (Yates et al., 2012) characterizing full-length mouseKindlin-3 reports a monomer by SEC and dimer by SAXS. The finding of a homotrimer state via crystal structure is a provocative result and the key title claim of this manuscript. Therefore, the editorial team feel it is essential to have strong and rigorous evidence for this result. We all agree with Reviewer 1 that this is currently not the case. The Academic Editor suggests that definitive support for the trimer state can be obtained by doing SEC-SAXS on a mixture of trimer and monomer and getting an envelope for each. We realize that these are difficult times and you may not be able to perform this experiment quickly due to COVID-19-related shutdowns. We do feel rigorous support for this result is necessary however and are willing to be flexible regarding the revision timeline. I have currently given you 6 months; if you need additional time please let us know. We encourage you to preprint the article (e.g. on bioRxiv) and please also know that your manuscript will fall under our scooping protection policy. Please see below for specific feedback regarding addressing Reviewer 1's comments -- First point (discrepancy with Yates et al., 2012) - the Academic Editor notes that the Yates paper is on mousekindlin-3. And while the expression system is a weak argument, he/she notes that the differential heparin step and/or concentration dependence could be factors. The concerns raised in the first point can be addressed via text discussion.- AUC has the same caveats as SEC-MALS and SEC, especially since the trimer has a hole in the middle. As noted above, SEC-SAXS would be the best experiment because an envelope of each peak could be made.- The Academic Editor agrees with Reviewer 1 that the DSSO experiment is not complete and is unconvincing. Crosslinking should be done with monomer to see if there is some interconversion to trimer, especially since you crystallized the monomer and got a trimer. And a MWM ladder that has a higher MWM than 200 kDa should be used (the current gel is inadequate).- The MS data is also weak. It is not clear how many times the crosslink was observed, if this is the only interaction detected, and if so, why. There is also no effort to convince us this is an intermolecular interaction vs intramolecular (by distance arguments), nor whether it is reasonable that 30 Å is OK for a spacer that is 12 Å.- Regarding the second point (large buried surface area) - this should be addressed directly.- Other comments-point 1 (regarding the resolution) - we agree with this concern and it should be addressed and updated, as relevant- Other comments-point 2 - please at least indicate how many times the experiment was done and what type of data is presented (e.g. average).Overall, in light of the reviews, we will not be able to accept the current version of the manuscript. As noted however, we would welcome re-submission of a revised version that takes into account the reviewers' comments and provides rigorous support for your conclusions. Please note that we cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent for further evaluation by the reviewers.We expect to receive your revised manuscript within 6 months. Please email us (plosbiology@plos.org) if you have any questions or concerns, or would like to request an extension. At this stage, your manuscript remains formally under active consideration at our journal; please notify us by email if you do not intend to submit a revision so that we may end consideration of the manuscript at PLOS Biology.**IMPORTANT - SUBMITTING YOUR REVISION**Your revisions should address the specific points made by each reviewer. Please submit the following files along with your revised manuscript:1. A 'Response to Reviewers' file - this should detail your responses to the editorial requests noted above, present a point-by-point response to all of the reviewers' comments, and indicate the changes made to the manuscript.*NOTE: In your point by point response to the reviewers, please provide the full context of each review. Do not selectively quote paragraphs or sentences to reply to. The entire set of reviewer comments should be present in full and each specific point should be responded to individually, point by point.You should also cite any additional relevant literature that has been published since the original submission and mention any additional citations in your response.2. In addition to a clean copy of the manuscript, please also upload a 'track-changes' version of your manuscript that specifies the edits made. This should be uploaded as a "Related" file type.*Re-submission Checklist*When you are ready to resubmit your revised manuscript, please refer to this re-submission checklist: https://plos.io/Biology_ChecklistTo submit a revised version of your manuscript, please go to https://www.editorialmanager.com/pbiology/ and log in as an Author. Click the link labelled 'Submissions Needing Revision' where you will find your submission record.Please make sure to read the following important policies and guidelines while preparing your revision:*Published Peer Review*Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. Please see here for more details:https://blogs.plos.org/plos/2019/05/plos-journals-now-open-for-published-peer-review/*PLOS Data Policy*Please note that as a condition of publication PLOS' data policy (http://journals.plos.org/plosbiology/s/data-availability) requires that you make available all data used to draw the conclusions arrived at in your manuscript. If you have not already done so, you must include any data used in your manuscript either in appropriate repositories, within the body of the manuscript, or as supporting information (N.B. this includes any numerical values that were used to generate graphs, histograms etc.). For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5*Blot and Gel Data Policy*We require the original, uncropped and minimally adjusted images supporting all blot and gel results reported in an article's figures or Supporting Information files. We will require these files before a manuscript can be accepted so please prepare them now, if you have not already uploaded them. Please carefully read our guidelines for how to prepare and upload this data: https://journals.plos.org/plosbiology/s/figures#loc-blot-and-gel-reporting-requirements*Protocols deposition*To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosbiology/s/submission-guidelines#loc-materials-and-methodsThank you again for your submission to our journal. We hope that our editorial process has been constructive thus far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.Sincerely,Hashi Wijayatilake, PhD,Managing EditorPLOS Biology*****************************************************REVIEWS:Reviewer #1:The authors made effort to address some of my concerns in the revised manuscript. Unfortunately, the major concerns were not addressed and I remain unconvinced about the physiological relevance of kindlin-3 trimerization, which is the key conclusion/major selling point of the study. In particular, the authors failed to define the minor peak as a trimer in their gel filtration experiment, and such minor peak was not observed in other previous studies. Even if they approved this minor peak were a trimer, the low population of such “trimer” vs monomer would still question the physiological relevance of the trimer. My primary concerns are as follows:First, as I mentioned last time, Yates et al., 2012 only observed kindlin-3 monomer using the similar insect cell expression system. Structurally Yates et al also only observed the monomer. In previous version, the authors ignored this apparent contradiction and simply explained the trimerization they observed in insect cells but not in E. coli was due to the expression condition. In this revised version, the authors argued that the purification protocols are different in the two studies. This is very weak argument. Yates et al purification protocol is standard! If their conditions could not reveal a trimer, I would strongly suspect whether the authors’ experimental conditions generated some non-physiological oligomer in the minor peak position, which the authors claim as a trimer in order to support their crystal structure. Please note that even based on the authors’ purification condition, the monomer is predominant from the gel filtration. The so-called “trimer” might be an oligomer or aggregation depending on the injected protein concentration and some unknown reasons such as disulfide-bond induced cross linking. I say this because the size exclusion chromatography largely depends on stokes radius of molecules that gives uncertain molecular weight (MW) information. Thus, the SEC-MALS (Figure 4c) may not always provide conclusive evidence but limited information for estimating apparent MW of proteins. One cannot eliminate the possibility of the observed minor peak as a dimer or tetramer or an oligomer! Indeed, in the newly generated figure of size exclusion chromatography (Fig. 4a,b), the elution positions of MW standards do not seem to match. More quantitative assessments such as analytical ultracentrifugation (AUC) are needed for characterizing this minor peak. Even if the authors can approve this is a trimer in vitro, the physiological relevance of the minor population of such trimer is questionable.Second, the humankindlin-3 utilized for crystallization was a monomer as the authors described in the main text. This strongly indicates that the trimer they observed in the crystal lattice is due to the crystal packing. This kind of phenomenon was already previously observed in mousekindlin-2 that began with monomeric form during crystallization but was crystallized as a dimer (Li et al., PNAS, 2017). Consistent with my view of the crystallization artifact, the large buried surface area (~1,850 A^2) in the trimer interface is huge. Such huge interface would lead to a very tight trimer as a major form. By contrast, the authors observed the monomer predominantly and so-called “trimer” was a very minor peak in the size exclusion experiment. This again indicates that the so-called “trimer” in the crystal structure is physiologically irrelevant, which is clearly a crystallization artifact.Other comments:1), the crystallographic data collection statistics is still poorly characterized. The authors failed to incorporate the Rmerge/R-meas in the data collection statistics table that is essential component for the main table in crystal structure report. Demonstration of all the essential components in the data collection and refinement statistics in the main table is crucial. The R-meas of over 500% in outer shell (500% discrepancy for the measured intensities!) are not acceptable by standard criteria. The resolution limit would be thus around at 4.3-A according to their statistics. The authors need to more carefully reevaluate the resolution limit followed by structure refinement. The authors also need to state the number of native data sets to be merged in the method section.2), the ITC measurement for the binding of kindlin-2/-3 to integrin has been criticized by all three reviewers but the authors did not seem to reply to their concerns for distinct binding affinity between two isoforms of kindlin and technical viewpoint. No saturation point was observed for the binding between monomeric kindlin-3 and integrin (Fig. S9a), but was observed for monomeric kindlin-2 (~200 uM vs. 13 uM).3). Fig. S10 seems to be the overlay of two structures instead of three as described in legendary.4). Line 540, typo, grid. There are several other typographical errors and uncertain sentences in the revised text.--Reviewer #2:The authors made a nice effort to address my previous concerns. I am fully satisfied with their approach at this point and recommend the paper for publication.--Reviewer #3:The authors made large changes to the manuscript in response to the comments. The rather speculative at this stage phosphorylation part of the study is completely removed, making the paper clear and focused. Now the story is straightforward: trimers are observed by crystallography and detected in cells; trimers do no bind integrin; mutants disrupting trimer formation enhance intergrin activation; therefore, trimer formation may be a mechanism of kindlin activity regulation and should be considered in the functional models. In addition, dimers that were previously proposed as important, have not been detected and may have been an artefact of truncation in the previous studies. In my view these are important messages for the field which may lead to a revised functional model of kindlin activity.All my comments have been addressed, mainly by the removal of more speculative or poor quality data. Writing now is clear an easy to follow.The only surprising omission is the lack of ITC data for K2 trimer. This should be fairly simple to measure as the authors have both monomers and trimers of K2. I suggest that these data are included in the manuscript.16 Apr 2020Submitted filename: Point-to-point responses_20200416.pdfClick here for additional data file.11 May 2020Dear Dr Gao,Thank you for submitting your revised Research Article entitled "Structural basis of human full-length kindlin-3 homotrimer in an auto-inhibited state" for publication in PLOS Biology. We have now discussed the revision with the Academic Editor. We appreciate your addition of more analytical details, including monomer cross linking that shows a trimer and a SEC trace of the results with and without monomer cross linking. We are willing to accept some of the rebuttals and responses provided to the other requests. However, in order to proceed, we will need the raw mass spec data provided, and the related analyses should be presented directly in the paper (e.g. MS spectrum of crosslinked peptide, corresponding fragmentation spectrum, fragment mass match accuracy, ion assignments).Please also address the following points:> Data Availability Statement: Please update your Data Availability Statement with crystal structure deposition information and code/s. The Materials and Methods section has the following statement: "Coordinates and structure factors have been deposited in the Protein Data Bank with accession code 6AEN" - please also duplicate this in the Data Availability Statement.> This PDB 6AEN dataset also needs to be publicly released (currently 'on hold')> As noted above, please provide the MS analysis data. Here are the recommended repositories for this type of data:https://journals.plos.org/plosbiology/s/recommended-repositorieshttps://massive.ucsd.edu/ProteoSAFe/static/massive.jsp> Please also make sure to address the other numerical data and other policy-related requests noted at the end of this email.We expect to receive your revised manuscript within two weeks. Your revisions should address the specific points made by each reviewer. In addition to the remaining revisions and before we will be able to formally accept your manuscript and consider it "in press", we also need to ensure that your article conforms to our guidelines. A member of our team will be in touch shortly with a set of requests. As we can't proceed until these requirements are met, your swift response will help prevent delays to publication.*Copyediting*Upon acceptance of your article, your final files will be copyedited and typeset into the final PDF. While you will have an opportunity to review these files as proofs, PLOS will only permit corrections to spelling or significant scientific errors. Therefore, please take this final revision time to assess and make any remaining major changes to your manuscript.NOTE: If Supporting Information files are included with your article, note that these are not copyedited and will be published as they are submitted. Please ensure that these files are legible and of high quality (at least 300 dpi) in an easily accessible file format. For this reason, please be aware that any references listed in an SI file will not be indexed. For more information, see our Supporting Information guidelines:https://journals.plos.org/plosbiology/s/supporting-information*Published Peer Review History*Please note that you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. Please see here for more details:https://blogs.plos.org/plos/2019/05/plos-journals-now-open-for-published-peer-review/*Early Version*Please note that an uncorrected proof of your manuscript will be published online ahead of the final version, unless you opted out when submitting your manuscript. If, for any reason, you do not want an earlier version of your manuscript published online, uncheck the box. Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us as soon as possible if you or your institution is planning to press release the article.*Protocols deposition*To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosbiology/s/submission-guidelines#loc-materials-and-methods*Submitting Your Revision*To submit your revision, please go to https://www.editorialmanager.com/pbiology/ and log in as an Author. Click the link labelled 'Submissions Needing Revision' to find your submission record. Your revised submission must include a cover letter, a Response to Reviewers file that provides a detailed response to the reviewers' comments (if applicable), and a track-changes file indicating any changes that you have made to the manuscript.Please do not hesitate to contact me should you have any questions.Sincerely,Hashi Wijayatilake, PhD,Managing EditorPLOS Biology------------------------------------------------------------------------DATA POLICY:You may be aware of the PLOS Data Policy, which requires that all data be made available without restriction: http://journals.plos.org/plosbiology/s/data-availability. For more information, please also see this editorial: http://dx.doi.org/10.1371/journal.pbio.1001797Note that we do not require all raw data. Rather, we ask that all individual quantitative observations that underlie the data summarized in the figures and results of your paper be made available in one of the following forms:1) Supplementary files (e.g., excel). Please ensure that all data files are uploaded as 'Supporting Information' and are invariably referred to (in the manuscript, figure legends, and the Description field when uploading your files) using the following format verbatim: S1 Data, S2 Data, etc. Multiple panels of a single or even several figures can be included as multiple sheets in one excel file that is saved using exactly the following convention: S1_Data.xlsx (using an underscore).2) Deposition in a publicly available repository. Please also provide the accession code or a reviewer link so that we may view your data before publication.Regardless of the method selected, please ensure that you provide the individual numerical values that underlie the summary data displayed in the following figure panels as they are essential for readers to assess your analysis and to reproduce it:Figs. 2D, 4ABC, 5C, 6BC, S7B, S9, S10NOTE: the numerical data provided should include all replicates AND the way in which the plotted mean and errors were derived (it should not present only the mean/average values).**As noted above, please also provide the MS analysis data. Here are the recommended repositories for this type of data:https://journals.plos.org/plosbiology/s/recommended-repositorieshttps://massive.ucsd.edu/ProteoSAFe/static/massive.jsp**Please also ensure that figure legends in your manuscript include information on where the underlying data can be found, and ensure your supplemental data file/s has a legend.**Please ensure that your Data Statement in the submission system accurately describes where your data can be found.------------------------------------------------------------------------BLOT AND GEL REPORTING REQUIREMENTS:PLOS Biology requires the original, uncropped and minimally adjusted images supporting all blot and gel results reported in an article's figures or Supporting Information files. We will require these files before a manuscript can be accepted so please prepare and upload them now. Please carefully read our guidelines for how to prepare and upload this data: https://journals.plos.org/plosbiology/s/figures#loc-blot-and-gel-reporting-requirements------------------------------------------------------------------------18 Jun 2020Submitted filename: Point-to-point responses_20200416.pdfClick here for additional data file.22 Jun 2020Dear Dr Gao,On behalf of my colleagues and the Academic Editor, Raquel L. Lieberman, I am pleased to inform you that we will be delighted to publish your Research Article in PLOS Biology.The files will now enter our production system. You will receive a copyedited version of the manuscript, along with your figures for a final review. You will be given two business days to review and approve the copyedit. Then, within a week, you will receive a PDF proof of your typeset article. You will have two days to review the PDF and make any final corrections. If there is a chance that you'll be unavailable during the copy editing/proof review period, please provide us with contact details of one of the other authors whom you nominate to handle these stages on your behalf. This will ensure that any requested corrections reach the production department in time for publication.Early VersionThe version of your manuscript submitted at the copyedit stage will be posted online ahead of the final proof version, unless you have already opted out of the process. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.PRESSWe frequently collaborate with press offices. If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximise its impact. If the press office is planning to promote your findings, we would be grateful if they could coordinate with biologypress@plos.org. If you have not yet opted out of the early version process, we ask that you notify us immediately of any press plans so that we may do so on your behalf.We also ask that you take this opportunity to read our Embargo Policy regarding the discussion, promotion and media coverage of work that is yet to be published by PLOS. As your manuscript is not yet published, it is bound by the conditions of our Embargo Policy. Please be aware that this policy is in place both to ensure that any press coverage of your article is fully substantiated and to provide a direct link between such coverage and the published work. For full details of our Embargo Policy, please visit http://www.plos.org/about/media-inquiries/embargo-policy/.Thank you again for submitting your manuscript to PLOS Biology and for your support of Open Access publishing. Please do not hesitate to contact me if I can provide any assistance during the production process.Kind regards,Alice MussonPublishing Editor,PLOS Biologyon behalf ofDi Jiang, PhD,Senior EditorPLOS Biology
Authors: Benjamin T Goult; Mohamed Bouaouina; Paul R Elliott; Neil Bate; Bipin Patel; Alexandre R Gingras; J Günter Grossmann; Gordon C K Roberts; David A Calderwood; David R Critchley; Igor L Barsukov Journal: EMBO J Date: 2010-02-11 Impact factor: 11.598
Authors: Huong T T Nguyen; Zhen Xu; Xiaofeng Shi; Shuzhen Liu; Marie L Schulte; Gilbert C White; Yan-Qing Ma Journal: J Thromb Haemost Date: 2021-08-31 Impact factor: 16.036
Authors: Panagiota Bouti; Steven D S Webbers; Susanna C Fagerholm; Ronen Alon; Markus Moser; Hanke L Matlung; Taco W Kuijpers Journal: Front Immunol Date: 2021-02-18 Impact factor: 7.561