LncRNA CRNDE modulates cardiac progenitor cells' proliferation and migration via the miR-181a/LYRM1 axis in hypoxia.

BACKGROUND: The cardiac progenitor cells provide a valuable method for myocardial infarction related heart failure therapies. But cardiac progenitor cell quickly loses the proliferation abilities during the myocardial infarction. In this paper, we aim to explore the role of lncRNA CRNDE in the modulation of cardiac progenitor cell reproduction and migration.
METHODS: Cardiac progenitor cells were isolated from neonatal adult Sprague-Dawley rats by removing the heart and homogenizing the tissue. Various siRNAs and RNA mimics were co-transfected to the cells. A list of characterization methods, including qRT-PCR, Western blotting, luciferase assay, CCK-8 assay, and EdU incorporation assay, were utilized to verify the roles and interactions of CRNDE, miR-181a, and LYRM1 in cardiac progenitor cells' proliferation and migration potentials.
RESULTS: LncRNA CRNDE expressions were substantially promoted in the CoCl2-related hypoxia cardiac progenitor cell model. CRNDE suppression inhibited cardiac progenitor cell reproduction and migration under hypoxic conditions. The miR-181a-inhibitor restored the reproduction and migration potentials of cardiac progenitor cells after CRNDE knockdown in hypoxia. LYR motif containing 1 (LYRM1) was a target of miR-181a, and miR-181a negatively modulated its expressions. LYRM1 knockdowns inhibited miR-181a-inhibitor's protective effects for cardiac progenitor cell functions in hypoxia.
CONCLUSIONS: Our experiments and analysis demonstrated that CRNDE could modulate cardiac progenitor cell proliferation and migration potentials via the miR-181a/LYRM1 axis in hypoxia. 2020 Journal of Thoracic Disease. All rights reserved.

Introduction

Myocardial infarction is a severe cardiovascular disease and a significant risk to human life (1). It could cause heart failure and malignant arrhythmia with high morbidities and mortalities (2). Inflammatory responses and cardiomyocyte apoptosis are the most significant outcomes from myocardial infarction (3). Cell apoptosis of cardiomyocytes after myocardial infarction usually causes ventricular remodeling as well as heart failure (4). In this research, we will be focused to explore the mechanisms for cardiac progenitor cell reproduction in myocardial infarction related heart failure.

Long non-coding RNAs (lncRNAs) are a group of RNAs that participate in many kinds of cellular events, such as cell growth, differentiation, and proliferation (5,6). Previous findings suggest that circulating lncRNAs are useful markers for the diagnosis of cardiovascular disease (7,8). For example, several circulating lncRNAs have been discovered as prognostic biomarkers for heart failure, including HOTAIR (9), H19 (10), LIPCR (11), and EGOT (12). The lncRNA CRNDE (colorectal neoplasia differentially expressed gene) is transcribed from chromosome 16 on the strand opposite to the adjacent IRX5 gene (13). LncRNA CRNDE promoted colorectal cancer cell proliferation and chemoresistance via miR-181a-5p-mediated regulation of Wnt/β-catenin signaling (13). According to Ma et al., CRNDE was involved in the regulation of granulocytic differentiation of acute promyelocytic leukemia (14). But it has not been elucidated whether CRNDE has any effect in the reproduction or migration of cardiac progenitor cells. Inspired by bioinformatic prediction and previous work (13), we are interested in the role of CRNDE in myocardial infarction, and therefore we carried a series of experiments in vitro and in vivo for this investigation.

MicroRNAs (miRNAs, ~24 nucleotides) have been reported to affect the stability and translation of messenger RNAs (15). Many reports have revealed that miRNAs could regulate cell apoptosis, reproduction, development, and differentiation (16). In 2016, Zhu et al. demonstrated the potential of using circulating miR-181a as a novel biomarker for the diagnosis of acute myocardial infarction (17). The expressions of circulating miR-181a in patients with AMI were substantially changed in a time-dependent manner, indicating the value of plasma miR-181a as a novel biomarker for diagnosing MI (17). Herein, we aim to investigate the mysteries of miR-181a and its interactions with CRNDE in myocardial infarction.

According to Qiu, Homo sapiens LYR motif containing 1 (LYRM1) could enhance proliferation and inhibits apoptosis of preadipocytes (18). Zhu et al. reported that LYRM1 increased reproduction and inhibited cell apoptosis during heart development (19). However, its functional mechanism remains to be clarified. In our experiments, we are determined to evaluate the cells’ abilities of proliferation and migration under transfections with LYRM1 over-expression or knockdown. Our experiments, results, and analysis may provide valuable information on its roles in myocardial infarction.

Methods

Cardiac progenitor cell culture

Cardiac progenitor cells were isolated from neonatal adult Sprague-Dawley rats by removing the heart and homogenizing the tissue as described (20). The cardiac progenitor cells were then incubated in DMEM +10% FBS (Gibco, HyClone, USA). After that, cardiac progenitor cells were kept at thirty-seven Celsius and 5% CO2. All procedures on rats are in accordance with the guidelines of the Animal Ethics Committee of The First Affiliated Hospital of Fujian Medical University. All the experiments were conducted according to the principles expressed in the Declaration of Helsinki and conform to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health.

miRNA and siRNA

si-CRNDE (5'-GTGCTCGAGTGGTTTAAAT-3') and si-LYRM1 (5'-GCAATCATTTCTAGACTAA-3') were made from GenePharma, China. miR-181a-mimic (5'-AACAUUCAACGCUGUCGGUGAGU-3') and miR-181a-inhibitor (5'-ACUCACCGACAGCGUUGAAUGUU-3') were provided by RiboBio, China.

Transfections

The transfections of siRNAs and miRNAs in cardiac progenitor cells were carried out by lipofectamine-2000 (Invitrogen, USA). Prior to transfections, we incubated cardiac progenitor cells in the medium. si-CRNDE or si-LYRM1, and miR-181a-mimic or miR-181a-inhibitor were transfected to the cells with lipofectamine 2000 (Invitrogen, USA).

Quantitative real time-PCR (qRT-PCR)

RNAs were extracted by Trizol (Invitrogen, USA). We made cDNA by EasyScript and SuperMix (Transgen biotech, USA). 10 ng cDNA was prepared for qRT-PCR by SYBR Green in Prism 7500 (Applied Biosystems, Thermo Fisher Scientific, USA). GAPDH and U6 were controls. showed the primer sequences.

Table 1

Sequences of primers used in qRT-PCR

Name	Forward primer (5'-3')	Reversed primer (5'-3')
CRNDE	CGATCGCGCTATTGTCATGG	TCCGCCTCGCTTAGACATTG
miR-181a	GCGGCAACATTCAACGCTGTCGGTGAGT	GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTG
LYRM1	AGGGCAGATGGAAGACACC	GATGGATAGGGCGTGGATAA
GAPDH	ATTCAACGGCACAGTCAA	CTCGCTCCTGGAAGATGG
U6	CTCGCTTCGGCAGCACA	AACGCTTCACGAATTTGCGT

LYRM1, LYR motif containing 1.

Western blotting

The cardiac progenitor cells were lysed, and the proteins were separated through SDS-PAGE and transferred to nitrocellulose membranes (Millipore, USA). The membranes were firstly blocked, treated with anti-LYRM1 (1:500, Abcam), then incubated with horseradish peroxidase linked anti-IgG, and visualized by Chemiluminescence Kit (Thermo Fisher Scientific, USA). Gel-pro was used for statistical analysis.

Luciferase reporter assays

The CRNDE-WT (wild-type), CRNDE-MT (mutant), LYRM1-WT, and LYRM1-MT including the common sequences with miR-181a were sub-cloned to luciferase reporter plasmids. The reporter vectors and miR-181a-mimic or NC-mimic were transfected to cardiac progenitor cells with lipofectamine-2000. After 2 days’ transfections, cardiac progenitor cells were lysed for luciferase activities’ measurement.

CCK-8 assays

A total of 5×104 cells/mL of cardiac progenitor cells after various treatments were grown in 96-well plate for 1 day. Then, cardiac progenitor cells were washed, and the levels of cell growth were evaluated by CCK-8 assays (Transgen, USA). Ten mL CCK-8 solution was placed to every well, and let incubations for four hours at thirty-seven Celsius. A microplate reader (Beckman, USA) was used to measure the absorbance at 450 nm.

Cell migration

Cardiac progenitor cells after various treatments were placed on the top transwell chamber (Corning, USA) with DMEM and 0.5% FBS. The bottom chamber had DMEM and 10% FBS. After 1 day’s incubations, the cardiac progenitor cells on the bottom were cleaned, fixed, and stained by 0.1% crystal violet for fifteen minutes. We counted the migration cells by microscopy (Zeiss, USA).

EdU assays

Cardiac progenitor cells were placed in the 24-well plate (1,500 cells/well). EdU was then pipetted to every well and had incaution for two hours. After fixing the cardiac progenitor cells with 4% paraformaldehyde for half an hour at 25 Celsius, we stained cardiac progenitor cells by Apollo (Ribobio) and detected the signals by fluorescence microscope (Zeiss, USA).

Data analysis

SPSS 17.0 was utilized to analyze the data, shown as mean ± SD. T-test was used for comparisons between two groups. The one-way ANOVA test, followed by Bonferroni’s post-hoc test, was performed to analyze the difference for over two groups. P<0.05 was considered significant.

Results

Hypoxia enhanced stem cell proliferation and migration abilities

showed that hypoxia could enhance the cell viabilities of cardiac progenitor cells, which was positively correlated with the dose of CoCl2 (P<0.05, P<0.01) (). From , the cardiac progenitor cell reproduction and migration potentials were also enhanced in CoCl2-related hypoxia. In consistence with the literature, hypoxia could enhance cell reproduction and migration abilities.

Figure 1

Hypoxia enhanced cardiac progenitor cell reproduction and migration. (A) Cell viabilities of cardiac progenitor cells after various levels of CoCl2. (B) EdU assays of the cardiac progenitor cell reproduction potentials after hypoxia. (C) Cell migration assays of the migration potentials of cardiac progenitor cells by CoCl2 treatments (×50 µm). *P<0.05, **P<0.01.

CRNDE affected cardiac progenitor cell proliferation and migration under hypoxic conditions

illustrated the qRT-PCR results that CRNDE expressions substantially increased in a CoCl2 dose-dependent manner (P<0.01). Si-CRNDE was made to suppress the expressions of CRNDE in cardiac progenitor cells (P<0.01) (). In , we noticed that the knockdown of CRNDE substantially reduced the cell viabilities of cardiac progenitor cells in hypoxic conditions (P<0.01). displayed that the reproduction and migration potentials of cardiac progenitor cells were also suppressed after CRNDE suppression in hypoxia. Obviously, CRNDE could affect cardiac progenitor cell reproduction and migration following hypoxic stimuli.

Figure 2

CRNDE affected cardiac progenitor cell proliferation and migration under hypoxic conditions. (A) qRT-PCR for CRNDE mRNA levels in cardiac progenitor cells in hypoxic conditions. (B) qRT-PCR results identified the effectiveness of siRNA against CRNDE in cardiac progenitor cells. (C) Cell viabilities in cardiac progenitor cells after si-CRNDE. (D) EdU assays for cell reproduction abilities in cardiac progenitor cells after CRNDE knockdown. (E) Cell migration assays for cell migration abilities in cardiac progenitor cells after si-CRNDE (×50 µm). **P<0.01.

CRNDE modulated cardiac progenitor cell proliferation and migration via targeting miR-181a in hypoxia

The binding scheme between CRNDE and miR-181a were shown in , with shared binding sequences. According to , CRNDE suppression could greatly elevate miR-181a expressions in both normoxic and hypoxic conditions (P<0.01). showed that miR-181a mimic reduced the luciferase activities of the CRNDE-WT, but didn’t affect the CRNDE-MT (P<0.01). As shown in , the miR-181a expressions were dramatically lowered in cardiac progenitor cells in hypoxia (P<0.05, P<0.01). In addition, the miR-181a-inhibitor substantially restored the cell viabilities (P<0.01) (), and abilities of reproduction () and migration () in cardiac progenitor cells. It was illustrated that CRNDE could modulate cardiac progenitor cell proliferation and migration via miR-181a in hypoxic conditions.

Figure 3

CRNDE modulated cardiac progenitor cell reproduction and migration via targeting miR-181a in hypoxic conditions. (A) The binding sequence of CRNDE and miR-181a. (B) qRT-PCR for miR-181a expressions under si-CRNDE. (C) Luciferase assays verification of miR-181a and CRNDE. (D) miR-181a expression levels in cardiac progenitor cells in hypoxia. (E) CCK-8 assays for the cell viabilities in cardiac progenitor cells transfected with si-CRNDE and miR-181a-inhibitor after hypoxia. (F) EdU assays for cell reproduction abilities in the cardiac progenitor cell by si-CRNDE+ miR-181a-inhibitor. (G) Cell migration assays for the cell migration abilities in cardiac progenitor cells by si-CRNDE+ miR-181a-inhibitor (×50 µm). *P<0.05, **P<0.01.

LYRM1 suppressions lowered the protection from miR-181a-inhibitor on cardiac progenitor cells after hypoxia

used PicTar and TargetScan to predict that LYRM1 was a target of miR-181a. It shows that miR-181a mimic substantially repressed the luciferase activities of cell transfected with LYRM1-WT (P<0.01). But miR-181a mimic didn’t suppress the luciferase activities of LYRM1-MT. It indicated that LYRM1 was targeted by miR-181a. discovered that LYRM1 expressions were decreased in cardiac progenitor cells after transfecting with miR-181a-mimic but increased in cardiac progenitor cells by miR-181a-inhibitor (P<0.01). showed that LYRM1 expressions were promoted in CoCl2-related hypoxia (P<0.05, P<0.01). illustrated that mRNA and protein levels of LYRM1 were markedly reduced in cardiac progenitor cells after siLYRM1 transfections (P<0.01). However, LYRM1 knockdown in cardiac progenitor cells under hypoxic conditions repressed cell viabilities (), reproduction () and migration () abilities that were induced by miR-181a-inhibitor (P<0.01). It indicated that miR-181a modulated cardiac progenitor cell functions though LYRM1.

Figure 4

LYRM1 suppressions lowered the protection from miR-181a-inhibitor on cardiac progenitor cells after hypoxia. (A) TargetScan to predict that LYRM1 was a target of miR-181a, and luciferase reporter assays in miR-181a and LYRM1. (B) qRT-PCR and western blotting for LYRM1 expressions in cardiac progenitor cells with transfections of miR-181a-mimic and miR-181a-inhibitor. (C) mRNA’s expressions and protein’s expressions of LYRM1 in cardiac progenitor cells after hypoxia. (D) mRNA expressions and protein levels by si-LYRM1 in cardiac progenitor cells. (E) CCK-8 assays for the cell viabilities in cardiac progenitor cells transfected with si-LYRM1 after miR-181a inhibitions in hypoxia. (F) EdU incorporation assays for cell proliferation potentials in cardiac progenitor cells transfected with siLYRM1 after miR-181a inhibitions under hypoxic conditions. (G) Cell migration assays for cell migration potentials in cardiac progenitor cells transfected with siLYRM1 after miR-181a inhibitions by hypoxia (×50 µm). *P<0.05, **P<0.01. LYRM1, LYR motif containing 1.

Si-LYRM1 inhibited CPC viability and migration ability

Then, we assessed the effect of si-LYRM1 on CPCs’ viability and migration ability. According to , si-LYRM1 greatly inhibited the cell viability of CPC, in contrast to the si-NC. From , we found that si-LYRM1 also suppressed cell proliferation and migration abilities. It was obvious that the knockdown of LYRM1 inhibited CPC viability and migration ability.

Figure 5

Si-LYRM1 inhibited CPC viability and migration ability. (A) Cell viability of CPC transfected with si-NC or si-LYRM1. (B) Cell proliferation potentials in cardiac progenitor cells after transfection with si-NC or si-LYRM1. (C) Cell migration assays for cell migration potentials in cardiac progenitor cells after transfection with si-NC or si-LYRM1 (×50 µm). **P<0.01. LYRM1, LYR motif containing 1.

CRNDE modulated CRNDE/miR-181a/LYRM1 in cardiac progenitor cells after hypoxia

According to , the mRNA and the protein levels of LYRM1 were dramatically reduced after CRNDE suppression (P<0.01). It suggested that LYRM1 was positively correlated with CRNDE. In , cell viabilities were suppressed by si-CRNDE but were elevated by miR-181a-inhibitor. But the addition of si-LYRM1 attenuated this effect. Similarly, we found that CRNDE/miR-181a/LYRM1 axis affected cardiac progenitor cell reproduction () and migration () abilities under hypoxic conditions (P<0.01). Overall, our results suggested that CRNDE exerted its roles in modulating cardiac progenitor cell reproductions and migration by upregulation of LYRM1 by targeting miR-181a.

Figure 6

CRNDE exerted its roles in regulating cardiac progenitor cell reproduction and migration in hypoxia via the CRNDE/miR-181a/LYRM1 axis. (A) mRNA’s expressions and the protein’s expressions of LYRM1 in cardiac progenitor cells after CRNDE suppression. (B) CCK-8 assays for cell viabilities in cardiac progenitor cells in hypoxia. (C) Cell proliferation potentials in cardiac progenitor cells after treatments under hypoxia. (D) Cell migration assays for cell migration potentials in cardiac progenitor cells (×50 µm). **P<0.01. LYRM1, LYR motif containing 1.

Discussion

It was well known that cardiac progenitor cells can quickly lose their reproduction abilities in infarcted myocardium activities (21). CCK-8 assays results found that hypoxia could enhance the cell viabilities of cardiac progenitor cells, which was positively correlated with the dose of CoCl2. The reproduction and migration potentials of cardiac progenitor cells were also enhanced in CoCl2-related hypoxia. Previous reports revealed that the expression levels of lncRNA CRNDE attenuated cardiac fibrosis via Smad3-Crnde negative feedback in diabetic cardiomyopathy (22), and also participated in the regulation of the proliferation and migration of vascular smooth muscle cells (23). The qRT-PCR results that CRNDE expressions substantially increased in a CoCl2 dose-dependent manner. The knockdown of CRNDE considerably reduced the cell viabilities of cardiac progenitor cells in hypoxic conditions. The reproduction and migration potentials of cardiac progenitor cells were also suppressed after CRNDE suppression in hypoxia. In agreements with previous findings, we also found that CRNDE could affect cardiac progenitor cell proliferation and migration by hypoxic stimuli.

MiRNAs were proved to participate in the regulation of a variety of cellular events such as apoptosis, reproduction, development, and differentiation (24,25). For instance, circulating miR-181a as a potential novel biomarker for diagnosis of acute myocardial infarction. Circulating miR-181a levels in patients with MI were substantially changed in a time-dependent manner, indicating the value of plasma miR-181a as a novel biomarker for diagnosing MI (17). Ji et al. demonstrated that CRNDE enhances hepatocellular carcinoma cell proliferation, invasion, and migration via regulating the miR-203/BCAT1 axis (26). It was shown that CRNDE could bind with some specific miRNAs and exert its biological functions in cellular processes (13,26). In our study, CRNDE suppression could much elevate miR-181a expressions, and miR-181a-mimic inhibited the luciferase activities of CRNDE-WT but didn’t affect the CRNDE-MT. Additionally, miR-181a-inhibitor substantially restored the cell viabilities and abilities of reproduction and migration in cardiac progenitor cells following a CRNDE knockdown under hypoxic stimuli. For the first time, we discovered that CRNDE could regulate cardiac progenitor cell proliferation and migration by targeting miR-181a in hypoxic conditions.

According to Chen, knockdown of LYRM1 substantially inhibited reproduction and differentiation and enhanced apoptosis in an embryonic carcinoma cell model of cardiac differentiation (27). In our experiments, LYRM1 expressions were decreased in cardiac progenitor cells by miR-181a mimic but elevated by miR-181a-inhibitor. MiR-181a mimic substantially repressed the luciferase activities of cell transfected with LYRM1-WT. But miR-181a-mimic didn’t suppress the luciferase activities of LYRM1-MT. It is quite possible that miR-181a could bind with LYRM1. What’s more, LYRM1 knockdown in cardiac progenitor cells under hypoxic conditions repressed cell viabilities, proliferation, and migration abilities that were induced by miR-181a-inhibitor. As far as we know, we are the first to report that miR-181a modulated cardiac progenitor cell functions though LYRM1.

Li demonstrated that lncRNA MALAT1 enhanced cardiac progenitor cell reproduction and migration via up-regulating JMJD6 via targeting miR-125 mRNA (28). In a similar pattern, we found that the protein levels of LYRM1 were dramatically reduced after CRNDE suppression, and LYRM1 was positively correlated with CRNDE. In consistence with previous findings, it was confirmed that CRNDE/miR-181a/LYRM1 axis affected cardiac progenitor cell proliferation and migration abilities under hypoxic conditions. CRNDE exerted its roles in modulating cardiac progenitor cell reproduction and migration by the upregulation of LYRM1 via sponging miR-181a.

It is well known that lncRNAs can act as competing endogenous RNA (ceRNA) or molecular sponges to exert “sponge-like” effects on many specific miRNAs, resulting to the downregulation of miRNA levels, upregulation of mRNA levels (target genes), and inhibition of miRNA/mRNA-mediated functions (29,30). In this study, the lncRNA CRNDE functioned as a molecular sponge for miR-181a to modulate the expression of LYRM1 under CoCl2-regulated hypoxia conditions. The upregulated CRNDE induced by hypoxia isolates miR-181a by binding with it, thus reducing the regulation of miR-181a on LYRM1 and promoting the expression of LYRM1, and vice versa.

Conclusions

Our finding demonstrated that CRNDE could modulate cardiac progenitor cell proliferation and migration potentials via the miR-181a/LYRM1 axis in hypoxia. The results may provide a new regulatory mechanism for cardiac progenitor cell reproduction in hypoxia and a new target for MI-related heart failure therapy.

The article’s supplementary files as