| Literature DB >> 32641984 |
Dandan Li1,2, Jiawei Zhang1,2, Jinming Li1,2,3.
Abstract
In December 2019, a new coronavirus disease (COVID-19) outbreak occurred in Wuhan, China. Severe acute respiratory syndrome-coronavirus-2 (SARS-CoV-2), which is the seventh coronavirus known to infect humans, is highly contagious and has rapidly expanded worldwide since its discovery. Quantitative nucleic acid testing has become the gold standard for diagnosis and guiding clinical decisions regarding the use of antiviral therapy. However, the RT-qPCR assays targeting SARS-CoV-2 have a number of challenges, especially in terms of primer design. Primers are the pivotal components of a RT-qPCR assay. Once virus mutation and recombination occur, it is difficult to effectively diagnose viral infection by existing RT-qPCR primers. Some primers and probes have also been made available on the WHO website for reference. However, no previous review has systematically compared the previously reported primers and probes and described how to design new primers in the event of a new coronavirus infection. This review focuses on how primers and probes can be designed methodically and rationally, and how the sensitivity and specificity of the detection process can be improved. This brief review will be useful for the accurate diagnosis and timely treatment of the new coronavirus pneumonia. © The author(s).Entities:
Keywords: SARS-CoV-2; coronavirus; primer design; quantitative nucleic acid testing; sensitivity
Mesh:
Substances:
Year: 2020 PMID: 32641984 PMCID: PMC7330846 DOI: 10.7150/thno.47649
Source DB: PubMed Journal: Theranostics ISSN: 1838-7640 Impact factor: 11.556
Figure 1The analysis process of primer and probe design for SARS-CoV-2 in chronological order. BALF: bronchoalveolar lavage fluid; GISAID: Global Initiative on Sharing All Influenza Data.
Detailed information of the reference sequence MN908947
| ORF | Function | Location (nt) | Length (bp) |
|---|---|---|---|
| 5' UTR | 1-265 | 265 | |
| 1ab | 266-21,555 | 21,290 | |
| 1a | Encoded nonstructural proteins (nsp1 to nsp11), essential for viral replication, viral assembly, immune response modulation, etc. | -- | -- |
| 1b | Encoded nonstructural proteins (nsp12 to nsp16), essential for viral replication | -- | -- |
| S | Binding to cell receptor and mediating virus-cell fusion | 21,563-25,384 | 3,822 |
| 3a | Accessory protein | 25,393-26,220 | 828 |
| 3b | Accessory protein | 25,765-26,220 | 456 |
| E | Envelope protein, virus assembly, and morphogenesis | 26,245-26,472 | 228 |
| M | Membrane protein, virus assembly | 26,523-27,191 | 669 |
| 6 | Accessory protein | 27,202-27,387 | 186 |
| 7a | Accessory protein | 27,394-27,759 | 366 |
| 7b | Accessory protein | 27,756-27,887 | 132 |
| 8 | Accessory protein | 27,894-28,259 | 366 |
| N | Nucleocapsid protein, forms complexes with genomic RNA, interaction with M protein for viral assembly | 28,274-29,533 | 1,260 |
| 10 | Accessory protein | 29,558-29,674 | 117 |
| 3' UTR | 29,675-29,903 | 229 |
Information regarding the primers and probes reported for SARS-CoV-2 real-time reverse-transcription PCR assays
| Target genes | Country | Name | Sequence (5' → 3') | Reference sequence | Nucleotide position | Reference |
|---|---|---|---|---|---|---|
| RdRp | China | Forward primer: | CAAGTGGGGTAAGGCTAGACTTT | -- | 14961-14983 | |
| RdRp /nCoV | Paris | Forward primer: | ATGAGCTTAGTCCTGTTG | SARS-CoV, NC_004718 | 12621-12727 | |
| RdRp/nCoV | Paris | Forward primer: | GGTAACTGGTATGATTTCG | SARS-CoV, NC_004718 | 14010-14116 | |
| RdRp gene | Germany | Forward primer; | GTGARATGGTCATGTGTGGCGG | MN908947 | 15431-15452 | |
| ORF1a | China | Forward primer: | AGAAGATTGGTTAGATGATGATAGT | Alignment of sequenced virus genomes | -- | |
| ORF 1ab | China | Forward primer: | TGATGATACTCTCTGACGATGCTGT | MN908947 | 15704-15728 | |
| ORF 1ab | China | Forward primer: | CCCTGTGGGTTTTACACTTAA | MN908947 | 13342-13362 | |
| ORF1b-nsp14 | Hong Kong | Forward primer: | TGGGGYTTTACRGGTAACCT | MN908947 | 18778-18797 | |
| N gene | China | Forward primer: | GGGGAACTTCTCCTGCTAGAAT | MN908947 | 28881-28902 | |
| N gene | Hong Kong | Forward primer, | TAATCAGACAAGGAACTGATTA | MN908947 | 29145-29166 | |
| N1 gene | USA | Forward primer: | GAC CCC AAA ATCAGCGAA AT | MN908947 | 28287-28306 | |
| N2 gene | USA | Forward primer: | TTACAA ACATTGGCCGCA AA | MN908947 | 29164-29183 | |
| N3 gene | USA | Forward primer: | GGGAGCCTTGAA TAC ACC AAA A | MN908947 | 28681-28702 | |
| NIID_2019-nCOV_N_F2 | Japan | Forward primer: | AAATTTTGGGGACCAGGAAC | MN908947 | 29125-29144 | |
| N gene | Thailand | Forward primer: | CGTTTGGTGGACCCTCAGAT | MN908947 | 28320-28339 | |
| E gene | Germany | Forward primer: | ACAGGTACGTTAATAGTTAATAGCGT | MN908947 | 26269-26294 | |
| Spike | China | Forward primer: | CCTACTAAATTAAATGATCTCTGCTTTACT | MN938384 | 22712-22741 | |
| RNase P gene (RP) | USA | Forward primer: | AGATTTGGACCTGCGAGCG | CDC internal | -- | |
| GAPDH | China | Forward primer: | TCAAGAAGGTGGTGAAGCAGG | internal | -- |
Abbreviations: E, envelope protein gene; M, membrane protein gene; N, nucleocapsid protein gene; ORF, open reading frame; RdRp, RNA-dependent RNA polymerase gene; FAM, 6-carboxyfluorescein; BBQ, blackberry quencher; BHQ-1, black hole quencher 1; TAMRA, carboxytetramethylrhodamine; IBFQ, Iowa Black FQ.
Figure 2Sequence alignment of the reference (MN908947) and SARS (NC_004718) sequences. Red colour marks the mismatch positions and pink colour marks the forward primer and reverse complementary sequence of the reverse primer in the study by Corman et al. 33.
Figure 3Secondary structures of the ORF 1ab and N gene fragments amplified using the forward and reverse primers. (A) The forward primer and reverse complementary sequence of the reverse primer for ORF 1ab from China are indicated in red. (B) The forward primer and reverse complementary sequence of the reverse primer for ORF1b from Hong Kong are shown in light blue. (C) The forward primer and reverse complementary sequence of the reverse primer for RdRp from Germany are shown in pink. (D) The forward primer and reverse complementary sequence of the reverse primer for the N1 gene from USA are shown in yellow and the N gene in Thailand are shown in dark blue. (E) The forward primer and reverse complementary sequence of the reverse primer for the N2 gene from USA are shown in yellow, the N gene from Hong Kong are shown in light blue, and the N gene from Japan are shown in green. (G) The forward primer and reverse complementary sequence of the reverse primer for the N3 gene from USA are shown in yellow and the N gene from China in red. Orange represents the overlap. F represents the forward primer and R represents the reverse complementary sequence of the reverse primer.
List of practical primer design tools
| Aim | Name | Software or Website |
|---|---|---|
| Secondary structure prediction | Mfold | |
| RNAfold | ||
| RNAStructure | ||
| SFold | ||
| Primer design | Primer Premier | Software |
| Primer Express | Software | |
| DNAMAN | Software | |
| Oligo 7 | Software | |
| Prime3 Plus | ||
| QuantPrime | ||
| Primer Blast | ||
| Primer bank | ||
| JCVI Primer Designer | ||
| Test the primer specificity | NCBI Primer-BLAST | |
| Primer Blast |
Figure 4The entire flow of primer design. (A) Establishment of the reference sequence. Different types of samples are collected, RNA is extracted, and then high-throughput sequencing is performed to determine the reference sequence. Alternatively, after multiple sequencing results are aligned, the reference sequence can be determined. (B) Identification of the target genes. By comparing the SARS-CoV-2 genome with other bat-associated SARS-related viral genomes, conserved and non-conserved regions were identified. Conserved regions such as ORF 1ab, E gene and N gene can be used as target genes for designing primers. Primers are designed at the same target region (E gene) of SARS-CoV-2 genome and bat-associated SARS-related viral genes for pan-sarbecovirus detection. Specific primer probes can be designed for specific target gene regions of SARS-CoV-2 (ORF 1ab and N gene) for confirmation experiments. (C) Improving the sensitivity of the RT-qPCR assay. Primers are designed according to the general principles of primers or by using software. Degenerate primers can increase the sensitivity of the reaction. When using primers to detect the target gene, if the target gene is mutated, the universal primer may amplify, but the degenerate primer can make a false negative result into a positive result (Grey heads indicate that false negative results become positive results). After considering the secondary structure of the target gene, the target gene on the stem can prevent RNA from being cleaved by RNase A, which can also increase the detection rate. NCBI Primer-BLAST verifies the specificity of the primers. In the experimental process of the designed primer probe, dual-target detection and multi-target detection can also improve the sensitivity of the reaction. The probe is labelled with different fluorescent dyes, or each target gene is detected in a separate assay with the probes labelled with the same fluorescent dye.