Literature DB >> 32626976

Schizophrenia‑associated microRNA‑148b‑3p regulates COMT and PRSS16 expression by targeting the ZNF804A gene in human neuroblastoma cells.

Shanshan Wu1, Pengjie Wang1, Ran Tao2, Pengbo Yang3, Xiaorui Yu3, Ye Li1, Qiuya Shao3, Fayi Nie3, Jing Ha3, Rui Zhang4, Ye Tian5, Jie Ma1.   

Abstract

Zinc finger protein 804A (ZNF804A) has been identified by genome‑wide association studies as a robust risk gene in schizophrenia, but how ZNF804A contributes to schizophrenia and its upstream regulation remains unknown. Previous studies have indicated that microRNAs (miRs) are key factors that regulate the expression levels of their target genes. The present study revealed significantly increased expression of miR148b‑3p in the peripheral blood of patients with first‑onset schizophrenia compared with healthy controls, and bioinformatics analysis predicted that the ZNF804A gene is a target of miR148b‑3p. Therefore, the present study investigated the possible upstream regulation of ZNF804A by miR148b‑3p in the human neuroblastoma SH‑SY5Y cell line, and assessed the implications for schizophrenia. The results revealed significantly reversed expression levels of miR148b‑3p (P=0.0051) and ZNF804A (P=0.0218) in the peripheral blood of patients with first‑onset schizophrenia compared with healthy individuals. Furthermore, it was demonstrated that miR148b‑3p directly targeted ZNF804A via binding to conserved target sites in the 3'‑untranslated region of ZNF804A mRNA, where it inhibited the endogenous expression of ZNF804A at both the mRNA (P=0.048) and protein levels (P=0.013) in SH‑SY5Y cells. Furthermore, miR148b‑3p was revealed to regulate the expression levels of catechol‑O‑methyltransferase (COMT) and serine protease 16 (PRSS16) by targeting ZNF804A in SH‑SY5Y cells. Collectively, the present results indicated that there was a direct upstream regulation of the schizophrenia risk gene ZNF804A by miR148b‑3p, which contributed to the regulation of the downstream genes COMT and PRSS16. Thus, the miR148b‑3p/ZNF804A/COMT/PRSS16 pathway may play an important role in the pathophysiology of schizophrenia, and may serve as a potential target in drug discovery and gene therapy for this disorder.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 32626976      PMCID: PMC7339789          DOI: 10.3892/mmr.2020.11230

Source DB:  PubMed          Journal:  Mol Med Rep        ISSN: 1791-2997            Impact factor:   2.952


Introduction

Schizophrenia is a serious mental disorder characterized by affective and cognitive symptoms, and affects ~1% of the population with an estimated heritability of 64–80% (1). Genome-wide association studies (GWASs) have revealed a large number of risk genes in schizophrenia (2). The potential interaction of these genes constitutes pivotal signaling pathways and complex networks of regulation implicated with schizophrenia (3). Zinc finger protein 804A (ZNF804A), located on chromosome 2q32.1, was the first schizophrenia susceptibility gene identified by GWASs (4). Subsequent larger GWASs confirmed the association of ZNF804A with schizophrenia, and extended its association to other psychiatric diagnoses, including bipolar disorder (5,6). Although ZNF804A regulates a number of genes and pathways associated with schizophrenia (7), the upstream regulation of ZNF804A, as well as its implication in schizophrenia, have not been fully investigated. MicroRNAs (miRNAs/miRs), a class of endogenous non-coding single-strand RNAs that are 9–23 nucleotides in length, are of interest as key transcriptional regulators of ~1/2 of human genes (8). Moreover, genetic variants in the human MIR137 gene locus increase schizophrenia risk and have genome-wide significance (9). It has been revealed that miR-137 downregulates the presynaptic target gene synaptotagmin-1 and impairs synaptic plasticity in the hippocampus (10). Furthermore, ephrin B2 is a validated target gene of miR-137, and the aberrant expression of miR-137 in the peripheral blood of patients with schizophrenia provides further evidence for its involvement in schizophrenia etiology and diagnosis (11). The present study revealed significantly different expression profiles for miR-148b-3p in peripheral blood of patients with first-onset schizophrenia compared with healthy controls. Thus, the present study investigated the possible upstream regulation of ZNF804A by miR-148b-3p, as an underlying molecular mechanism in schizophrenia. Therefore, SH-SY5Y neuroblastoma human cells were used in the present study. SH-SY5Y is a thrice cloned subline of the SK-N-SH cell line that was originally established from a bone marrow biopsy from a patient with neuroblastoma in the 1970s, and has been widely used for examining the cellular mechanisms underlying the etiology of neuropsychiatric disorders, including schizophrenia and bipolar disorder (12–14).

Materials and methods

Human peripheral blood collection and reverse transcription-quantitative PCR (RT-qPCR)

The study was approved by the Medical Ethics Committee of Xi'an Jiaotong University Health Science Center and was in accordance with the Declaration of Helsinki. Informed consent was obtained from all subjects in the Affiliated Hospitals of Xi'an Jiaotong University (Xi'an, China) from May 2014 to April 2015. A total of 88 unrelated subjects were enrolled in the present study, including 44 patients with schizophrenia and 44 healthy controls, the details of whom were described previously (11). Peripheral blood samples from the participants (5 ml) were collected in EDTA-coated tubes and were then placed on ice. Total RNA was isolated within 2 h of collection using TRIzol® (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions and quantified using a NanoDrop 2000 (Thermo Fisher Scientific, Inc.). The first strand of cDNA for miRNA was synthesized using Mir-X miRNA First-Strand Synthesis Kit (Clontech, USA), and the first strand of cDNA for mRNA was synthesized using RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Inc.). RT-qPCR was performed using FastStart Universal SYBR Green Master (Rox; Roche Diagnostics) and an Mx3005P qPCR system (Agilent Technologies, Inc.) according to the following procedure: 95°C for 10 min; followed by 40 cycles of 95°C for 10 sec, 60°C for 30 sec, 72°C for 30 sec; and a final dissociation curve analysis stage. Gene expression and miRNA expression were normalized to GAPDH and U6 small nuclear RNA expression, respectively. Each sample was tested in triplicate, and all data were analyzed using the 2−ΔΔCq method (15). Primer information for genes and miRNAs is summarized in Table I.
Table I.

Primer information of miRNA and genes for RT-qPCR.

Gene nameAccession no.Primer for RT-qPCRLocation for the first nucleotide of the primer[a]Sequence (5′3′)Annealing temperature (°C)
Hsa-miR-148b-3pNR_029894ForwardChr12:54337278TCAGTGCATCACAGAACTTTGT60
ZNF804ANM_194250ForwardChr2:184933670GAAAACAGGAAAAGGCACTCC60
ReverseChr2:184935847CACAACAACTCGTTGGGAAAT
COMTNM_000754ForwardChr22:19962760CATTGACACCTACTGCGAGC59
ReverseChr22:19963678TCTCGATGGTGATGAGCCTC
PRSS16NM_005865ForwardChr6:27255074CTTGGACATGGCACCTGAG58
ReverseChr6:27255274CTCTCCTTTGCCAGCTTGAG
GAPDHNM_002046ForwardChr12:6,537,347CCAAGGTCATCCATGACAACT60
ReverseChr12:6,537,683CAGGGATGATGTTCTGGAGAG
U6 snRNANR_004394ForwardChr15:67,840,042CTCGCTTCGGCAGCACA60
ReverseChr15:67,839,949AACGCTTCACGAATTTGCGT

UCSC Browser, Dec 2013 (http://genome.ucsc.edu/cgi-bin/hgGateway). RT-qPCR, reverse transcription-quantitative PCR; miR/miRNA, microRNA; Chr, chromosome; ZNF804A, zinc finger protein 804A; NC, negative control; COMT, catechol-O-methyltransferase; PRSS16, serine protease 16.

Bioinformatics prediction

Human miR-148b-3p sequences were obtained from miRBase 22.1 (mirbase.org/). ZNF804A mRNA 3′-untranslated region (3′-UTR) sequences (Chr2:184,939,027-184,939,487, NM_194250) were obtained from the UCSC genome browser Human GRCh38/hg38 (http://genome.ucsc.edu/cgi-bin/hgTracks). TargetScan 6.2 (http://www.targetscan.org/), DIANA TOOLS 5.0 (http://diana.imis.athena-innovation.gr/Diana Tools/index.php) and miRanda (August 2010 Release) (http://www.microrna.org) were used to predict miR-148b-3p and ZNF804A interaction, which was based on the presence of binding sites in the seed region, the efficacy of targeting and the probability of conserved targeting (16). A Venn diagram of individual prediction among the three software programs was calculated and drawn using Bioinformatics & Evolutionary Genomics online software 1.0 (http://bioinformatics.psb.ugent.be/webtools/Venn/).

Recombinant construction and site-directed mutagenesis

A 461-bp-long 3′-UTR fragment of the ZNF804A gene, which contained the putative miR-148b-3p binding site, was synthesized by Chang Jing Bio-Tech, Ltd. The sequence was inserted into a pmirGLO Dual-Luciferase miRNA Target Expression vector (Promega Corporation) downstream of the firefly luciferase gene, between the SacI and XbaI sites. The constructed wild-type vectors were validated by restriction enzyme digestion and Sanger sequencing. For restriction enzyme digestion, the following reaction components were mixed and maintained at 37°C for 4 h: 10 µl 10X M buffer, 1 µl SacI, 1 µl XbaI (cat. Nos. 1078A and 1093A, respectively; both Takara Biotechnology Co., Ltd.) and 1 µg constructed wild-type vector. The total volume was adjusted to 20 µl by adding ddH2O. The digestion products were separated on a 1% agarose gel using DL2000 (cat. no. 3427; Takara Biotechnology Co., Ltd.) as a DNA marker. For Sanger sequencing, the forward primer (5′-GACGAGGTGCCTAAAGGACT-3′), constructed vectors, and BigDye™ terminator v3.1 (cat. no. 4336913; Applied Biosystems; Thermo Fisher Scientific, Inc.) were used for sequencing reaction to generate fluorescently labeled DNA fragments with different sizes. Subsequently, the DNA fragments were separated by capillary electrophoresis, during which the fluorescent labels were excited by laser and transformed to chromatogram. The Sanger sequencing results were identified to be consistent with the GRCh38/hg38 reference sequence from the UCSC genome browser (genome.ucsc.edu/cgi-bin/hgTracks) and the NCBI database (ncbi.nlm.nih.gov/gene/91752). The mutated ZNF804A 3′-UTR sequence, containing all six nucleotides in the putative seed-pair region, was synthesized according to A-T, C-G substitution criteria (17). The mutated product was constructed by inserting the mutant sequence into the pmirGLO Dual-Luciferase miRNA Target Expression vector, and it was validated by restriction enzyme digestion and Sanger sequencing.

Cell culture

The SH-SY5Y cell line was purchased from American Type Culture Collection (cat. no. CRL-2266), and has been authenticated by short tandem repeat profiling. Another neuroblastoma cell line, SK-N-BE(2), and 293T cells were obtained from the Cell Bank of the Chinese Academy of Sciences, and were authenticated. All cells were maintained in a humidified incubator at 37°C with 5% CO2. 293T cells were cultured in DMEM with high glucose (HyClone; GE Healthcare Life Sciences) supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.), 100 U/ml penicillin and 100 µg/ml streptomycin (Penicillin-Streptomycin solution; HyClone; GE Healthcare Life Sciences). SH-SY5Y and SK-N-BE(2) cells were cultured in a 1:1 mixture of DMEM:nutrient mixture and F-12 medium (DMEM/F-12) containing 1.5 mM L-glutamine (HyClone; GE Healthcare Life Sciences); the mix was supplemented with 10% FBS, 100 U/ml penicillin and 100 µg/ml streptomycin.

Co-transfection and dual luciferase reporter assays

293T cells were seeded on 48-well plates at a density of 5×104/well and cultured at 37°C for 24 h before transfection. A miR-148b-3p mimic (5′-UCAGUGCAUCACAGAACUUUGU-3′), a mimic negative control (NC; 5′-UUCUCCGAACGUGUCACGUTT-3′), a miR-148b-3p inhibitor (5′-ACAAAGUUCUGUGAUGCACUGA-3′) and an inhibitor NC (5′-CAGUACUUUUGUGUAGUACAA-3′) were obtained from Chang Jing Bio-Tech, Ltd. To evaluate the interaction between miR-148b-3p and the ZNF804A 3′-UTR, combinations of 50 nM mimic or mimic NC with 1 µg wild-type and mutant UTR vectors were co-transfected by using Lipofectamine™ 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). At 24 and 48 h after transfection, cells were harvested. The activity of the luciferase reporter gene was detected using the Dual-Luciferase® Reporter Assay system (Promega Corporation). Each sample was tested in triplicate, and the relative luciferase activity was calculated as the ratio of firefly to Renilla luciferase activity, which was normalized against a blank control.

Cell transfection and RT-qPCR

SH-SY5Y cells were seeded on 12-well plates at a density of 2.5×105/well and cultured at 37°C for 24 h, followed by transfection with 50 nM miR-148b-3p mimic, 50 nM mimic NC, 50 nM miR-148b-3p inhibitor or 50 nM inhibitor NC, by Lipofectamine™ 2000. For comparison, blank and mock controls using the sample volume of media (1 ml) and transfection reagent (2 µl) were prepared. Each experimental group was transfected in triplicate. After a 24-h transfection period, total RNA was isolated using TRIzol® (Invitrogen; Thermo Fisher Scientific, Inc.) and quantified with NanoDrop 2000 (Thermo Fisher Scientific, Inc.). The same experimental procedure was performed in SK-N-BE(2) to verify the results in SH-SY5Y. RT-qPCR for mRNA expression was performed as aforementioned.

Western blotting

Following 48 h of transfection, proteins were extracted from SH-SY5Y cells using RIPA lysis buffer (Beyotime Institute of Biotechnology) containing the protease inhibitor phenylmethanesulfonyl fluoride (Beyotime Institute of Biotechnology). Total protein was quantified using a bicinchoninic acid assay kit (Pierce; Thermo Fisher Scientific, Inc.). A total of 20 µg protein samples was loaded onto each lane of 8% SDS-PAGE gel, followed by electrophoresis and transfer to PVDF membranes (EMD Millipore). Membranes were probed with the following primary antibodies overnight at 4°C: Rabbit polyclonal anti-ZNF804A (1:1,000; cat. no. ab229346; Abcam), mouse monoclonal anti-GAPDH (1:1,000, cat. no. TA-08; OriGene Technologies, Inc.) or rabbit polyclonal anti-β-actin (1:1,000; cat. no. ab0035; Abways Technology). Subsequently, membranes were incubated with horseradish peroxidase-conjugated goat anti-mouse IgG (1:5,000; cat. no. 31430; Thermo Fisher Scientific, Inc.) or goat anti-rabbit IgG (1:5,000; cat. no. 31460; Thermo Fisher Scientific, Inc.) secondary antibody at room temperature for 2 h. The target proteins were detected by an enhanced chemiluminescence system (EMD Millipore) and scanned using the GeneGnome XRQ system (Syngene) with GeneTools analysis software 4.0; Syngene, and the densitometry of specific western blotting bands was analyzed with GeneTools analysis software. Protein expression was determined by comparing the band intensity of ZNF804A to that of the internal control, GAPDH. The same experimental procedure was performed in SK-N-BE(2) to verify the results in SH-SY5Y. Each experiment was performed in triplicate.

Ad-ZNF804A construction and cell infection

The human ZNF804A gene fragment was amplified by PCR and cloned into the adenoviral vector pHBAd-EF1-MCS-GFP (Hanbio Biotechnology Co., Ltd.). The forward primer, 5′-GTGACCGGCGCCTACGAATTCGCCACCATGGAGTGTTACTACATTGT-3′ and reverse primer, 5′-TCGGGATCCCGCCCGGGGGAAGAGAGGTTGCAAAGGGA-3′ as well as human genome DNA template were used to amplify the ZNF804A gene fragment using KOD Plus (Toyobo Life Science) according to the following procedure: Pre-denatured at 95°C for 5 min; then 27 cycles of 94°C for 20 sec, 55°C for 20 sec and 72°C for 90 sec; and final extension at 72°C for 10 min. Subsequently, the recombinant plasmid and pHBAd-BHG plasmid (Hanbio Biotechnology Co., Ltd.) were co-transfected into 293T cells using LipoFiter™ (Hanbio Biotechnology Co., Ltd.) to generate recombinant ZNF804A adenovirus, which was named ‘Ad-ZNF804A’. Ad-green fluorescent protein was used as a NC. SH-SY5Y cells were pre-transfected with miR-148b-3p mimics (50 nM), and then infected with Ad-ZNF804A and Ad-NC for 24 h. The multiplicity of infection (MOI) was 50, and the blank group was used as a control. Total RNA was harvested using TRIzol® (Invitrogen; Thermo Fisher Scientific, Inc.) after 48 h, and RT-qPCR for gene expression was performed as aforementioned.

Statistical analysis

Data are presented as the mean ± SEM. Statistically significant differences among groups were detected with one-way ANOVA. Fisher's Least Significant Difference test or Tukey's test were carried out for post hoc analyses. Student's t-tests were used for comparisons between two groups that fitted normal distribution and had a homogeneity of variance. For data that did not fit normal distribution and had a homogeneity of variance, a non-parametric test (Mann Whitney test) was performed. Correlation analysis was performed using Pearson's correlation. Data analyses were performed using GraphPad Prism 5 software (GraphPad Prism Software, Inc.) or SPSS software version 18.0 (IBM Corp.). P<0.05 was considered to indicate a statistically significant difference.

Results

Bioinformatic prediction of ZNF804A as a target of miR-148b-3p

TargetScan, DIANA TOOLS and miRanda predicted 40, 901 and 3,015 putative target genes of miR-148b-3p, respectively. ZNF804A was one of 23 shared target genes identified by all prediction tools (Fig. 1A). Furthermore, 16, 30 and 27 miRNAs that target the ZNF804A gene were predicted by TargetScan, DIANA TOOLS and miRanda, respectively. Moreover, miR-148b-3p was one of three shared miRNAs identified by all prediction tools (Fig. 1B). It was demonstrated that all three databases predicted that miR-148b-3p interacted with the ZNF804A 3′-UTR from nucleotides 198–204. The binding site sequence of the ZNF804A 3′-UTR is broadly conserved among vertebrates, such as humans, chimpanzees, rhesus monkeys, rodents, rabbits, pigs, cats, elephants and chickens, suggesting that it has important roles in the regulation of gene function (genome.ucsc.edu/cgi-bin/hgTracks?db=hg38&lastVirtModeType=default&lastVirtModeExtraState=&virtModeType=default&virtMode=0&nonVirtPosition=&position=chr2%3A184939027%2D184939487&hgsid=820743199_5AAECt1MXtmem7EgvQiIixlwuapI).
Figure 1.

Venn diagrams of bioinformatics results for miR-148b-3p and ZNF804A. (A) ZNF804A is one of 23 shared target genes among the three databases. (B) miR-148b-3p is one of three shared miRNAs among the three databases. miR/miRNA, microRNA; ZNF804A, zinc finger protein 804A.

miR-148b-3p and ZNF804A have aberrantly reversed expression in the peripheral blood of patients with schizophrenia

It was determined that the expression of miR-148b-3p was 1.35-fold higher in the peripheral blood of patients with schizophrenia compared with healthy controls (P=0.0051; Fig. 2A). Furthermore, the expression of ZNF804A was significantly decreased in patients with schizophrenia compared with healthy controls (P=0.0218; Fig. 2B). In addition, a correlation analysis between miR-148b-3p and ZNF804A was performed and a moderate negative correlation was identified (r=−0.409; P=0.006; Fig. 2C).
Figure 2.

Altered expression levels of miR-148b-3p and ZNF804A in the peripheral blood of patients with schizophrenia and healthy controls. (A) Increased expression of miR-148b-3p. (B) Decreased expression of ZNF804A. (C) Correlation analysis between miR-148b-3p and ZNF804A. *P<0.05, **P<0.01. miR/miRNA, microRNA; ZNF804A, zinc finger protein 804A.

Biological verification of miR-148b-3p directly targeting ZNF804A

PmirGLO reconstructed vectors were generated and were then assessed by restriction enzyme digestion and Sanger sequencing. For this, one product of restriction enzyme digestion was the pmirGLO vector, which was 7,350 bp, and the other product was 461 bp, which was the same size as the PCR product before cloning into the vector (Fig. 3A). The sequencing results of the amplified fragments in the wild-type construct were consistent with the GRCh38/hg38 reference sequences from the UCSC genome browser and the NCBI database (Fig. 3B). Furthermore, the sequence in the binding sites was mutated according to the A-T, C-G substitution criterion (Fig. 3C).
Figure 3.

Results of restriction enzyme digestion and sequencing. (A) Results of restriction enzyme digestion. The lane ‘Marker’ was DL2000. The 461-bp PCR product representing the ZNF804A 3′-untranslated is in lane 1, and the restriction enzyme digestion result of the wild-type construct is in lane 2. (B) Sequencing results of the wild-type construct. (C) Sequencing results of the mutant construct. ZNF804A, zinc finger protein 804A.

The present results indicated that the luciferase activity in 293T cells co-transfected with the miR-148b-3p mimic was significantly decreased after 24 h (P<0.001; Fig. 4A) and 48 h (P<0.001; Fig. 4B) compared with the NC group. However, the luciferase activity did not reveal a significant difference for the mutant group with miR-148b-3p mimic compared with the NC group, thus suggesting that miR-148b-3p directly binds to the ZNF804A 3′-UTR and inhibits its expression.
Figure 4.

miR-148b-3p directly targets the ZNF804A gene. (A) Results of the dual luciferase reporter assay after 24 h, following transfection with the miR-148b-3p mimic or the mimic NC, and co-transfected with the WT or the MT constructs in 293T cells. (B) Results of the dual luciferase reporter assay after 48 h. ***P<0.001. miR, microRNA; ZNF804A, zinc finger protein 804A; NC, negative control; WT, wild-type; MT, mutant.

miR-148b-3p inhibits the endogenous expression of ZNF804A

The results of RT-qPCR experiments revealed that the miR-148b-3p mimic significantly increased the expression of miR-148b-3p compared with the NC, mock or control groups, while the miR-148b-3p inhibitor significantly decreased miR-148b-3p expression. These results demonstrated the transfection efficiency with the successful gain or loss of miR-148b-3p function in SH-SY5Y cells (Fig. 5A). Moreover, ZNF804A expression was significantly decreased in the miR-148b-3p mimic group compared with the NC group (P=0.048). In addition, ZNF804A expression was increased significantly in the group transfected with the miR-148b-3p inhibitor compared with the inhibitor NC group (P=0.044; Fig. 5B). Therefore, the present results indicated that endogenous expression of ZNF804A may be regulated by miR-148b-3p at the mRNA level.
Figure 5.

Endogenous mRNA expression of ZNF804A following gain or loss of miR-148b-3p function in human neuroblastoma cells. (A) Reverse transcription-quantitative PCR results following miR-148b-3p expression in SH-SY5Y cells. (B) mRNA expression of ZNF804A in SH-SY5Y cells. *P<0.05, ****P<0.0001. miR/miRNA, microRNA; ZNF804A, zinc finger protein 804A; NC, negative control.

Western blotting results indicated that the miR-148b-3p mimic significantly decreased ZNF804A protein expression compared with the NC (P=0.013), mock or control groups (Fig. 6A and C). However, treatment with the miR-148b-3p inhibitor significantly increased ZNF804A protein expression (P=0.001; Fig. 6B and D). Collectively, the present results indicated that the endogenous expression of ZNF804A was downregulated by miR-148b-3p at the protein level.
Figure 6.

Effect of miR-148b-3p on the endogenous protein expression of ZNF804A in SH-SY5Y cells. (A) Western blotting results demonstrated the effects of the miR-148b-3p mimic treatment on ZNF804A expression. (B) Western blotting revealed the effects of the miR-148b-3p inhibitor treatment on ZNF804A expression. (C) Quantification of western blotting results presented in A. (D) Quantification of western blotting results presented in B. GAPDH was used as an internal control in both experiments. Statistical analyses were performed on three independent results. *P<0.05, **P<0.01. miR, microRNA; ZNF804A, zinc finger protein 804A; NC, negative control.

miR-148b-3p regulates the schizophrenia susceptibility genes catechol-O-methyltransferase (COMT) and serine protease 16 (PRSS16) by targeting ZNF804A

SH-SY5Y cells were transfected with the miR-148b-3p mimic, mimic NC, miR-148b-3p inhibitor and inhibitor NC, to identify whether COMT and PRSS16 are regulated by miR-148b-3p. It was demonstrated that transfection with the miR-148b-3p mimic induced a significant decrease in COMT compared with the NC (P=0.025), mock or control levels, and COMT expression was increased significantly in the miR-148b-3p inhibitor group compared with the inhibitor NC group (P=0.040; Fig. 7A). Furthermore, transfection with the miR-148b-3p mimic significantly increased the mRNA expression of PRSS16 compared with the NC (P<0.0001), mock or control levels, and PRSS16 expression was significantly decreased in the miR-148b-3p inhibitor group compared with the inhibitor NC group (P=0.047; Fig. 7B). Moreover, western blotting results of the quantification of the protein expression of COMT were consistent with the RT-qPCR data (Fig. S1).
Figure 7.

Effect of miR-148b-3p on the expression levels of COMT and PRSS16 in SH-SY5Y cells. (A) mRNA expression of COMT in SH-SY5Y cells. (B) mRNA expression of PRSS16 in SH-SY5Y cells. *P<0.05, ****P<0.0001. miR, microRNA; ZNF804A, zinc finger protein 804A; NC, negative control; COMT, catechol-O-methyltransferase; PRSS16, serine protease 16.

Similar experiments were performed in another neuroblastoma cell line, SK-N-BE(2). It was revealed that the results obtained in the SK-N-BE(2) cell line (Fig. S2) were consistent with those generated in the SH-SY5Y cell line. It has been previously reported that COMT and PRSS16 are regulated by ZNF804A (7). To assess whether miR-148b-3p regulates COMT and PRSS16 by targeting the ZNF804A gene, ZNF804A expression was rescued in miR-148b-3p-expressing SH-SY5Y cells using an Ad-ZNF804A vector. It was revealed that the infection efficiency was as high as 90% when the MOI of adenovirus was 50 (Fig. 8A). Moreover, the mRNA expression level of ZNF804A revealed that the transfections were successful (P<0.001; Fig. 8B). The results of the gene expression experiments demonstrated that the transfection of the miR-148b-3p mimic, in addition to the infection of the ZNF804A expression vector, rescued the expression levels of COMT and PRSS16, which indicated that gene regulation was mediated by miR-148b-3p (Fig. 8C and D). Therefore, the present results suggested that miR-148b-3p regulated COMT and PRSS16 by inhibiting ZNF804A.
Figure 8.

miR-148b-3p regulation of COMT and PRSS16 is rescued by ZNF804A in SH-SY5Y cells. (A) Infection results of recombinant ZNF804A adenovirus. Multiplicity of infection=50. (B) mRNA expression of ZNF804A in SH-SY5Y cells. (C) mRNA expression of COMT in SH-SY5Y cells. (D) mRNA expression of PRSS16 in SH-SY5Y cells. *P<0.05, **P<0.01, ***P<0.001. miR, microRNA; ZNF804A, zinc finger protein 804A; NC, negative control; COMT, catechol-O-methyltransferase; PRSS16, serine protease 16.

Discussion

The present study revealed that the expression of miR-148b-3p was significantly increased in the peripheral blood of patients with first-onset schizophrenia compared with healthy controls. Bioinformatics analyses and dual luciferase reporter assays indicated that ZNF804A may be directly targeted by miR-148b-3p. In human neuroblastoma cells transfected with a miR-148b-3p mimic or a mimic NC, expression of ZNF804A at both the mRNA and protein levels was influenced by miR-148b-3p expression. Furthermore, two susceptibility genes, COMT and PRSS16, were determined to be indirectly regulated by miR-148b-3p via ZNF804A in SH-SY5Y cells. It has been previously shown that dopamine (DA) dysfunction influences both cortical and subcortical circuitry, thus facilitating different symptomatology of schizophrenia (18). SH-SY5Y cells possess numerous characteristics of DAergic neurons, such as the ability to synthesize DA and express DA transporters (19,20). Furthermore, under certain conditions SH-SY5Y cells can differentiate into a more pronounced DAergic neuronal phenotype, which present several of the characteristics of primary cultures of neurons (20,21). Therefore, this cell line has been widely used for schizophrenia research (19–21). miR-148b-3p belongs to the miR-148/152 family, which regulates the growth and development of healthy tissues (22). Differential expression between members of the miR-148/152 family in patients with tumor or type 1 diabetes compared with healthy controls indicates their important roles in the initiation and process of different diseases (22). In our previous study, it was revealed that miR-148b-3p expression was upregulated in the post-mortem dorsolateral prefrontal cortex of the schizophrenia group compared with healthy controls (23). Moreover, miR-148b has been revealed to affect neural stem cell proliferation, and their differentiation into new neurons and astrocytes (24). While the precise function of ZNF804A is unknown in psychiatric disorders, the biological function and molecular mechanisms of ZNF804A have been revealed by previous studies (25,26). Furthermore, the neuronal function and molecular mechanisms of ZNF804A have been revealed by two landmark studies (25,26). Using neurons derived from human neural progenitor cells (NPCs), human induced pluripotent stem cells or primary rat cortical neurons, Deans et al (25) revealed that ZNF804A localizes to synapses, and regulates neurite formation and dendritic spine structure. In addition, Zhou et al (26) revealed that the rodent homologue of ZNF804A (Zfp804a) is required for NPC proliferation and neuronal migration, and also identified a novel role of ZNF804A in modulating protein translational efficiency during neurodevelopment. COMT is a downstream gene of ZNF804A that codes for catechol-O-methyltransferase, which degrades extracellular catecholamines (27). DA is a catecholamine and is also a principal neurotransmitter in the central nervous system (28). In pharmacology, COMT is a biological target for the treatment of various central and peripheral nervous system disorders, including Parkinson's disease, depression and other DA-related diseases (29). The DAergic system has been implicated in neuropsychological processes that are impaired in patients with schizophrenia, and these impairments are correlated with structural abnormalities observed in the brains of these patients (30,31). In addition, DA is a powerful activator of resting effector T cells by acting on its receptors on immune effector cells (28). Both altered immune functions and abnormal DAergic systems have been observed in patients with schizophrenia (32). COMT, as a susceptibility gene for schizophrenia, also represents an important target for the treatment of the disease (33). PRSS16 is located at 6p22-p21.3 on the chromosome near the major histocompatibility complex class I region, and encodes a serine protease that is abundantly expressed in the thymus; this serine protease plays an important role in immune function (34). Moreover, a GWAS indicated that the single-nucleotide polymorphisms rs6932590 and rs13219354 in the PRSS16 loci are associated with schizophrenia risk (35). Thus, it is speculated that miR-148b-3p may affect neurotransmitter synthesis and immune function by regulating the expression levels of COMT and PRSS16, which are downstream of ZNF804A, in schizophrenia. In the present study, it was revealed that expression of miR-148b-3p was aberrantly higher in the peripheral blood of patients with schizophrenia compared with healthy controls. Moreover, this expression pattern may reflect pathological processes in the brain, as significant gene expression overlap is found between whole blood and brain tissue (36). Brain-derived exosomes and their miRNA cargo may be key players in the cross-talk between the brain and the immune system in psychiatric disorders (37). Furthermore, the secretion of brain or immune cell exosomes is partially regulated by neurotransmitters (38,39). Exosomes or liposomes packaged with a specifically selected miRNA cargo may readily cross the blood-brain barrier, and therefore represent ideal carriers for nucleic acid-based drugs (40,41). The present results indicated that the miR-148b-3p/ZNF804A/COMT/PRSS16 pathway may play an important role in the pathophysiology of schizophrenia, and that miR-148b-3p may be a novel drug target in schizophrenia. In conclusion, the present results indicated that miR-148b-3p directly regulated the expression of ZNF804A, and as a result influenced the expression levels of COMT and PRSS16, which are downstream genes of ZNF804A. Therefore, this regulatory pathway may affect the immune function of patients with schizophrenia. It was also speculated that the miR-148b-3p/ZNF804A/COMT/PRSS16 pathway may play an important role in the pathophysiology of schizophrenia. In addition, the present results may facilitate the development of drug discovery and gene therapy for schizophrenia.
  41 in total

1.  Identification of loci associated with schizophrenia by genome-wide association and follow-up.

Authors:  Michael C O'Donovan; Nicholas Craddock; Nadine Norton; Hywel Williams; Timothy Peirce; Valentina Moskvina; Ivan Nikolov; Marian Hamshere; Liam Carroll; Lyudmila Georgieva; Sarah Dwyer; Peter Holmans; Jonathan L Marchini; Chris C A Spencer; Bryan Howie; Hin-Tak Leung; Annette M Hartmann; Hans-Jürgen Möller; Derek W Morris; Yongyong Shi; GuoYin Feng; Per Hoffmann; Peter Propping; Catalina Vasilescu; Wolfgang Maier; Marcella Rietschel; Stanley Zammit; Johannes Schumacher; Emma M Quinn; Thomas G Schulze; Nigel M Williams; Ina Giegling; Nakao Iwata; Masashi Ikeda; Ariel Darvasi; Sagiv Shifman; Lin He; Jubao Duan; Alan R Sanders; Douglas F Levinson; Pablo V Gejman; Sven Cichon; Markus M Nöthen; Michael Gill; Aiden Corvin; Dan Rujescu; George Kirov; Michael J Owen; Nancy G Buccola; Bryan J Mowry; Robert Freedman; Farooq Amin; Donald W Black; Jeremy M Silverman; William F Byerley; C Robert Cloninger
Journal:  Nat Genet       Date:  2008-09       Impact factor: 38.330

2.  Exosome-Mediated Targeted Delivery of miRNAs.

Authors:  Shin-Ichiro Ohno; Masahiko Kuroda
Journal:  Methods Mol Biol       Date:  2016

3.  Fine mapping of ZNF804A and genome-wide significant evidence for its involvement in schizophrenia and bipolar disorder.

Authors:  H J Williams; N Norton; S Dwyer; V Moskvina; I Nikolov; L Carroll; L Georgieva; N M Williams; D W Morris; E M Quinn; I Giegling; M Ikeda; J Wood; T Lencz; C Hultman; P Lichtenstein; D Thiselton; B S Maher; A K Malhotra; B Riley; K S Kendler; M Gill; P Sullivan; P Sklar; S Purcell; V L Nimgaonkar; G Kirov; P Holmans; A Corvin; D Rujescu; N Craddock; M J Owen; M C O'Donovan
Journal:  Mol Psychiatry       Date:  2010-04-06       Impact factor: 15.992

4.  Medicinal chemistry of catechol O-methyltransferase (COMT) inhibitors and their therapeutic utility.

Authors:  László E Kiss; Patrício Soares-da-Silva
Journal:  J Med Chem       Date:  2014-09-02       Impact factor: 7.446

5.  Exosomes and the blood-brain barrier: implications for neurological diseases.

Authors:  Matthew J A Wood; Aisling J O'Loughlin; Lakhal Samira
Journal:  Ther Deliv       Date:  2011-09

6.  ZNF804a regulates expression of the schizophrenia-associated genes PRSS16, COMT, PDE4B, and DRD2.

Authors:  Matthew J Girgenti; Joseph J LoTurco; Brady J Maher
Journal:  PLoS One       Date:  2012-02-27       Impact factor: 3.240

7.  Statistical analysis of real-time PCR data.

Authors:  Joshua S Yuan; Ann Reed; Feng Chen; C Neal Stewart
Journal:  BMC Bioinformatics       Date:  2006-02-22       Impact factor: 3.169

8.  Characterization of a REST-Regulated Internal Promoter in the Schizophrenia Genome-Wide Associated Gene MIR137.

Authors:  Alix Warburton; Gerome Breen; Dan Rujescu; Vivien J Bubb; John P Quinn
Journal:  Schizophr Bull       Date:  2014-08-25       Impact factor: 9.306

9.  Exosomes secreted by cortical neurons upon glutamatergic synapse activation specifically interact with neurons.

Authors:  Mathilde Chivet; Charlotte Javalet; Karine Laulagnier; Béatrice Blot; Fiona J Hemming; Rémy Sadoul
Journal:  J Extracell Vesicles       Date:  2014-11-13

Review 10.  The microRNA-148/152 family: multi-faceted players.

Authors:  Yue Chen; Yong-Xi Song; Zhen-Ning Wang
Journal:  Mol Cancer       Date:  2013-05-19       Impact factor: 27.401

View more
  2 in total

1.  rs1344706 polymorphism of zinc finger protein 804a (ZNF804a) gene related to the integrity of white matter fiber bundle in schizophrenics.

Authors:  Jian Zhou; Quan Bao; Shuang Liang; Hong Guo; Xin Meng; Guangfeng Zhang; Ping Li
Journal:  Exp Ther Med       Date:  2021-05-18       Impact factor: 2.447

Review 2.  Glial changes in schizophrenia: Genetic and epigenetic approach.

Authors:  Ramos Daniel Francisco; Vazquez Fernando; Estrada Norma; Méndez Edna Madai; Barraza Marcelo
Journal:  Indian J Psychiatry       Date:  2022-01-21       Impact factor: 1.759

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.