Literature DB >> 32606939

Inhibition of lncRNA PART1 Chemosensitizes Wild Type but Not KRAS Mutant NSCLC Cells.

Shu-Chen Chen1, Yu-Zhu Diao1, Zi-Han Zhao2, Xiao-Ling Li1.   

Abstract

BACKGROUND: Lung cancer has the highest incidence among solid tumors in men and is the third most common cancer in women. Despite improved understanding of genomic and mutational landscape in non-small cell lung cancer (NSCLC), the five-year survival in these patients has remained stagnant at a dismal 15%. The first line of treatment commonly adapted for NSCLC patients with somatic mutation in EGFR is tyrosine kinase inhibitor gefitinib or erlotinib. EGFR mutant cells seem to be intrinsically sensitive to tyrosine kinase inhibitors; however, the remaining 20-30% patients are resistant to tyrosine kinase inhibitor.
MATERIALS AND METHODS: Here we show, using in vitro normal and NSCLS cell lines, that the lncRNA Prostate androgen-regulated transcript 1 (PART1) is expressed at higher levels in NSCLC cells compared to normal lung epithelial cell line, corroborating two earlier studies.
RESULTS: We additionally show that these cells are resistant to erlotinib which is reversed in some, but not all, cell lines following suppression of PART1 expression. The differential response to erlotinib following siRNA-mediated knockdown of PART1 was found to be related to the mutational status of KRAS. Only in cells with wild-type KRAS suppression of PART1 sensitized them to erlotinib. Knockdown of mutant KRAS did not sensitize those cell lines to erlotinib. But knockdown of mutant KRAS along with suppression of PART1 sensitized the cells to treatment with erlotinib. The results from the study reveal a yet undefined and important role of lncRNA PART1 in defining sensitivity to erlotinib. This action is mediated by mutation status of KRAS.
CONCLUSION: Even though preliminary, our results indicate PART1 might be a potential candidate for targeted therapy or used as a predictor of chemosensitivity in patients with NSCLC.
© 2020 Chen et al.

Entities:  

Keywords:  KRAS; PART1; chemosensitivity; erlotinib; lncRNA; non-small cell lung cancer

Year:  2020        PMID: 32606939      PMCID: PMC7293907          DOI: 10.2147/CMAR.S245257

Source DB:  PubMed          Journal:  Cancer Manag Res        ISSN: 1179-1322            Impact factor:   3.989


Introduction

China has the sixteenth highest incidence of lung cancer in the world with an age-standardized rate of 35.1 per 100,000.1 Worldwide, lung cancer is also the most common solid cancer in men and third most common solid cancer in women.1 Despite all the advances made in diagnostic and therapeutic regimens, the 5-year survival at 15% has largely remained static in lung cancer patients.2 This highlights the urgent need to define pathogenic mechanisms in lung cancer in order to identify and test more effective therapeutic targets.3,4 Non-small cell lung cancer (NSCLC) is the major form of lung cancer contributing to approximately 85% cases. Deregulated tyrosine kinase activity of the transmembrane growth factor receptor epidermal growth factor receptor (EGFR) has been implicated in pathogenesis of lung cancer.5–8 Indeed, sensitivity to tyrosine kinase inhibitors gefitinib and erlotinib in lung cancer patients have shown association with somatic mutations mapping to the tyrosine kinase domain of the EGFR gene.9–12 Patients harboring mutations have increased EGFR signaling and are better responders to the gefitinib and/or erlotinib. Thus, gefitinib and erlotinib are routinely the therapy of choice in EGFR-mutation positive NSCLC patients, with greater than 70% patients showing durable and positive outcome.13–15 However, the remaining patients have intrinsic resistance to tyrosine kinase inhibitors.16 The mechanism of this intrinsic resistance is not completely understood. There have been an increasing number of studies elucidating that microRNAs and long non-coding RNAs are important regulators of chemosensitivity of cancer cells.17,18 Even in the context of lung cancer, lncRNAs, including lncRNA RP11‑838N2.4, have shown association with resistance to tyrosine kinase inhibitors.19,20 It will not be surprising if additional lncRNAs are also involved in a context-dependent or context-independent fashion in rendering resistance to tyrosine kinase inhibitors in NSCLC patients. Prostate androgen-regulated transcript 1 (PART1) was identified as an androgen-regulated and prostate-specific lncRNA.21 PART1 is also expressed in lungs of NSCLC patients and was found to be correlated to survival22 as well as disease progression via JAK-STAT signaling pathway.23 Given its apparent importance in pathogenesis of NSCLC,20,23 our objective was to study if PART1 expression indirectly or directly regulates chemosensitivity of NSCLC cells. Interestingly, our results show that inhibition of PART1 sensitized NSCLC cell lines to erlotinib treatment whereas its overexpression in normal lung epithelial cells rendered them resistant to erlotinib treatment. But this effect on erlotinib chemosensitivity was restricted to cells with wild-type KRAS.

Materials and Methods

Cell Culture

The normal human lung epithelial cell line BEAS-2B, and the NSCLC cell lines NCI-H2444, NCI-H647, A549, and NCI-H23 were purchased from American Type Culture Collection (ATCC, Manassas, VA, USA. Both cell lines were cultured in DMEM (Thermo Fisher Scientific, Shanghai, China) containing 10% fetal bovine serum (Thermo Fisher Scientific) and 100 units penicillin/streptomycin (Thermo Fisher Scientific). Cells were incubated at 37°C.

Cell Lysate and Western Blot

At the end of experimental time-point, the media was aspirated off and the cells were washed twice with ice-cold 1X phosphate-buffered saline (PBS). Cells were then lysed using RIPA buffer (20x volumes of cell pellet; Thermo Fisher Scientific) and protein concentration in extracted whole cell lysate was determined using BCA assay (Thermo Fisher Scientific). Fifty micrograms of lysates were resolved by SDS-PAGE and processed for Western blot using standard methodologies. Blots were probed with the following antibodies: anti-KRAS (clone 9.13, 1:1000; ThermoFisher Scientific), anti-EGFR (#2085; 1:2000; Cell Signaling), anti-EGFR (#2234; 1:1000; Cell Signaling) and anti-GAPDH (#5174, 1:4000; Cell Signaling). Blots were probed with anti-GAPDH antibody to ensure equivalent protein loading across samples.

Immunofluorescence (IF) Analysis

Cells were grown on coverslips housed in 24-well plates. Once cells reached exponential growth phase, they were washed with ice-cold PBS and fixed using methanol. Cells were blocked with 10% BSA + 0.1% saponin in PBS for 1 hour. The cells were then incubated overnight at room temperature with EGFR antibody (clone D38B1, 1:250; Cell Signaling Technology, Cambridge, USA). The excess antibody was washed off using three 15-minutes wash with PBS and then the cover slips were incubated with secondary antibody (1:500) for 1 hour followed by three more washes with PBS. The coverslips were then mounted using VECTASHIELD Antifade containing 4,6-diamidino-2-phenylindole (DAPI) Vector Laboratories, Burlingame, USA). Slides were imaged via Confocal Spectral Microscope (TCS-SP8 confocal microscope, Leica, Germany).

Gene Construction and Transfection/Transduction

shRNA targeting KRAS was obtained from Dharmacon and was transduced in NCI-H2444 and NCI-H647 cells. Cells were selected with puromycin (2 µg/mL) for 2 weeks. siRNA targeting PART1 (Assay ID: n260057; 5ʹ- GGAACAACACAGAUGAGAUtt – 3ʹ) or a negative control siRNA (#4390843) were obtained from ThermoFisher Scientific. PART1 overexpression plasmid or negative control vector was obtained from GeneChem (Shanghai, China). For transfection cells were plated in antibiotic-free media. Cells were transfected with control or PART1 siRNA (10 nM final concentration) using Polyplus jetPrime transfection reagent. For transduction, BEAS-2B cells were transduced with either lentiviral particles containing control or PART1 overexpression construct using polybrene. Cells were selected with puromycin (2 µg/mL) for 2 weeks. All indicated treatments were done 48 hours following siRNA transfection. Successful knockdown or overexpression was verified by quantitative real-time polymerase chain reaction (qRT-PCR).

RNA Isolation and qRT-PCR

Media was aspirated off and cells were rinsed with ice-cold PBS. The cell pellet was then used to isolate RNA using Trizol (Thermo Fisher Scientific). qRT-PCR was performed using SYBR Green (Thermo Fisher Scientific) using the following primers: EGFR forward primer – 5ʹ – AACACCCTGGTCTGGAAGTACG – 3ʹ; EGFR reverse primer – 5ʹ – TCGTTGGACAGCCTTCAAGACC – 3ʹ; PART1 forward primer – 5ʹ-AAGGCCGTGTCAGAACTCAA-3ʹ; PART1 reverse primer – 5ʹ-GTTTTCCATCTCAGCCTGGA-3ʹ; KRAS forward primer – 5ʹ -CAGTAGACACAAAACAGGCTCAG - 3ʹ; KRAS reverse primer – 5ʹ – TGTCGGATCTCCCTCACCAATG – 3ʹ; 18s rRNA forward primer – 5ʹ-GGCCCTGTAATTGGAATGAGTC-3ʹ; 18s rRNA reverse primer - 5ʹ-CCAAGATCCAACTACGAGCTT-3ʹ. Post-normalization to 18s rRNA expression relative expression of PART1 was calculated by ΔΔCt method. Data were represented as expression relative to that in BEAS-2B cells (Figure 1A and E), or relative to mock overexpression or knockdown (Figure 2A). Data were represented as mean ± standard error of mean (SEM). qRT-PCR experiments were run in triplicate and P-values were calculated by t-test. P < 0.05 was considered statistically significant.
Figure 1

Differential PART1 expression and resistance to erlotinib in NSCLC cells. (A) Relative expression of EGFR determined by qRT-PCR. Post-normalization to 18s rRNA expression, expression relative to BEAS-2B is shown. Error bars, SEM. Error bars, SD. *P<0.05. (B, C) Western blot (B) and IF (C) analysis of EGFR expression in the normal lung epithelial cell line BEAS-2B or the NSCLC cell line, H-2444, A549, NCI-H647, and NCI-H23. Scale bar, 35 µm. (D) The normal lung epithelial cell line BEAS-2B or the NSCLC cell line, H-2444, A549, NCI-H647, and NCI-H23 cells were treated with indicated doses of erlotinib for 3 days and cell viability was measured. Data is representative of three independent experiments, each done in triplicate. Error bars, SD. (E) Relative expression of lncRNA PART1 determined by qRT-PCR. Post-normalization to 18s rRNA expression, expression relative to BEAS-2B is shown. Error bars, SEM. Error bars, SD. *P<0.05.

Figure 2

Overexpression of PART1 makes BEAS-2B cells resistant to erlotinib. (A) Relative expression of lncRNA PART1 determined by qRT-PCR. Post-normalization to 18s rRNA expression, expression relative to mock transduction (BEAS-2B) or transfection (other cell lines). Error bars, SEM. Error bars, SD. *P<0.05. (B) Mock or PART1 transduced BEAS-2B cells were treated with indicated doses of erlotinib for 3 days and cell viability was measured. Data is representative of three independent experiments, each done in triplicate. Error bars, SD. *P<0.05.

Differential PART1 expression and resistance to erlotinib in NSCLC cells. (A) Relative expression of EGFR determined by qRT-PCR. Post-normalization to 18s rRNA expression, expression relative to BEAS-2B is shown. Error bars, SEM. Error bars, SD. *P<0.05. (B, C) Western blot (B) and IF (C) analysis of EGFR expression in the normal lung epithelial cell line BEAS-2B or the NSCLC cell line, H-2444, A549, NCI-H647, and NCI-H23. Scale bar, 35 µm. (D) The normal lung epithelial cell line BEAS-2B or the NSCLC cell line, H-2444, A549, NCI-H647, and NCI-H23 cells were treated with indicated doses of erlotinib for 3 days and cell viability was measured. Data is representative of three independent experiments, each done in triplicate. Error bars, SD. (E) Relative expression of lncRNA PART1 determined by qRT-PCR. Post-normalization to 18s rRNA expression, expression relative to BEAS-2B is shown. Error bars, SEM. Error bars, SD. *P<0.05. Overexpression of PART1 makes BEAS-2B cells resistant to erlotinib. (A) Relative expression of lncRNA PART1 determined by qRT-PCR. Post-normalization to 18s rRNA expression, expression relative to mock transduction (BEAS-2B) or transfection (other cell lines). Error bars, SEM. Error bars, SD. *P<0.05. (B) Mock or PART1 transduced BEAS-2B cells were treated with indicated doses of erlotinib for 3 days and cell viability was measured. Data is representative of three independent experiments, each done in triplicate. Error bars, SD. *P<0.05.

Cytotoxicity Assays

Cytotoxicity of erlotinib (Selleckchem, Houston, USA) was determined in dose-dependent manner in indicated cell types and conditions. In each case, cells were treated with indicated dose of erlotinib for 3 days before cell viability was measured using MTT (3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyl tetrazolium bromide) assay (Sigma Aldrich, Shanghai, China). The antiproliferative effect of erlotinib was calculated as a percentage of cell growth inhibition with respect to dose and compared to the respective controls. Data are represented as mean ± standard deviation (SD). P-values were calculated by t-test. P < 0.05 was considered statistically significant.

Statistical Analysis

All data, except for qRT-PCR, were represented as mean ± standard deviation (SD) of at least three independent replicates. qRT-PCR data were presented as mean + SEM. Statistical significance between groups was analyzed using the Student’s t-test. A P-value <0.05 was considered statistically significant.

Results

We initially determined mRNA and protein expression of EGFR in the normal lung cell line BEAS-2B and the NSCLC cell lines, NCI-H647, NCI-H24444, NCI-H23, and A549. Steady state mRNA expression of EGFR was not significantly different among the NSCLC cell lines compared to the normal lung cell line BEAS-2B (Figure 1A). Both Western blot (Figure 1B) and immunofluorescence analysis (Figure 1C) showed equivalent EGFR protein expression in these cell lines. We also tested for phosphorylated (Tyrosine 1068) EGFR in these cell lines. Given that the cells were not treated with EGF we did not observe any phosphorylated EGFR along expected lines (data not shown). We next determined the chemosensitivity of these cells to increasing concentration of erlotinib over 72 hours. Cells were treated with 0–20 µM erlotinib and relative viability was measured after 72 hours. The IC50 for BEAS-2B was 3.4185 ± 0.54 µM (Figure 1D). The IC50 for each of the NSCLC cell lines was greater than 20 µM (Figure 1D), indicating that these cell lines were resistant to erlotinib. Our broad question was whether lncRNA PART1 was involved in the observed erlotinib resistance in these cells. We initially determined the relative expression of lncRNA PART1 in BEAS-2B and the NCI-H647, NCI-H24444, NCI-H23, and A549 cell lines. Similar levels of high PART1 expression were observed in NCI-H647, NCI-H24444, NCI-H23, and A549 cells, which was significantly higher than that observed in the normal lung cell line BEAS-2B (Figure 1E; P<0.05 in each case). This indicated that lncRNA PART1 is overexpressed in NSCLC cell lines, corroborating previous studies.22,23 We then investigated if modulating PART1 expression will alter chemosensitivity of BEAS-2B or the NSCLC cell lines. PART1 was overexpressed in BEAS-2B cells, whereas the NSCLC cells lines were transfected with PART1 siRNA. Overexpression of PART1 in BEAS-2B and knockdown in NCI-H647, NCI-H24444, NCI-H23, and A549 cell lines were confirmed by qRT-PCR (Figure 2A). To determine if overexpression of PART1 in the BEAS-2B cells alter their sensitivity to erlotinib, we treated the mock or PART1 transduced BEAS-2B cells to different doses of erlotinib for 72 hours and quantified their relative viability by MTT assay. Overexpression of PART1 increased the IC50 from 2.86 ± 0.31 µM to 13.48 ± 0.03 µM (Figure 2B; P<0.05). This indicated that PART1 expression level is potentially regulated to sensitivity to erlotinib in lung cancer cells. We next investigated if decreasing PART1 expression in the NSCLC cell lines will increase their sensitivity to erlotinib. Mock transfected or PART1 siRNA transfected NSCLC cells were treated with different doses of erlotinib for 3 days and relative viability were determined. The IC50 in NCI-H2444 (26.55 ± 2.34 µM in PART1 siRNA vs 26.69 ± 1.29 µM control siRNA; P>0.05) and NCI-H647 (31.27 ± 1.09 µM in PART1 siRNA vs 32.27 ± 3.28 µM control siRNA; P>0.05) did not change even after PART1 knockdown (Figure 3A and B). However, the IC50 of A549 (6.97 ± 1.21 µM in PART1 siRNA vs 27.02 ± 1.34 µM control siRNA; P<0.05) and NCI-H23 (9.12 ± 3.1 µM in PART1 siRNA vs 25.32 ± 1.12 µM control siRNA; P<0.05) significantly decreased following knockdown of PART1 (Figure 3C and D). The differential response observed was not due to different efficiency of PART1 knockdown (Figure 2A). This indicated that there are secondary factors whose expression is different in the NSCLC cell lines and that mediate the effect of PART1 on sensitivity to erlotinib.
Figure 3

Differential sensitivity of NSCLC cell lines to erlotinib following knockdown of PART1. Indicated cells were transfected with PART1 or negative control siRNA for 48 hours. Post-48 hours of transfection, cells (NCI-H2444 (A), NCI-H647 (B), A549 (C), and NCI-H23 (D)) were treated with indicated doses of erlotinib for 3 days and cell viability was measured. Data is representative of three independent experiments, each done in triplicate. Error bars, SD. *P<0.05.

Differential sensitivity of NSCLC cell lines to erlotinib following knockdown of PART1. Indicated cells were transfected with PART1 or negative control siRNA for 48 hours. Post-48 hours of transfection, cells (NCI-H2444 (A), NCI-H647 (B), A549 (C), and NCI-H23 (D)) were treated with indicated doses of erlotinib for 3 days and cell viability was measured. Data is representative of three independent experiments, each done in triplicate. Error bars, SD. *P<0.05. We evaluated the mutation status of the NSCLC cell lines from published literature.24 This search revealed that both NCI-H23 and A549 cell lines harbor PTEN mutation whereas the NCI-H2444 and NCI-H647 cell lines harbored KRAS mutation. NCI-H2444 harbors KRAS G12V mutation whereas NCI-H647 harbors KRAS G13D mutation. Whereas the PTEN mutation results in constitutive PI3K/AKT signaling, the KRAS mutations result in hyperactivation of the MAPK pathway. Given that both cell lines with KRAS mutation were resistant to erlotinib irrespective of PART1 expression we next determined if altering KRAS expression in these cell lines would sensitize them to erlotinib treatment. Hence, we transduced NCI-H2444 and NCI-H647 cells with shRNA targeting KRAS alone or in combination with siRNA targeting PART1 and confirmed knockdown by qRT-PCR (Figure 4A) immunoblot analysis (Figure 4B).
Figure 4

NSCLC cells with mutant KRAS become sensitive to erlotinib following combined knockdown of PART1 and KRAS. (A) Relative expression of KRAS determined by qRT-PCR. Post-normalization to 18s rRNA expression, expression relative to respective controls are shown. Error bars, SEM. Error bars, SD. *P<0.05 versus mock-KRAS group; #P<0.05 versus mock-PART1 group. (B) Immunoblot analysis of KRAS in NCI-H2444 and NCI-H647 cells transduced with negative control or KRAS shRNA. Blots were probed with GAPDH to confirm loading across lanes. Shown are representative blots from three independent experiments. (C, D) KRAS knockdown NCI-H2444 (C) and NCI-H647 (D) cells were transiently transfected with negative control (mock) or PART1 siRNA. Post-48 hours of transfection, cells (NCI-H2444 (C), and NCI-H647 (D)) were treated with indicated doses of erlotinib for 3 days and cell viability was measured. Data is representative of three independent experiments, each done in triplicate. Error bars, SD. *P<0.05, #P<0.05.

NSCLC cells with mutant KRAS become sensitive to erlotinib following combined knockdown of PART1 and KRAS. (A) Relative expression of KRAS determined by qRT-PCR. Post-normalization to 18s rRNA expression, expression relative to respective controls are shown. Error bars, SEM. Error bars, SD. *P<0.05 versus mock-KRAS group; #P<0.05 versus mock-PART1 group. (B) Immunoblot analysis of KRAS in NCI-H2444 and NCI-H647 cells transduced with negative control or KRAS shRNA. Blots were probed with GAPDH to confirm loading across lanes. Shown are representative blots from three independent experiments. (C, D) KRAS knockdown NCI-H2444 (C) and NCI-H647 (D) cells were transiently transfected with negative control (mock) or PART1 siRNA. Post-48 hours of transfection, cells (NCI-H2444 (C), and NCI-H647 (D)) were treated with indicated doses of erlotinib for 3 days and cell viability was measured. Data is representative of three independent experiments, each done in triplicate. Error bars, SD. *P<0.05, #P<0.05. The KRAS knockdown cells were then transfected with PART1 or negative control siRNA and knockdown by qRT-PCR (Figure 4A). The sensitivity to erlotinib was subsequently analyzed by MTT assay. Stable knockdown of KRAS did not make either the NCI-H2444 (IC50 26.84 ± 0.09 µM) or NCI-H647 cells (IC50 27.02 ± 2.91 µM) (Figure 4C and D). However, knockdown of PART1 in the KRAS knockdown NCI-H2444 and NCI-H647 cells sensitized them to erlotinib treatment decreasing the IC50 to 5.89 ± 0.39 µM and 3.14 ± 0.14 µM, respectively (Figure 4C and D; P<0.05 in each case). Taken together, these results confirmed that decreasing PART1 expression can sensitize NSCLC cells with wild-type KRAS, but such a strategy will not work in cells with mutant KRAS. Our results also indicate that PART1 mediates its chemoresistant activity to erlotinib via KRAS.

Discussion

The PART1 lncRNA was originally characterized in the prostate gland and was shown to be regulated by androgens.21,25,26 PART1 has been indicated previously in glioblastoma,27 esophageal squamous cell carcinoma (ESCC),28 oral cancer,29 colorectal cancer,30 as well as in survival and disease progression of NSCLC.22,23 However, there has been no previous study elucidating a role of PART1 in chemoresistance to erlotinib in NSCLC. In ESCC, it has been shown that exosome-mediated transfer of PART1 can induce resistance to the tyrosine kinase inhibitor gefitinib. In this context, PART1 has also been shown to function as a competing endogenous RNA (ceRNA). PART1 was found to sponge miR-129 and activate Bcl2 in ESCC.28 Whether PART1 functions also mediate resistance to the tyrosine kinase inhibitor erlotinib in NSCLC by functioning as a ceRNA has to be determined in future studies. Despite the best of efforts in understanding molecular mechanism dictating chemoresistance in cancer cells it still continues to be an enigma.31 Recent evidences have suggested that lncRNAs and miRNAs can both be critical regulators of this process and our current study corroborates those findings in that PART1 expression was higher in chemoresistant cells and downregulating its expression in cells with wild type KRAS sensitized the cells to erlotinib. It is not entirely without precedence that KRAS mutation status is dictating chemosensitivity of cancer cells. It has been shown that the let-7b, which is a tumor suppressor, replenishment sensitizes KRAS mutant cancer cells to paclitaxel and gemcitabine treatment.32 In the current study, we found that PART1 requires wild-type KRAS activity to render resistance to erlotinib. Furthermore, knockdown of mutant KRAS alone did not sensitize the cells to erlotinib treatment. Only when both mutant KRAS and PART1 expression were downregulated the cells became sensitive to erlotinib highlighting PART1 mediates the resistance but requires KRAS activity. The KRAS mutations are known to cause constitutive activation of MAPK pathway so there might be a possibility of crosstalk between MAPK signaling and EGFR signaling. Hyperactive MAPK pathway perhaps overrides the effect of PART1 downregulation and maintains chemoresistance in the NSCLC cells. To completely define the specific molecules mediating this effect, gene expression analysis in the different cell types needs to be performed.

Conclusion

One potential limitation of our study is that it was done using in vitro cells. The results need to be expanded and verified to other in vivo models of NSCLS as well as tested in clinical samples. In summary, our results show that PART1 mediates resistance to erlotinib in NSCLC cells with wild-type KRAS and modulating its expression can potentially be tailored to targeted therapies or PART1 expression can be used as a predictor of resistance in NSCLSC patients without somatic mutations in EGFR.
  32 in total

1.  PART-1 functions as a competitive endogenous RNA for promoting tumor progression by sponging miR-143 in colorectal cancer.

Authors:  Yongbo Hu; Zhen Ma; Yiming He; Wei Liu; Yu Su; Zongbin Tang
Journal:  Biochem Biophys Res Commun       Date:  2017-06-12       Impact factor: 3.575

2.  Metastatic non-small cell lung cancer: ESMO Clinical Practice Guidelines for diagnosis, treatment and follow-up.

Authors:  D Planchard; S Popat; K Kerr; S Novello; E F Smit; C Faivre-Finn; T S Mok; M Reck; P E Van Schil; M D Hellmann; S Peters
Journal:  Ann Oncol       Date:  2018-10-01       Impact factor: 32.976

3.  EGFR mutation and resistance of non-small-cell lung cancer to gefitinib.

Authors:  Susumu Kobayashi; Titus J Boggon; Tajhal Dayaram; Pasi A Jänne; Olivier Kocher; Matthew Meyerson; Bruce E Johnson; Michael J Eck; Daniel G Tenen; Balázs Halmos
Journal:  N Engl J Med       Date:  2005-02-24       Impact factor: 91.245

4.  Complex integrated analysis of lncRNAs-miRNAs-mRNAs in oral squamous cell carcinoma.

Authors:  Simin Li; Xiujie Chen; Xiangqiong Liu; Yang Yu; Hongying Pan; Rainer Haak; Jana Schmidt; Dirk Ziebolz; Gerhard Schmalz
Journal:  Oral Oncol       Date:  2017-07-31       Impact factor: 5.337

5.  Gefitinib or chemotherapy for non-small-cell lung cancer with mutated EGFR.

Authors:  Makoto Maemondo; Akira Inoue; Kunihiko Kobayashi; Shunichi Sugawara; Satoshi Oizumi; Hiroshi Isobe; Akihiko Gemma; Masao Harada; Hirohisa Yoshizawa; Ichiro Kinoshita; Yuka Fujita; Shoji Okinaga; Haruto Hirano; Kozo Yoshimori; Toshiyuki Harada; Takashi Ogura; Masahiro Ando; Hitoshi Miyazawa; Tomoaki Tanaka; Yasuo Saijo; Koichi Hagiwara; Satoshi Morita; Toshihiro Nukiwa
Journal:  N Engl J Med       Date:  2010-06-24       Impact factor: 91.245

Review 6.  The EGF receptor family as targets for cancer therapy.

Authors:  J Mendelsohn; J Baselga
Journal:  Oncogene       Date:  2000-12-27       Impact factor: 9.867

7.  EGF receptor gene mutations are common in lung cancers from "never smokers" and are associated with sensitivity of tumors to gefitinib and erlotinib.

Authors:  William Pao; Vincent Miller; Maureen Zakowski; Jennifer Doherty; Katerina Politi; Inderpal Sarkaria; Bhuvanesh Singh; Robert Heelan; Valerie Rusch; Lucinda Fulton; Elaine Mardis; Doris Kupfer; Richard Wilson; Mark Kris; Harold Varmus
Journal:  Proc Natl Acad Sci U S A       Date:  2004-08-25       Impact factor: 11.205

8.  Genistein and daidzein downregulate prostate androgen-regulated transcript-1 (PART-1) gene expression induced by dihydrotestosterone in human prostate LNCaP cancer cells.

Authors:  Lunyin Yu; George L Blackburn; Jin-Rong Zhou
Journal:  J Nutr       Date:  2003-02       Impact factor: 4.798

9.  Let-7 Sensitizes KRAS Mutant Tumor Cells to Chemotherapy.

Authors:  Xin Dai; Ying Jiang; Chalet Tan
Journal:  PLoS One       Date:  2015-05-06       Impact factor: 3.240

10.  PART1 expression is associated with poor prognosis and tumor recurrence in stage I-III non-small cell lung cancer.

Authors:  Ming Li; Weiwei Zhang; Shenjun Zhang; Changhui Wang; Yinping Lin
Journal:  J Cancer       Date:  2017-07-01       Impact factor: 4.207

View more
  1 in total

Review 1.  Emerging role of non-coding RNAs in the regulation of KRAS.

Authors:  Soudeh Ghafouri-Fard; Zeinab Shirvani-Farsani; Bashdar Mahmud Hussen; Mohammad Taheri; Reza Jalili Khoshnoud
Journal:  Cancer Cell Int       Date:  2022-02-09       Impact factor: 5.722

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.