| Literature DB >> 32605314 |
Li-Chan Yang1, Shih-Wei Lin2, I-Chen Li2, Yen-Po Chen2, Shih-Yang Tzu2, Wei Chou2, Chin-Chu Chen2,3,4,5, Wen-Chuan Lin1, Yen-Lien Chen2, Wen-Hsin Lin1.
Abstract
<span class="Disease">Osteoporosis, an imbalance in the bone-forming process mediated by osteoblasts and the bone-resorbing function mediated by osteoclasts, is a <span class="Disease">bone degenerative disease prevalent among the aged population. Due to deleterious side effects of currently available medications, probiotics as a potential treatment of osteoporosis is an appealing approach. Hence, this study aims to evaluate the beneficial effects of two novel Lactobacilli strain probiotics on bone health in ovariectomized (OVX) induced osteoporotic mice model and its underlying mechanisms. Forty-five 9-week-old Institute of Cancer Research (ICR) mice underwent either a sham-operation (n = 9) or OVX (n = 36). Four days after the operation, OVX mice were further divided into four groups and received either saline alone, Lactobacillus plantarum GKM3, Lactobacillus paracasei GKS6 or alendronate per day for 28 days. After sacrifice by decapitation, right distal femur diaphysis was imaged via micro-computed tomography (MCT) and parameters including bone volume/tissue volume ratio (BV/TV), trabecular thickness (Tb.Th), trabecular number (Tb.N), trabecular separation (Tb.Sp), and bone mineral density (BMD) were measured. Moreover, GKM3 and GKS6 on RANKL-induced osteoclast formation and osteoblast differentiation using in vitro cultures were also investigated. The results showed that both probiotics strains inhibited osteoporosis in the OVX mice model, with L. paracasei GKS6 outperforming L. plantarum GKM3. Besides this, both GKS6 and GKM3 promoted osteoblast differentiation and inhibited RANKL-induced osteoclast differentiation via the Bone Morphogenetic Proteins (BMP) and RANKL pathways, respectively. These findings suggested that both strains of Lactobacilli may be pursued as potential candidates for the treatment and management of osteoporosis, particularly in postmenopausal osteoporosis.Entities:
Keywords: Lactobacillus paracasei GKS6; Lactobacillus plantarum GKM3; osteoblast; osteoclast; osteoporosis
Year: 2020 PMID: 32605314 PMCID: PMC7401263 DOI: 10.3390/nu12071914
Source DB: PubMed Journal: Nutrients ISSN: 2072-6643 Impact factor: 5.717
Specific primers used for QPCR.
| Gene | Forward | Reverse |
|---|---|---|
| BMP-2 | 5′−GGGTTGGAACTCCAGACTGT−3′ | 5′−GAAGAGTGAGTGGACCCCAG−3′ |
| ALP | 5′−CCACGTCTTCACATTTGGTG−3′ | 5′−AGACTGCGCCTAGTAGTTGT−3′ |
| OCN | 5′−TGAGAGCTCTCACACTCCTCGCCCTATTGG−3′ | 5′−GCTCCCAGCCATCGATACAGGTAGCGC−3′ |
| RANK | 5′−AAACCTTGGACCAACTGCAC−3′ | 5′−ACCATCTTCTCCTCCCHAGT−3′ |
| c-Fos | 5′−ATGGGCTCTCCTGTCAACAC−3′ | 5′−GGCTGCCAAAATAAACTCCA−3′ |
| TRAP | 5′−ACTTCCCCAGCCCTTACTACCG−3′ | 5′−TCAGCACATAGCCCACACCG−3′ |
| GAPDH | 5′−ACTTTGTCAAGCTCATTTCC−3′ | 5′−TGCAGCGAACTTTATTGATG−3′ |
| BMP-2: bone morphogenetic protein-2; ALP: alkaline phosphatase; OCN: osteocalcin; RANK: receptor activator of nuclear factor-κB; TRAP: tartrate-resistant acid phosphatase | ||
Figure 1Body weight changes of mice in different groups. * p < 0.05 compared with ovariectomized (OVX) mice.
Figure 2Representative Micro Computed Tomography images of Femur in (A) Sham group, (B) OVX untreated group, (C) OVX + GKM3 20.5 mg/kg group, (D) OVX + GKS6 20.5 mg/kg group and (E) OVX + alendronate 2.5 mg/kg group.
Effects of probiotics on bone morphometric parameters.
| Treatments | Dose (mg/Kg) | BV/TV (%) | Tb.Th | Tb.N | Tb.Sp | BMD |
|---|---|---|---|---|---|---|
| (μm) | (No./mm) | (μm) | (g/cm3) | |||
| Sham | - | 40.9 ± 1.6 d | 112.6 ± 2.6 d | 3.58 ± 0.17 b | 282.2 ± 56.0 ab | 0.67 ± 0.05 d |
| OVX | - | 32.0 ± 2.1 a | 100.1 ± 6.6 a | 3.11 ± 0.16 a | 379.2 ± 51.8 c | 0.51 ± 0.03 a |
| +GKM3 | 20.5 | 32.5 ± 2.3 ab | 104.6 ± 3.5 abc | 3.14 ± 0.13 a | 337.7 ± 44.7 ab | 0.55 ± 0.05 ab |
| +GKS6 | 20.5 | 32.9 ± 2.7 abc | 106.9 ± 5.2 bcd | 3.11 ± 0.12 a | 288.4 ± 37.6 ab | 0.58 ± 0.02 bc |
| +Alen | 2.5 | 34.0 ± 2.1 abc | 106.9 ± 5.6 bcd | 3.20 ± 0.14 a | 255.1 ± 41.3 a | 0.59 ± 0.03 bc |
All data are expressed as mean ± SD (n = 9). Letters a, b, c, and d are used to express analysis results where data labeled with the same letter are not significantly different from each other (p > 0.05). Alen: alendronate; BV/TV: ratio of bone volume/tissue volume; Tb.Th: trabecular thickness; Tb.N: trabecular number; Tb.Sp: trabecular separation; and BMD: bone mineral density.
Figure 3Effect of probiotics on osteoblast and osteoclast differentiation. Data are presented as the mean ± SD. For osteoblast differentiation, MG-63 cells were treated with estradiol, GKM3, and GKS6 in 1% FBS medium for 7 days. Gene expression of (A) bone morphogenetic protein-2 (BMP-2), (B) alkaline phosphatase (ALP), and (C) osteocalcin (OCN) on day 7 were determined by Q-PCR. For osteoclast differentiation, RAW264.7 were treated with estradiol, GKM3, and GKS6 in the presence of 50 ng/mL RANKL for 7 days. Gene expression of (D) receptor activator of nuclear factor-κB (RANK), (E) Cellular Oncogene Fos (c-Fos), and (F) tartrate-resistant acid phosphatase (TRAP) on day 7 were determined by Q-PCR. All data were normalized to GADPH. #p < 0.05 compared with control and *p < 0.05 compared with untreated.