Long Non-coding RNA MALAT1/microRNA-143/VEGFA Signal Axis Modulates Vascular Endothelial Injury-Induced Intracranial Aneurysm.

The roles of some long non-coding RNAs (lncRNAs) in intracranial aneurysm (IA) have been investigated in many studies. The aim of this study is to elucidate the mechanism of lncRNA metastasis-associated lung adenocarcinoma transcript 1 (MALAT1)/microRNA-143 (miR-143)/vascular endothelial growth factor-A (VEGFA) signal axis in vascular endothelial injury-induced IA. MALAT1, miR-143, and VEGFA expression in IA tissues and normal arterial tissues were detected. Matrix metalloproteinase 9 (MMP-9) in tissues, von Willebrand factor (vWF) in serum and tissues, and endothelin-1 (ET-1) in serum were detected. The modeled IA rats were injected with silenced or overexpressed MALAT1 for detecting vascular endothelial injury. Vascular endothelial cells from patients with IA were abstracted and transfected with silenced or overexpressed MALAT1 to verify the impacts of MALAT1 on cell viability and apoptosis. The connections among MALAT1, miR-143, and VEGFA were verified by online prediction, luciferase activity, and RNA-pull down assays. Overexpression of MALAT1 and VEGFA and poor expression of miR-143 were found in IA tissues. Downregulation of MALAT1 inhibited blood pressure, the expression of ET-1, vWF, and MMP-9, as well as the apoptotic index of vascular endothelial cells of rats with IA. Downregulated MALAT1 inhibited apoptosis and promoted viability of vascular endothelial cells in IA. MALAT1 bound to miR-143 and miR-143 targeted VEGFA. This study suggests that MALAT1 elevates VEGFA expression through competitive binding to miR-143, thereby boosting apoptosis and attenuating viability of vascular endothelial cells in IA.

Introduction

Intracranial aneurysm (IA), also known as cerebral aneurysm, is caused by the increase of intracranial pressure induced by the local abnormal widening of the cerebral artery cavity or arterial wall [1]. IA is a severe disease with high mortality and morbidity, and the prevalence rate is about 1–3% in the general population [2]. The main clinical features of IA are cerebral vasospasm, spontaneous cerebral hemorrhage, and oculomotor nerve palsy [3]. So far, the common risk factors leading to the occurrence and development of IA include hemodynamic disorders, gene, aging, infections, and congenital factors [4]. The main clinical treatments, mainly surgical clipping and/or endovascular coiling, are functioned to prevent aneurysm rupture [5]. However, the detailed mechanism underlying IA still remains to be elucidated, reflecting the urgent need for more effective methods in the management of IA.

Long non-coding RNAs (lncRNAs) are longer than 200 nucleotides which belong to a species of non-coding RNAs [6]. It is reported that the expression of lncRNA growth arrest-associated lncRNA 1 in IA is downregulated ancung adenocarcinoma transcript 1 (MALAT1) is a highly enriched and widely expressed lncRNA whose length is about 8000 nt [7]. MALAT1 has been documented to modulate smooth muscle dysfunction in thoracic aortic aneurysm [8]. Also, a study has presented the abnormal expression of lncRNAs and messenger RNA (mRNA) in IA, and the lncRNA-mRNA co-expression networks provide clues to find the pathogenesis of IA [9]. MALAT1 has been suggested to advance osterix expression and modulates osteogenic differentiation via targeting miRNA-143 (miR-143) expression in human bone marrow mesenchymal stem cells [10]. A study has also presented the role of miR-143/145 cluster in reversing the regulation of krüppel-like factor 5 in the smooth muscle cells and its contractility and proliferation in IA [11]. According to Feng et al., downregulation of miR-143/145 and higher matrix metalloproteinase-9 (MMP-9) level during circulation may be related to the formation and rupture of IA [12]. An analysis has revealed that the most uncontrolled miRNAs (miR-143 and miR-145) are common to target genes that are signal pathways, such as vascular endothelial growth factor (VEGF), and other genes that regulate cellular movement or adhesion [13]. A study has revealed the predictive importance of vascular endothelial growth factor-A (VEGFA) variations in IA [14]. Hence, we sought to evaluate the mechanism of MALAT1/miR-143/VEGFA signal axis in IA induced by vascular endothelial injury.

Materials and Methods

Ethics Statement

The study was endorsed by the Institutional Review Board of The First Affiliated Hospital of USTC, Division of Life Sciences and Medicine, University of Science and Technology of China and followed the tenets of the Declaration of Helsinki. Participants provided written informed consent in this study. All animal experiments were in line with the Guide for the Care and Use of Laboratory Animal of the National Institutes of Health. The protocol was permitted by the Committee on the Ethics of Animal Experiments of The First Affiliated Hospital of USTC, Division of Life Sciences and Medicine, University of Science and Technology of China.

Study Subjects

Twenty IA patients (IA group) who had been diagnosed by imaging examination and had received neurosurgical clipping in The First Affiliated Hospital of USTC, Division of Life Sciences and Medicine, University of Science and Technology of China were selected for our experiments. There were 11 males and 9 females who aged 43.27 ± 6.25 years. The IA tissues were sampled. Meanwhile, the temporal cortical arterial vascular tissues from temporal pole were resected from 20 patients (control group) with temporal lobe epilepsy caused by amygdala and hippocampal sclerosis. The resected tissues were examined as normal arterial tissues by histopathology after operation, and there were 13 males and 7 females aged 44.18 ± 5.91 years. No significant discrepancy was recognized in gender and age between the IA group and control group (both P > 0.05). Venous blood samples (2 tubes) were obtained from all subjects in fasting condition at the same time in the morning before operation.

Establishment of Rat Models of IA

Sixty clean-grade Sprague-Dawley male rats (Hunan SJA Laboratory Animal Co., Ltd., Hunan, China), weighting between 200 and 250 g, were raised for 7 days (25 ± 2 °C, relative humidity of 65–70%, 12 h of light and dark cycle, free water and food intake). Rats were dropped with the porcine pancreatic elastase to the external carotid artery and around the bifurcation artery wall. The external carotid artery was ligated with two surgical lines at the branch of the external carotid artery about 1.5 mm. The external carotid artery was cut between the two lines to form an internal carotid aneurysm in the blind segment of the external carotid artery. Rats were fed with 1% saline for 1 week after operation. Cerebral angiography was performed after 1 month and the formation of aneurysm was observed.

After the establishment of IA rat models, 50 rats were randomly distributed into blank group (n = 10, modeled rats were treated with stereotactic injection of 100 μL phosphate buffered saline (PBS) once a day), short hairpin RNA (sh)-negative control (NC) group (n = 10, modeled rats were treated with stereotactic injection of 100 μL sh-MALAT1 NC once a day), sh-MALAT1 group (n = 10, modeled rats were treated with stereotactic injection of 100 μL sh-MALAT1 plasmid once a day), overexpression (Oe)-NC group (n = 10, modeled rats were treated with stereotactic injection of 100 μL Oe-MALAT1 NC plasmid once a day), and Oe-MALAT1 group (n = 10, modeled rats were treated with stereotactic injection of 100 μL Oe-MALAT1 plasmid once a day) [15]. The above plasmids were composed by Shanghai Genechem Co., Ltd. (Shanghai, China).

Blood Pressure Test of Rats

The blood pressure of rats’ tail artery was measured at the 1st, 4th, and 12th week after operation. Before measuring blood pressure, the rats were placed in a constant temperature heating device for a moment to prevent the disturbance of external temperature. Secondly, the rats were kept quiet for several minutes in a special rat cage to prevent the interference of activity. If the blood pressure varied to a large extent, it was determined twice or three times in different times to obtain the average value.

Aneurysm Tissue Acquisition

After 3 months, rats were anesthetized with 1% pentobarbital sodium (40 mg/kg) by intraperitoneal injection to obtain blood samples from the veins. Rats were euthanized, and chest was opened, the left ventricle was intubated into the aorta, and the cava was cut to release the blood. Meanwhile, 30 mL of normal saline containing heparin sodium was utilized for rapid cardiac perfusion to flush blood, and then 10 mL of 10% polyformaldehyde/0.1 M PBS (pH 7.4) was injected into the brain. After perfusion and fixation, the brain of rat was opened. The arterial circulation in the skull base was carefully observed, the aneurysm tissue was separated, and the changes of aneurysm were observed under the microscope.

Enzyme-Linked Immunosorbent Assay (ELISA)

Serum-related indices were tested by ELISA kit. The collected blood samples were placed in a 37 °C thermostat for 1 h and centrifuged at 3000 r/min for 10 min. Detection of endothelin-1 (ET-1) and von Willebrand factor (vWF) expression was conducted in accordance with kit’s instructions (all kits were purchased from NanJing JianCheng Bioengineering Institute, Jiangsu, China).

Hematoxylin-Eosin (HE) Staining

The samples were fixed with 10% formalin for more than 24 h and preserved in paraffin blocks. The paraffin blocks were dewaxed with xylene for 20 min, dehydrated with gradient descending series of alcohol (100%, 95%, 80%, 75%) for l min, and dyed with hematoxylin for 10 min. Then, the tissues were rinsed with distilled water, differentiated with hydrochloric acid ethanol for 30 s, and soaked in warm water at 50 °C for 5 min. Dyed with eosin solution, the tissues were rinsed with distilled water, dehydrated with 70% and 90% alcohol, cleared with xylene, and sealed with neutral gum. The morphology of the tissues was observed under a high-power microscope.

Transmission Electron Microscope Observation

The spare tissues were fixed with 2.5% glutaric dialdehyde and 1% osmitic acid, dehydrated and then embedded with Epon812 resin. The semi-thin sections were dyed with toluene blue, trimmed, and made into ultra-thin sections. The sections were dyed with uranyl acetate and lead citrate and observed by a JME-2000EX transmission electron microscope (Hitachi High-Technologies Co., Ltd., Shanghai, China).

Terminal Deoxynucleotidyl Transferase-Mediated Deoxyuridine Triphosphate-Biotin Nick End-Labeling (TUNEL) Staining

TUNEL staining was implied to observe endothelial cell apoptosis in IA rats on the basis of TUNEL kit (Roche, Basel, Switzerland). The prepared rat aneurysm sections were washed twice with xylene (5 min/time) and dehydrated with descending series of alcohol (100%, 95%, 80%, 75%) for 3 times (5 min/time). The tissues were treated with 20 μg/mL protease K solution without DNase for 15–30 min, dropped with 50 μL TUNEL reaction solution for 60 min, and developed with 50 μL diaminobenzidine (DAB) at 25 °C for 10 min. Then, sections were counterstained with hematoxylin, dehydrated with gradient alcohol, cleared with xylene, and sealed with neutral gum. The sections were observed under the optical microscope and the apoptotic index was calculated.

Isolation and Identification of Aneurysm Vascular Endothelial Cells

Endothelial cell isolation was performed according to the method conducted by Boscolo et al. [16]. The IA tissues were sectioned into 3 mm2 fragments. The tissues were incubated with 0.1% collagenase B/0.1% dispase (Roche) for 25 min at 37 °C. Then, the pre-detached tissues were triturated for 2 min by a 2 mL pipette and filtered with a 100-μm strainer (Thermo Fisher Scientific, Rockford, IL, USA). Subsequently, cell suspension was centrifuged and then resuspended in MV2 medium (including growth factors and 20% fetal bovine serum) (PromoCell, Heidelberg, Germany). The cells were seeded at 1 × 104 cells/mL in a culture flask coated with 1 μg/cm2 fibronectin. Following the method described by Jackson et al. [17], the cells of 80–100% confluence were separated with the beads (Dynabeads M-450 Tosylactived, Oxoid, Hampshire, UK) coated by Ulex europaeus Agglutinin I (UEA) (Vector Laboratories, Ltd., Peterborough, UK). The endothelial cells adhered to the lectin-coated beads were amassed with a magnetic particle concentrator and the unconjugated cells were washed with a basal medium. The UEA positive cells were resuspended in the culture medium and seeded in the fibronectin-coated culture flask to improve the adhesion and growth rate of the cells.

Cells were grown in MV2 on fibronectin-coated chamber slides. When the cell confluence reached 80–100%, the cells were fastened in acetone at 4 °C and treated with 1% Triton X-100 for 5 min and then 0.5% bovine serum albumin (BSA) for 15 min. The cells were dripped with primary antibody against vWF (1:300, Abcam, Cambridge, MA, USA) and incubated for 2 h (NC was performed in the absence of primary antibody), dripped with horseradish peroxidase-conjectured immunoglobulin G (1:150, Abcam) and incubated for 30 min. Then cells were developed with 50 μL DAB at 25 °C for 5 min, counterstained with hematoxylin, differentiated with 0.1% hydrochloric acid, dehydrated with alcohol, followed by xylene clearance, and neutral gum sealing. After drying, cells were photographed under an inverted microscope.

Cell Grouping and Transfection

The aneurysm vascular endothelial cells in the logarithmic phase were assigned into 5 groups: blank group (aneurysm vascular endothelial cells without any treatment), sh-NC group (aneurysm vascular endothelial cells transfected with sh-MALAT1 NC plasmid), sh-MALAT1 group (aneurysm vascular endothelial cells transfected with sh-MALAT1 plasmid), Oe-NC group (aneurysm vascular endothelial cells transfected with Oe-MALAT1 NC plasmid), and Oe-MALAT1 group (aneurysm vascular endothelial cells transfected with Oe-MALAT1 plasmid). The above plasmids were synthesized by Genechem. Cell transfection was carried out in accordance with the instructions of the lipofectamineTM 2000 reagent (11668-027, Invitrogen, Carlsbad, California, USA).

3-(4, 5-Dimethylthiazol-2-Yl)-2, 5-Diphenyltetrazolium Bromide (MTT) Assay

The vascular endothelial cells of each group were seeded on a 96-well plate at a density of 3 × 104 cells/mL and cultured at 37 °C, 5% CO2 for 48 h. Each group was set with 5 parallel wells, and each well was appended with 20 μL fresh MTT solution (5 mg/mL, Sigma, St. Louis, MO, USA). After 4-h reaction, the cells were mixed with 200 μL dimethyl sulfoxide. After full dissolution, the optical density value of cells in each group was measured by a microplate reader (BioRad, Hercules, California, USA) at 490 nm.

Flow Cytometry

Cell cycle distribution was tested by propidium iodide (PI) staining. Vascular endothelial cells were detached, centrifuged, resuspended with pre-cooled 75% ethanol, and fastened overnight at − 20 °C. The cells were centrifuged to discard the supernatant. Cells were appended in 450 μL PBS, added with 100 μL Rnase A, and stained by 400 μL PI at 4 °C for 30 min avoiding light. A flow cytometer (FACSCalibur, Becton, Dickinson and Company, NJ, USA) was utilized to test cell cycle distribution.

Cell apoptosis was tested by Annexin V/PI double staining. Detached endothelial cells were gathered and washed with PBS 3 times. Cells were resuspended with 100 μL pre-cooled 1 × binding buffer and mixed with 5 μL Annexin and 5 μL PI, respectively. Cell apoptosis was tested by a flow cytometer. With AnnexinV as a transverse axis and PI as a longitudinal axis, the left upper quadrant stood for mechanical injured cells (AnnexinV−/PI+), the right upper quadrant for late apoptotic cells or necrotic cells (AnnexinV+/PI+), the left lower quadrant for negative normal cells (AnnexinV−/PI−), and the right lower quadrant for early apoptotic cells (AnnexinV+/PI−). The total apoptotic cells (AnnexinV+/PI− and AnnexinV+/PI+) were calculated and expressed as a percentage.

Reverse Transcription Quantitative Polymerase Chain Reaction (RT-qPCR)

The total RNAs in the tissues and cells were abstracted by Trizol (Takara Biotechnology Ltd., Dalian, China), and the concentration and purity of RNA were determined. The process of reverse transcription of RNA into complementary DNA was conducted in accordance with the instructions of reverse transcription kit (K1621, Fermentas, Maryland, NY, USA). MALAT1, miR-143, and VEGFA primer sequences (Table 1) were devised and composed by Genechem. To evaluate the expression of lncRNA, miRNA, or mRNA, RT-qPCR was conducted using SYBR GreenPCR Master Mix (Takara, Tokyo, Japan) with Roche Real-Time PCR system (Roche). U6 was set as an internal parameter of miR-143, while MALAT1 and VEGFA, with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as internal parameters. The relative transcriptional levels of target genes were computed by 2−△△Ct method.

Table 1

Primer sequence

Gene	Sequence (5’→3’)
MALAT1	F: 5’- GCAGGGAGAATTGCGTCATT -3’
	R: 5’- TTCTTCGCAGAATTGCGTCATT -3’
miR-143	F: 5’- GTGGTGAGATGAAGCACTG -3’
	R: 5’- TGGTGTCGTGGAGTCG-3’
VEGFA	F: 5’-ACGGATCCATGGCGGTCAATCCCACGTC-3’
	R: 5’-TTGAATTCTTACCGCCTCGGCTTGTCAC-3’
U6	F: 5’-CTCGCTTCGGCAGCACA-3’
	R: 5’-AACGCTTCACGAATTTGCGT-3’
GAPDH	F: 5’-TCCCATCACCATCTTCCA-3’
	R: 5’-CATCACGCCACAGTTTTCC-3’

Note: F forward, R reverse, MALAT1 metastasis-associated lung adenocarcinoma transcript 1, miR-143 microRNA-143, VEGFA vascular endothelial growth factor, GAPDH glyceraldehyde phosphate dehydrogenase

Western Blot Analysis

Total protein from tissues and cells were abstracted. The protein concentration was determined by the instructions of bicinchoninic acid kit (Boster Biological Technology Co. Ltd., Wuhan, Hubei, China). The protein was separated by electrophoresis with 10% polyacrylamide gel (Boster Biological Technology). The membrane was transferred onto a polyvinylidene fluoride membrane and then sealed with 5% BSA for 1 h. The membrane was incubated with primary antibody against Ki-67 (1:1000), VEGFA (1:1000), vWF (1:1000), and matrix metalloproteinase (MMP)-9 (1:1000, Abcam, Cambridge, UK), Cyclin D1 (1:1000), Bax (1:1000), and Bcl-2 (1:1000, Santa Cruz Biotechnology, Santa Cruz, California, USA), and GAPDH (1:2000, Jackson Immuno Research, Grove, Pennsylvania, USA) and with the secondary antibody (1:500, Jackson Immuno Research) labeled with horseradish peroxide. The membrane was obtained by Odyssey two-color infrared fluorescence scanning imaging system, and the gray values of bands were measured by Quantity One image analysis software.

Dual Luciferase Reporter Gene Assay

The binding sites of MALAT1 and miR-143 were forecasted and expounded by bioinformatics website (https://cm.jefferson.edu/rna22/Precomputed/). The binding relationship between MALAT1 and miR-143 was further verified by luciferase reporter gene assay. The synthetic MALAT1 3′untranslated region (3′UTR) gene fragment was introduced into pmiR-Report luciferase reporter vectors (Thermo Fisher Scientific) to generate MALAT1 wild-type (MALAT1-WT) by endonuclease site Bamh1 and Ecor1. The complementary sequence mutation site of the sequence was devised on MALAT1-WT, and the target fragment was inserted into the pmiR-Report luciferase reporter vectors to produce MALAT1 mutant-type (MALAT1-MUT) by T4 DNA ligase after restriction endonuclease digestion. The correctly sequenced MALAT1-WT and MALAT1-MUT were co-transfected with mimic NC and miR-143 mimic into vascular endothelial cells. The cells were harvested and lysed 48 h after transfection, and luciferase activity was tested by luciferase detection kit (BioVision, San Francisco, CA, USA) with a luminometer (Glomax20/20, Promega, Madison, Wisconsin, USA).

The target relationship of miR-143 and VEGFA and binding site of miR-143 and VEGFA 3′UTR were forecasted through bioinformatics website (http://www.targetscan.org/vert_72/). The sequence of VEGFA 3′UTR promoter region containing miR-143 binding site was compounded and cloned into pmiR-Report luciferase reporter vectors to generate VEGFA-WT. On the basis of this reporter, the binding site of VEGFA-WT and miR-143 was mutated to form VEGFA-MUT. VEGFA-WT or VEGFA-MUT reporter was mixed with mimic NC or miR-143 mimic and then co-transfected into vascular endothelial cells for 48 h. After that, the cells were lysed and the luciferase activity was tested by a luciferase detection kit.

RNA-Pull Down Assay

To verify the binding relationship between miR-143 and MALAT1, RNA-pull down assay was implemented. Three biotin-labeled miRNA sequences Bio-miR-143-WT, Bio-miR-143-MUT, and Bio-miR-NC were designed and entrusted to GenePharma Company (Shanghai, China). These biotinylated oligonucleotides were transfected into cells for 48 h. Then, the cells were harvested and incubated with a specific cell lysate (Ambion, Austin, Texas, USA) for 10 min. After that, the lysate was hatched with M-280 streptavidin beads pre-coated with RNase-free and yeast tRNA (all from Sigma) at 4 °C for 3 h, then cleaned twice with a cold lysis solution, three times with a low salt buffer, and once with high-salt buffer solution. An antagonistic miR-143 probe was established as a NC. Total RNA was abstracted with Trizol and then MALAT1 enrichment level was tested using RT-qPCR.

Statistical Analysis

All data were expounded by the SPSS 21.0 software (IBM Corp. Armonk, NY, USA). The measurement data were represented by mean ± standard deviation. Comparisons between two groups were conducted by independent sample t test, while comparisons among multiple groups were assessed by one-way analysis of variance (ANOVA), and pairwise comparison were implemented by Tukey’s multiple comparisons test. The relationship among MALAT1 expression and the clinicopathological features of IA was determined by chi-square test. P value less than 0.05 was indicative of statistically significant difference.

Results

MALAT1 and VEGFA Are Overexpressed and miR-143 Is Downregulated in IA Tissues

ET-1 and vWF expression in serum in the IA group and control group were detected by ELISA, and the results manifested that ET-1 and vWF expression increased in the IA group versus the control group (both P < 0.05) (Fig. 1a, b).

Fig. 1

MALAT1 and VEGFA are overexpressed, and miR-143 is downregulated in IA tissues. a ET-1 expression in serum of IA patients and temporal lobe epilepsy patients by ELISA. b vWF expression in serum of IA patients and temporal lobe epilepsy patients by ELISA. c Pathological observation of IA tissues and normal arterial tissues by HE staining. d Morphological observation of IA tissues and normal arterial tissues by a transmission electron microscope. e MALAT1, miR-143, and VEGFA mRNA expression in IA tissues and normal arterial tissues by RT-qPCR. f VEGFA, MMP-9, and vWF protein expression in IA tissues and normal arterial tissues by western blot analysis. Endothelial cells (ECs), internal elastic lamina (IEL), smooth muscle cells (SMC). Measurement data were depicted as mean ± standard deviation; comparisons between groups were conducted by independent sample t test

The pathological changes of IA tissues were observed through HE staining. No obvious damage in endoderm, endothelial cells, and smooth muscle cells was seen in normal arterial tissues, and the cells were arranged neatly and had a complete structure. The IA tissues presented damaged endothelial cells, degenerated smooth muscle cells, attenuated arterial wall, ruptured elastic fibers, and infiltrated inflammatory cells (Fig. 1c).

Ultrastructure changes of IA and normal arterial tissues were observed by a transmission electron microscope. It was found that the endothelial cells were complete and adventitia structure were intact; no broken internal elastic membrane or apoptotic smooth muscle cells were seen in normal arterial tissues. In IA tissues, it was presented with severe degeneration of blood vessel wall, mainly manifested as the disappearance of most endothelial cells, severely broken internal elastic layer, severely damaged and degraded smooth muscle cells, and the disorder of the outer membrane of the blood vessel (Fig. 1d).

RT-qPCR was conducted for determining MALAT1, miR-143, and VEGFA mRNA expression, while western blot analysis for VEGFA, MMP-9, and vWF protein expression in IA tissues and normal arterial tissues. It was demonstrated that in contrast to the normal arterial tissues, MALAT1, VEGFA, MMP-9, and vWF expression levels were heightened and miR-143 expression was degraded in IA tissues (all P < 0.05) (Fig. 1e, f).

Hunt-Hess Grade, Degree of Endothelial Damage, and Smoking History Are Correlated with MALAT1 Expression in IA Tissues

In the light of the median expression of MALAT1, the patients were assigned into two groups: low expression group and high expression group. The relationship between MALAT1 expression and the clinicopathologic features of patients with IA was analyzed. The results suggested that Hunt-Hess grade, degree of endothelial damage, and smoking history were associated with MALAT1 expression (all P < 0.05), while age, gender, and surgical mode were not related to MALAT1 expression (all P > 0.05) (Table 2).

Table 2

Relationship between relative expression of MALAT1 and clinicopathological features in patients with intracranial aneurysm

Clinicopathologic data	n	Expression of MALAT1		P
		Low expression group (n = 12)	High expression group (n = 8)
Age (year)
≤ 42	8	5	3	0.852
> 42	12	7	5
Gender
Male	11	7	4	0.714
Female	9	5	4
Hunt-Hess grade
I/II	14	6	8	0.002
IIII/V	6	6	0
Degree of endothelial damage
0~2	6	1	5	0.010
3~4	14	11	3
Surgical mode
Clippping surgery	11	7	4	0.446
Conservative treatment	7	3	4
Interventional treatment	2	2	0
Smoking history
Smoking	15	11	4	0.035
Non-smoking	5	1	4

Note: MALAT1 metastasis-associated lung adenocarcinoma transcript 1; Grade 0: endothelial cells were basically normal, a few granulocytes attached to the gap; Grade 1: the gap between endothelial cells widened and intercellular filaments changed, but there was no obvious interruption of endothelial continuity; Grade 2: local endothelial cell damage and blood cell adhesion, other areas were covered by normal endothelial cells; Grade 3: the destruction of endothelial cell layer and the attachment of blood cells were large, and normal endothelial cells were still covered in the distant area; Grade 4: destruction of extensive endothelial cell layer, obvious attachment of blood cells, and the presence of a few endothelial cells. The data in this table are enumeration data, which are tested by chi-square test

Downregulated MALAT1 Represses the Blood Pressure, the Expression of ET-1, vWF, and MMP-9, As Well as the Apoptotic Index of Vascular Endothelial Cells of Rats with IA

As displayed in Table 3, MALAT1 knockdown degraded, while MALAT1 restoration raised blood pressure at the 4th and 12th week.

Table 3

Changes of blood pressure (mmHg) of rats in each group

	Preoperative	1 W	4 W	12 W
Blank	106.37 ± 10.65	124.74 ± 10.37	138.60 ± 10.11	153.75 ± 10.21
sh-NC	105.65 ± 10.09	124.65 ± 10.15	133.36 ± 10.28	155.32 ± 10.32
sh-MALAT1	104.98 ± 10.88	110.65 ± 10.10	118.67 ± 12.17*	124.73 ± 12.38*
Oe-NC	108.25 ± 11.34	122.68 ± 12.17	131.65 ± 1.04	154.27 ± 0.45
Oe-MALAT	109.36 ± 10.76	152.66 ± 16.69	178.82 ± 19.21#	209.06 ± 20.33#

Note: * P < 0.05 vs. the sh-NC group. # P < 0.05 vs. the Oe-NC group. Measurement data were depicted as mean ± standard deviation

ELISA revealed that MALAT1 downregulation reduced, while MALAT1 up-regulation elevated ET-1 and vWF expression in serum of rats with IA (Fig. 2a, b).

Fig. 2

Downregulated MALAT1 represses blood pressure, the expression of ET-1, vWF, and MMP-9, as well as the apoptotic index of vascular endothelial cells of rats with IA. a ET-1 expression in serum of rats by ELISA. b vWF expression in serum of rats by ELISA. c Pathological changes of IA tissues in rats observed by HE staining. d The ultrastructure of IA tissues in rats observed by a transmission electron microscope. e Apoptosis of vascular endothelial cells by TUNEL staining. f Vascular endothelial cell apoptotic index of rats. g MALAT1, miR-143, and VEGFA mRNA expression in IA tissues of rats by RT-qPCR. h VEGFA, MMP-9, and vWF protein expression in IA tissues of rats by western blot analysis. * P < 0.05 vs. the sh-NC group, # P < 0.05 vs. the Oe-NC group. Measurement data were depicted as mean ± standard deviation, and comparisons among multiple groups were assessed by one-way analysis of variance followed with Tukey’s multiple comparisons test

The pathological changes of IA tissues in each group were surveyed with HE staining. The blank group, sh-NC group, and Oe-NC group were manifested with damaged inner membrane, exfoliated endothelial cells, degenerated smooth muscle cells, reduced cells and layers, and thinned artery wall. In the sh-MALAT1 group, the endodermis, endothelial cells, smooth muscle cell layer, and outer membrane layer of intracranial artery were slightly damaged but arranged neatly. The Oe-MALAT1 group showed with disappeared intimal layer, exfoliated endothelial cells, broken elastic fibers, and infiltrated inflammatory cells (Fig. 2c).

The IA tissues of rats in each group were observed by a transmission electron microscope. It was displayed that denatured endothelial cells, disintegrated subendothelial layer, disappeared internal elastic layer, and decreased smooth muscle cells were presented in the blank group, sh-NC group, and Oe-NC group. The sh-MALAT1 group demonstrated with flat endothelial cells, oval nucleus, and increased collagen fibers but without elastic layer. The Oe-MALAT1 group was featured by disappeared endothelial cells and separated elastic layer from the muscle layer, which was disintegrated into the lumen (Fig. 2d).

The apoptotic index of vascular endothelial cells in IA rat was tested by TUNEL staining. Silencing MALAT1 reduced the apoptotic index of vascular endothelial cells, while overexpressed MALAT1 exhibited the opposite effect (Fig. 2e, f).

RT-qPCR detection of MALAT1, miR-143, and VEGFA mRNA expression, and western blot analysis of VEGFA, MMP-9, and vWF protein expression in IA tissues presented that MALAT1 elimination depressed MALAT1, VEGFA, MMP-9, and vWF expression, and heightened miR-143 expression. On the contrary, MALAT1 elevation imposed the opposite influences on these gene expressions (Fig. 2g, h).

Low Expression of MALAT1 Advances Viability and Restrains Apoptosis of Vascular Endothelial Cells in IA

Immunohistochemical staining was employed to detect the expression of endothelial-specific marker vWF. It was manifested that the cytoplasm of IA vascular endothelial cells was covered with fine brown particles, which was positive, while the cytoplasm in its NC group had no brown particles. The results confirmed that the cultured cells were endothelial cells (Fig. 3a, b).

Fig. 3

Low expression of MALAT1 advances viability and restrains apoptosis of vascular endothelial cells in IA. a vWF immunohistochemical staining in IA vascular endothelial cells: IA vascular endothelial cells were covered with fine yellow particles. b vWF immunohistochemical staining in IA vascular endothelial cells: IA vascular endothelial cells showed no brown particles in the NC group. c Vascular endothelial cell viability in each group by MTT assay. d Protein expression of CyclinD1 and Ki-67 in each group by western blot analysis. e Cell cycle changes in each group by PI staining. f Cell apoptosis rate in each group by Annexin V/PI double staining. g Bax and Bcl-2 protein expression in each group by western blot analysis. * P < 0.05 vs. the sh-NC group, # P < 0.05 vs. the Oe-NC group. Measurement data were depicted as mean ± standard deviation, and comparisons among multiple groups were assessed by one-way analysis of variance followed with Tukey’s multiple comparisons test

MTT assay, flow cytometry, together with western blot analysis were utilized to test vascular endothelial cell viability and apoptosis. It was displayed that MALAT1 diminution promoted vascular endothelial cell viability (heightened Cyclin D1 and Ki-67 expression) and depressed apoptosis (decreased G0/G1 phase cells and increased S and G2/M phase cells, reduced Bax and elevated Bcl-2 expression). However, MALAT1 upregulation functioned in an opposite way to that of MALAT1 diminution on cell viability and apoptosis (Fig. 3c–g).

MiR-143 Is Bound to MALAT1 and VEGFA Is a Target Gene of miR-143

MALA1, miR-143, and VEGFA expression in vascular endothelial cells of each group were verified through RT-qPCR and western blot analysis. The results presented that MALA1 knockdown depressed MALA1 and VEGFA expression and enhanced miR-143 expression. On the contrary, MALA1 upregulation led to the increment in MALAT1 and VEGFA expression and the reduction in miR-143 expression (Fig. 4a, b).

Fig. 4

MiR-143 is bound to MALAT1 and VEGFA is a target gene of miR-143. a MALAT1, miR-143, and VEGFA mRNA expression in vascular endothelial cells of aneurysm in each group. b VEGFA protein expression in vascular endothelial cells of aneurysm in each group. c The binding sites of MALAT1 and miR-143 predicted by the bioinformatics website. d The regulatory relation of MALLA1 and miR-143 validated by dual luciferase reporter gene assay. e The binding relationship between MALAT1 and miR-143 verified by RNA-pull down assay. f The binding sites of miR-143 and VEGFA predicted by the bioinformatics website. g The regulatory relation of miR-143 and VEGFA validated by dual luciferase reporter gene assay. * P < 0.05 vs. the sh-NC group, # P < 0.05 vs. the Oe-NC group. Measurement data were depicted as mean ± standard deviation, comparisons between two groups were assessed by independent sample t test, and comparisons among multiple groups were assessed by one-way analysis of variance followed with Tukey’s multiple comparisons test

The specific binding region between MALAT1 and miR-143 was divined by online analysis software (Fig. 4c). The results of dual luciferase reporter gene assay revealed that the luciferase activity was impaired in the MALAT1-WT + miR-143 mimic group versus the MALAT1-WT + mimic-NC group (P < 0.05). However, there was no distinct difference in luciferase activity in the MALAT1-MUT + miR-143 mimic group relative to that in the MALAT1-MUT + mimic-NC group (P > 0.05), indicating that miR-143 was specifically bound to MALAT1 (Fig. 4d). The results of RNA-pull down assay reported that the enrichment level of MALAT1 in the Bio-miR-143-WT group was heightened compared to the Bio-miR-NC group (P < 0.05), but there was no distinct difference in MALAT1 enrichment level in the Bio-miR-143-MUT group (P > 0.05) (Fig. 4e).

Bioinformatics software divined a targeted relationship between miR-143 and VEGFA (Fig. 4f). The results of luciferase activity showed that the relative luciferase activity repressed after VEGFA-WT and miR-143 mimic co-transfected into vascular endothelial cells (P < 0.05). However, the relative luciferase activity of vascular endothelial cells was not affected by co-transfection of VEGFA-MUT and miR-143-mimic (P > 0.05) (Fig. 4g). It was indicated that VEGFA was a direct target gene of miR-143.

Discussion

IA is a serious intracranial disease, which mainly leads to subarachnoid hemorrhage [18]. A previous study has demonstrated the involvements of lncRNA-related competitive endogenous RNA networks in IA [19]. Also, a recent study has provided a proof that functional polymorphism in miR-143/145 gene promoter region is connected with the risk of IA [20]. In a study conducted by Xu et al., it is shown that overexpression of angiogenic factors, such as VEGFA, may be related to IA formation and rupture [21]. In order to explain the molecular mechanism of MALAT1 in IA, a series of assays have been conducted and the results revealed that IA induced by vascular endothelial injury was regulated by MALAT1/miR-143/VEGFA signal axis.

Firstly, our study has provided substantial evidence that MALAT1 and VEGFA are upregulated and miR-143 is downregulated in IA tissues. A recent study has presented that MALAT1 is one of the most upregulated lncRNAs in the process of cerebral ischemia [22]. Another study has presented that MALAT1 is upregulated in ovarian cancer cells and intends to participate in the processes of ovarian cancer cell apoptosis, migration, and proliferation [23]. A study concerning to the expression profile of unruptured and ruptured IA has demonstrated that the expression of angiogenic factors such as VEGFA is upregulated in ruptured aneurysm [21]. Moreover, a clinical study has presented that the miR-143/145 cluster of IA patients is downregulated compared to healthy subjects [11]. In addition, it is previously discussed that miR-143/145 takes part in various biological processes associated with aneurysm formation and is downregulated in patients with IA [20]. All these findings are more or less echoed with the previous exploration outcomes.

Except for the abovementioned findings, this study has also explored the functional role of MALAT1 in IA through gain-off-function and loss-of-function assays. It could be summarized that downregulation of MALAT1 reduced blood pressure, serum levels of ET-1, and vWF and MMP-9 expression in IA tissues. It has been suggested previously that downregulation of MALAT1 restrains the upregulation of the glucose-induced ET-1 transcription product [24]. Also, it is reported that ectopic MALAT1 expression is the inducer of vWF generation [25]. Another study has verified that the depletion of MALAT1 in bone marrow-derived macrophages inhibits the expression of MMP-9 [26].

Also, cell experiments have been conducted for further confirmation of the functions of MALAT1 in IA. The results have suggested that MALAT1 knockdown promoted vascular endothelial cell viability and depressed apoptosis in IA. Similarly, it has been documented that disturbance of MALAT1 improves aortic mural architecture and retards aneurysm growth [8]. Supplementary to our study finding, there is research highlighting that poor expression of MALAT1 induces apoptosis and restrains proliferation of acute myeloid leukemia cells [27]. Another study has also demonstrated the inhibitory effects of MALAT1 knockdown on proliferation of human osteoarthritis cartilage cells [28]. Besides that, a prior research generally confirms that downregulation of MALAT1 can induce apoptosis and attenuate the proliferation of glioma cells [29]. Moreover, low expression of MALAT1 induced by RNA interference promotes apoptosis and suppresses proliferation of multiple myeloma cells [30]. Collectively, these studies have explained the molecular mechanism of MALAT1 in IA to some extent.

In addition, this study has evidenced that miR-143 is bound to MALAT1 and VEGFA is a target gene of miR-143. Similarly, a paper contends that MALAT1 binds directly to miR-143 and suppresses its expression [10]. Zhu et al. have found that MALAT1 exerts its roles via interacting with miR-143 in cervical carcinoma cells [31]. It is further confirmed that MALAT1 indirectly modulate VEGFA via miR-200b-3p [32]. Moreover, another study has suggested that miR-143-3p mediates ZFPM2 effect on a number of protein targets in blood, including VEGFA [33]. Nevertheless, the interactions among MALAT1, miR-143, and VEGFA in IA have not been discussed and need further study.

Conclusion

From these results, it is clear that MALAT1 knockdown depresses apoptosis and promotes viability of vascular endothelial cells in IA by modulating miR-143/VEGFA axis. The co-expression network suggests the connection between MALAT1 and miR-143 with the involvement of VEGFA. The findings in this study partially disclose the pathogenesis of IA initiation and progression, and the studied targets may be a notably potential entry point to reveal pathology of IA from another perspective. Limitedly, further large-scale studies are required to comprehensively illustrate the mechanisms of MALAT1/miR-143/VEGFA axis in IA.