Effects of Certain cis-Regulatory Elements on Stage-Specific vitellogenin Expression in the Bombyx mori (Lepidoptera: Bombycidae).

Bombyx mori vitellogenin (BmVg) is highly upregulated during pupation, and the 20-hydroxyecdysone and amino acids may regulate stage-specific BmVg expression. However, previous studies showed that other factors may also affect stage-specific BmVg expression. Here, we characterized effective BmVg transcription factors by identifying the corresponding cis-regulatory elements (CREs). We prepared transgenic B. mori, in which DsRed was driven by various lengths of BmVg promoter. qRT-PCR analysis showed that DsRed expression driven by a 1.0-kb BmVg promoter (VgP1.0K) was consistent with endogenous BmVg. VgP1.0K specificity was closer to the endogenous BmVg promoter than that of VgP0.8K. These results suggest that CREs affecting stage-specific BmVg expression were localized to the 1.0-kb BmVg promoter. We investigated the effects of certain CREs that could influence the stage specificity of BmVg promoter on BmVg expression in transgenic B. mori. The relative DsRed expression was significantly reduced in transgenic female B. mori and the peak in DsRed expression was delayed after E-box CRE mutation. These results demonstrate that the E-box element enhanced BmVg expression and also affected stage-specific BmVg expression. Moreover, the relative DsRed expression was significantly increased in transgenic female of B. mori after 3×BD CRE mutation in BmVg promoter. However, the stage specificity of the mutated promoter was consistent with that of the endogenous BmVg promoter. The 3×BD element downregulated BmVg but had no effect on stage-specific BmVg expression. The present study promoted the process of elucidating the regulatory network for stage-specific BmVg expression and furnished a theoretical basis for the application of BmVg promoter.

The Vg gene is unique in oviparous animals, which plays a significant role in yolk protein synthesis during the embryo formation (Valle 1993). Vg is essential for insect reproduction. When the Vg content is reduced, the embryo fails to develop normally (Lin et al. 2013, Yang et al. 2014a). Vg is synthesized mainly in the fat bodies of female insects at specific developmental stages (Valle 1993, Hirai et al. 1998, Raikhel et al. 2002). The mechanisms regulating Vg expression have been widely investigated. The stages at which Vg is expressed vary with insect species (Hirai et al. 1998, Tufail et al. 2010, Yang et al. 2014a). Stage-specific Vg expression is relatively complex and regulated mainly by juvenile hormones, ecdysone, amino acids, and insulin (Bownes 1982, Hansen et al. 2014, Gujar and Palli 2016, Lu et al. 2016, Roy et al. 2018, Asad et al. 2020).

Bombyx mori (B. mori) is an economically important lepidopteran insect that synthesizes and secretes abundant silk proteins (Luan et al. 2018). It is completely metamorphic. Previous studies showed that B. mori Vg (BmVg) expression has definite sex, tissue, and stage specificity (Yang et al. 2014a). BmVg expression starts in the fat body on day 2 after spinning in female B. mori (Yang et al. 2014a). Stage-specific BmVg expression is regulated mainly by nutritional and 20-hydroxyecdysone (20E) signals (Yang et al. 2014b; Lin et al. 2017; Shen et al. 2018; Liu et al. 2019a,b). After spinning is complete, the increase of amino acid in the hemolymph induces BmGATA β4 to upregulate BmVg (Liu et al. 2019a,b). 20E titer is also increased in the hemolymph at this time to induce the early gene BmBrC-Z2 and the homodomain transcription factor BmPOU-M2, then BmBrC-Z2 and BmPOU-M2 to upregulate the expression of BmVg (Lin et al. 2017). During spinning, BmGATAβ4 is expressed at a certain level and 20E has a small titer peak but BmVg is not expressed. Therefore, other unidentified transcription factors may regulate stage-specific BmVg expression.

Gene expression is regulated mainly by promoters including their cis-regulatory elements and their corresponding trans-acting factors. There are many predicted cis-regulatory elements in the BmVg promoter (Yang et al. 2014b). The regulatory regions −42 to −152 bp and −752 to −952 bp in the BmVg promoter significantly influence its activity. There is a predicted binding site for the Drosophila transcriptional repressor hairy in the −39 to −54 region of the BmVg promoter. Hairy belongs to the bHLH family, which could recognize E-box or N-box sites in target gene promoter (Sasai et al. 1992). Hairy could recruit a co-suppressor to inhibit target gene expression (Davis and Turner 2001, Jindra 2016, Saha et al. 2016). Thus, hairy may also affect BmVg expression. Moreover, three tandem repeat sequences in the −836 bp to −887 bp region of the BmVg promoter are the predicted binding sites for DREF (DNA replication-related element factor) or BEAF (boundary element-related factor). DREF elements promote gene expression (Hart et al. 1999, Fernández-Moreno et al. 2009). BEAF requires three tandem repeats to block the enhancer upstream of the gene promoter (Hart et al. 1999). The core motifs of DREF and BEAF are similar; therefore, DREF and BEAF may be antagonistic (Hart et al. 1999). However, there are no prior reports on DREF or BEAF in B. mori. It remains to be determined whether DREF or BEAF affects stage-specific BmVg expression.

Previous studies used ~0.8-kb upstream region of the BmVg promoter to drive green fluorescent protein expression and prepare transgenic B. mori. RT-PCR assays revealed that the promoter of 0.8 kb in length had the same sex, tissue, and stage specificity as the endogenous BmVg promoter (Xu et al. 2014). This discovery may imply that the cis-regulatory elements influencing stage-specific BmVg expression mainly reside within this 0.8-kb BmVg promoter.

For this reason, here we focused on the cis-regulatory elements in the BmVg promoter to identify those regulating stage-specific BmVg expression. We used the promoter 0.8 kb in length as a control and extended it. We first prepared transgenic B. mori with BmVg promoters of various lengths to drive DsRed expression and analyzed the expression characteristics of the different BmVg promoters. And we comprehensively analyzed the regulatory regions affecting stage-specific BmVg expression. Then we applied this transgenic method to explore the effects of certain cis-regulatory elements in the BmVg promoter on stage-specific BmVg expression. This study initiated the process of elucidating the regulatory network of stage-specific BmVg expression and provided a theoretical basis for the application of the BmVg promoter.

Materials and Methods

Construction of Vectors for Cell Line Transfection

Various lengths of BmVg promoter were amplified from the B. mori genome and ligated to the pGL3-basic vector (Promega, Madison, WI) using the restriction endonucleases XhoI and HindIII. The vector constructs were named pGL3-VgP0.8K Luc, pGL3-VgP1.0K Luc, and pGL3-VgP1.7K Luc. The BmVg promoter was truncated and used to construct the pGL3-VgP54 Luc vector with the E-box element, the pGL3-VgP39 Luc vector without the E-box element, the pGL3-VgP888 Luc vector with the 3×BD element, and the pGL3-VgP834 Luc vector without the 3×BD element. The E-box element was connected to the upstream regulatory sequence from −38 to +40 of BmVg (basic promoter VgP78ML), the VgP78ML was unresponsive to the induction of ecdysone, juvenile hormone, or their transcription factors (Liu et al. 2019b) stored in the laboratory and the product was named VgP78ML+E-box Luc. The amplification primers are listed in Table 1.

Table 1.

Primers used in the study

Purpose/primer name	Nucleotide sequence (5′–3′)
Cell transfection
VgPcell-0.8K-F (XhoI)	CCGCTCGAGCCCGATCCATTAACAGTGCT
VgPcell-1.0K-F (XhoI)	CCGCTCGAGAGCACAGCTTACTAACAAGA
VgPcell-1.7K-F (XhoI)	CCGCTCGAGATCGAGAAGATAAAAAACTCGCAC
VgPcell888-F (XhoI)	CCGCTCGAGCATTCCCGATACAGCTCTAGGA
VgPcell834-F (XhoI)	CCGCTCGAGCATACCCGATCCCGTAGACCGA
VgP54-F (XhoI)	CCGCTCGAGTGGGACGCGTGTACCCTCCCTA
VgP39-F (XhoI)	CCGCTCGAGCTCCCTATATAAAGGGGGTGA
78ML+E-box-F (XhoI)	CCGCTCGAGTGGGACGCGTGTACCCGGTCTCGATCAGCGGGT
E-box-M1-F (XhoI)	CCGCTCGAGTGGGATATACATACCCTCCCTA
VgPcell-R (HindIII)	CCCAAGCTTTGTACTAGCTCCGCTGTC
Transgenic vectors
VgP0.8K-F (EcoRI)	CCGGAATTCCCCGATCCATTAACAGTGCT
VgP1.0K-F (EcoRI)	CCGGAATTCAGCACAGCTTACTAACAAGA
VgP-R (BamHI)	CGCGGATCCTGTACTAGCTCCGCTGTC
E-box-M1-F	AGTTCTGGGATATACATACCCTCCCTA
E-box-M1-R	TAGGGAGGGTATGTATATCCCAGAACT
3×BD-M1-F	ACCGTATTGGCTTACGACACATACCCGATCCCGT
3×BD-M1-R	ACGGGATCGGGTATGTGTCGTAAGCCAATACGGT
RT-PCR
DsRed-F	AACGGCCACGAGTTCGA
DsRed-R	GGTGTAGCCTCGTTGTGGG
BmVg-F	CCACCCTCAATAACTTCTAC
BmVg-R	AGGTATGTATCCTTGTGCC
BmActin3-F	AACACCCCGTCCTGCTCACTG
BmActin3-R	GGGCGAGACGTGTGATTTCCT
qRT-PCR
Bmsw22934-F	TTCGTACTGGCTCTTCTCGT
Bmsw22934-R	CAAAGTTGATAGCAATTCCCT
DsRed-F	TTCGCCTGGGACATCCTG
DsRed-R	TGGTCTTCTTCTGCATTACGG
BmVg-F	AGTCACGACGAATACCAAGAAGAT
BmVg-R	TACGATAGTCCTGTGTGAAAACG
Inverse PCR
pBacL-F	ATCAGTGACACTTACCGCATTGACA
pBacL-R	TGACGAGCTTGTTGGTGAGGATTCT
pBacR-F	TACGCATGATTATCTTTAACGTA
pBacR-R	GTACTGTCATCTGATGTACCAGG

Cell Transfection

The B. mori embryonic cell line BmE-SWU1 stored in the laboratory was maintained at 27°C in Grace’s insect medium (Invitrogen, Carlsbad, CA) supplemented with 10% (v/v) fetal bovine serum (FBS; HyClone, Thermo Fisher Scientific, Waltham, MA). X-tremeGENE HP DNA transfection reagent (Roche, Basel, Switzerland) was used for the cell transfection assays. The PRL-VgP78M vector was transferred as an internal control (Liu et al. 2018). After 36 h transfection, the cells were harvested and assayed for luciferase activity. The cell transfection experiments and luciferase activity measurements were conducted as previously described (Deng et al. 2012).

Construction of Vectors for Germline Transformation

BmVgP1.0K with a mutant E-box element was named as BmVgP1.0M. The BmVgP1.0M sequence was amplified with a unique primer containing the mutated E-box sequence. The core site of the E-box element, CGCGTG, was changed to TATACA. Three repeated DREF and BEAF elements in series on the BmVg promoter were named 3×BD. BmVgP1.7K with a deletion 3×BD element was named BmVgP1.7K-3×BD. The BmVgP1.7K-3×BD sequence was amplified with a unique primer deleting the 3×BD element.

The pBac [3xp3-EGFP-SV40] stored in the laboratory served as a framework vector expressing enhanced green fluorescent protein (EGFP) in the B. mori eyes (Chen et al. 2018). It is used to screen for positive transgenic B. mori. DsRed was the target gene driven by the BmVg promoter. The BmVg promoter was ligated with BamHI and EcoRI to the plasmid pSL1180-A4-DsRed-SV40 stored in the laboratory. The vector product was pSL1180-VgP-DsRed SV40. The plasmid containing VgP-DsRed-SV40 was digested with AscI and inserted into the vector pBac [3xp3-EGFP-SV40] to generate pBac [3xp3-EGFP-SV40; VgP-DsRed-SV40]. Transgenic vectors were constructed with promoters of various length and mutated CRE and named pBac [3xp3-EGFP-SV40; VgP0.8K-DsRed-SV40], pBac [3xp3-EGFP-SV40; VgP1.0K-DsRed-SV40], pBac [3xp3-EGFP-SV40; VgP1.7K-DsRed-SV40], pBac [3xp3-EGFP-SV40; VgP1.0M-DsRed-SV40], and pBac [3xp3-EGFP-SV40; VgP1.7K-3×BD -DsRed-SV40]. The primers used are listed in Table 1.

Production of Transgenic B. mori

The nondiapause B. mori dazao strains were used to prepare transgenic B. mori and the transgenic B. mori were generated as previously described (Chen et al. 2018). The injected G0 embryos were reared to the moth stage for G1 oviposition. The G1 embryos were screened under a fluorescence microscope (Olympus SZX12, Olympus, Tokyo, Japan) after growth for ~6–7 d. The G1 individuals on the basis of green fluorescence signal in compound eyes were selected and reared to adult stage. Individuals positive were interspecifically crossed over multiple generations to obtain pure stable transgenic B. mori.

Inverse PCR

DNA was extracted from transgenic adults and 15 μg was digested with HaeIII at 37°C for 4 h and purified. Then 1 μg purified product was circularized with T4 DNA ligase at 16°C overnight and used as template for PCR reaction with primers designed from the arm region of the piggyBac vector. The amplified PCR product was cloned into the pMD19-T vector for sequencing (TaKaRa Bio, Dalian, China). The sequencing results were blasted in the B. mori genome database SilkDB (http://www.silkdb.org/silkdb/) to identify the insertions in the transgenic B. mori. The primers are listed in Table 1.

Collection of Fat Body Samples and RNA Isolation

Numerous factors affect exogenous DsRed expression in transgenic B. mori such as the DsRed copy number and the homozygous and hybrid transgenic lines. To compare BmVg promoter activity accurately and eliminate the influences of the aforementioned factors, the transgenic lines with single insertion site were selected. The transgenic B. mori lines were also backcrossed with the wild type to generate more hybrid transgenic B. mori for subsequent experiments.

The last-instar B. mori larvae began spinning silk on days 7–8. The period from spinning to pupation is the wandering stage and it lasts for 2~3 d. The fat bodies of 5–10 B. mori were collected for each group between day 1 of wandering to day 3 of pupation. TRIzol reagent (Invitrogen) was used to extract total RNA according to the manufacturer’s protocol.

RT-PCR and qRT-PCR

The corresponding cDNA was synthesized with Moloney murine leukemia virus reverse transcriptase (Promega). For the RT-PCR analysis, the BmVg and DsRed fragments were amplified from the cDNA samples using gene-specific primers. BmActin3 was the housekeeping gene. The PCR program was as follows: 95°C, 4 min; 95°C, 30 s; 55°C, 30 s; 72°C, 30 s, n* cycles; and 72°C, 10 min. The amplified samples were maintained at 4°C.

*Here, n = 20 for BmVg in females, n = 25 for DsRed in females, BmVg in males, and BmActin3, and n = 30 for DsRed in males. The PCR products were separated by agarose gel electrophoresis.

For qPCR, SYBR Green kits (TaKaRa Biotech, Osaka, Japan) were used according to the manufacturer’s instructions. The relative mRNA levels of the target gene were normalized to the housekeeping gene translation initiation factor 4A. The expression level was determined by the 2−ΔΔCt method (Livak and Schmittgen 2001). Three independent replicates were performed for each experiment. The RT-PCR and qPCR primers are listed in Table 1.

Statistical Analysis

The data are presented as means ± standard error. The relative DsRed expression values were calculated as follows: DsRed mRNA level/BmVg mRNA level. Independent-sample t-tests were applied to evaluate the promoter activity and gene expression data. Differences between group means were considered significant at P < 0.05; *P < 0.05; **P < 0.01.

Results and Discussion

BmVgP1.0K Stage Specificity Was Closer to the Endogenous BmVg Promoter

Previous studies showed that BmVgP0.8K expression is tissue-, stage-, and sex-specific (Xu et al. 2014). To verify whether all elements determining stage-specific BmVg expression are located in the 0.8-kb region of the BmVg promoter, we used BmVgP0.8K as a control to analyze promoters of different lengths. The luciferase activity assay in cells revealed that BmVgP1.0K activity was significantly higher than those of BmVgP0.8K and BmVgP1.7K (Fig. 1A). Thus, there are some elements upregulate promoter activity from −0.8 to −1.0 kb.

Fig. 1.

Generation of transgenic B. mori with DsRed driven by the BmVg promoter. (A) Activity of BmVg promoters with different lengths. (B) Map of transgenic vector; pBacR and pBacL are the right and left arms of the transposon, respectively; 3xp3 EGFP SV40 is the transgene marker; and Promoter is the BmVg promoter. (C) Screening of positive transgenic B. mori under fluorescence microscope; (a1–d1) white light image of wild-type B. mori (a1), VgP0.8K transgenic B. mori (b1), VgP1.0K transgenic B. mori (c1), and VgP1.7K transgenic B. mori (d1); (a2–d2) fluorescence image of wild-type B. mori (a2), VgP0.8K transgenic B. mori (b2), VgP1.0K transgenic B. mori (c2), and VgP1.7K transgenic B. mori (d2). (D) Analysis of insertion sites for transgenic B. mori. Significant differences between data sets were calculated by two-tailed Student’s t-tests; *P < 0.05; **P < 0.01.

We then constructed the transgenic vector for BmVg promoters of different lengths (Fig. 1B). These vectors were injected into B. mori embryos to gain transgenic B. mori. The compound eyes of the positive moths presented with specific EGFP emission (Fig. 1C) and the transgenic insects with only one insertion site (Fig. 1D) were backcrossed of wild-type B. mori to collect fat bodies for detection. RT-PCR showed that exogenous DsRed was not expressed in female or male wild-type B. mori (Fig. 2A). The expression patterns of DsRed were consistent with those of BmVg in BmVgP0.8K (Fig. 2B), BmVgP1.0K transgenic B. mori (Fig. 2C), and BmVgP1.7K transgenic B. mori (Fig. 2D). DsRed was highly expressed only in the fat bodies of transgenic B. mori (Fig. 2E). This discovery was consistent with previous reports demonstrating that BmVgP0.8K had BmVg promoter specificity (Xu et al. 2014). Our results showed that BmVgP1.0K and BmVgP1.7K also had BmVg promoter specificity. These results indicated that the elements that determine the stage-specific expression are mainly in the 0.8-kb BmVg promoter. In this region, the DSX, BrC-Z2, POUM2, ERR, and GATA elements could regulate BmVg expression (Suzuki et al. 2003, Yang et al. 2014b, Lin et al. 2017, Shen et al. 2018, Liu et al. 2019b). Moreover, ABDB, FTZ, and hairy elements have been predicted for this region (Yang et al. 2014b). However, we found that the onecut, ABDB, and FTZ elements had no apparent impact on BmVg promoter activity (data not shown). Therefore, we selected a Drosophila hairy binding site E-box element that could inhibit the BmVg promoter in theory (Davis and Turner 2001) for analyzing the effects on BmVg stage-specific expression in this study.

Fig. 2.

Detection of exogenous DsRed expression in various B. mori by RT-PCR. (A–D) DsRed expression in fat bodies at different B. mori stages. (A) Wild-type B. mori. (B) BmVgP0.8K transgenic B. mori. (C) BmVgP1.0K transgenic B. mori. (D) BmVgP1.7K transgenic B. mori. (E) DsRed expression in various B. mori tissues. BmVg was a positive control and BmActin3 was a housekeeping gene. (W1–W3) Wandering stage (d); (P1, P3) pupal stage (d).

Then we used qPCR to further compare promoter activity among the three types of transgenic B. mori. In BmVgP0.8K transgenic B. mori, the DsRed expression peak was delayed (Fig. 3A). However, DsRed expression was consistent with endogenous BmVg expression in BmVgP1.0K (Fig. 3B) and BmVgP1.7K (Fig. 3C) transgenic B. mori. These results suggest that the elements determining stage-specific BmVg expression resided mainly within 0.8 kb. However, there were some elements between −0.8 and −1.0 kb of the BmVg promoter that affected stage-specific BmVg expression. The typical elements in the range from −0.8 to −1.0 kb are three tandem repeats of the BEAF or DREF element (Yang et al. 2014b), so we then detected the effect of 3×BD CREs on the stage-specific expression of BmVg promoter. And we calculated relative exogenous DsRed expression value and found that it was significantly higher in BmVgP1.0K transgenic B. mori than it was in BmVgP0.8K and BmVgP1.7K transgenic B. mori on day 3 after wandering (Fig. 3D), suggesting the BmVgP1.0K activity was higher than that of BmVgP0.8K and BmVgP1.7K. Therefore, some cis-regulatory elements may enhance BmVg promoter activity in the region from −0.8 to −1.0 kb and inhibit BmVg promoter activity in the region from −1.0 to −1.7 kb.

Fig. 3.

Detection of exogenous DsRed expression in various transgenic B. mori. (A) DsRed expression trend in BmVgP0.8K transgenic B. mori. (B) DsRed expression trend in BmVgP1.0K transgenic B. mori. (C) DsRed expression trend in BmVgP1.7K transgenic B. mori. (D) Relative expression of DsRed in various transgenic B. mori. Significant differences between data sets calculated by two-tailed Student’s t-tests; **P < 0.01.

The E-Box Element Affects the Stage-Specific Expression of BmVg Promoter

The E-box element was between −39 and −54 bp in the BmVg promoter (Fig. 4A). We transfected the vectors for BmVg promoter with and without E-box into cells and found that the E-box element could significantly enhance BmVg promoter activity (Fig. 4B). We then connected the E-box element to the basic promoter VgP78ML and also confirmed that the E-box element enhanced promoter activity (Fig. 4C). While the promoter activity was significantly downregulated after mutating the E-box element (Fig. 4D).

Fig. 4.

Effect of E-box on BmVg promoter activity. (A) Position of E-box element on BmVg promoter. (B) Effect of E-box element on BmVg promoter activity in BmE-SWU1 cell. (C) Activity of 78ML basal promoter linked with E-box CRE. (D) Effects of E-box CRE on BmVg promoter activity after mutation. (E) qPCR of DsRed expression trend in BmVgP1.0M transgenic B. mori. (F) Comparison of DsRed expression on day 3 after wandering in female of transgenic B. mori. For more visual representation relative fold change in promoter activity after mutation, the DsRed expression driven by BmVgP1.0K promoter without mutation was normalized as 1. Significant differences between data sets calculated by two-tailed Student’s t-tests; *P < 0.05; **P < 0.01.

We then constructed a transgenic vector by VgP1.0K with the E-box mutation (Supp Fig. S1A [online only]) and screened the stable heritable transgenic individuals (Supp Fig. S1B [online only]). We selected single-insertion moths in subsequent analyses (Supp Fig. S1C [online only]). RT-PCR revealed that the expression profile of exogenous DsRed driven by VgP1.0M was consistent with that of endogenous BmVg (Supp Fig. S1D [online only]). DsRed was also highly expressed in the fat bodies (Supp Fig. S1E [online only]). Therefore, VgP1.0M had essentially the same expression characteristics as the BmVg promoter.

Similarly, we also analyzed DsRed expression by qPCR. The DsRed expression peak was delayed and occurred on day 1 after pupation in VgP1.0M transgenic B. mori (Fig. 4E), indicating the E-box element affected the stage specificity of BmVg expression. Meanwhile, we found that the relative DsRed expression value was significantly lower after mutating the E-box element (Fig. 4F). This finding was consistent with the observed results in the transfected cells. Nevertheless, this E-box element was predicted to be the binding site for the hairy which inhibits promoter activity (Saha et al. 2016). Therefore, we speculated that it was not the hairy that bound the E-box element in BmVg promoter. At the same time, we overexpressed the hairy in cells and found that the E-box element does not respond to the hairy (data not shown). However, the E-box element nonetheless stimulates promoter activity and must, therefore, bind a transcription factor upregulating BmVg expression. Our findings indicated that the mutated E-box element impeded BmVg upregulation on day 3 after wandering and could alter BmVg promoter stage specificity. But the mechanism of the effect of the E-box element on BmVg expression remains unknown. To this end, we must determine which transcription factor(s) binds this site and have regulatory functions there in the further.

3×BD Elements Have No Effects on the Stage-Specific Expression of BmVg Promoter

Previous studies showed certain elements might affect the stage specificity of the promoter in the upstream 0.8- to 1.0-kb region of the BmVg promoter. There are three tandem repeat elements in this sequence (Fig. 5A). They may be the binding elements of BEAF and DREF (Fig. 5B). DREF could significantly upregulate the promoter activity and BEAF could suppress upstream enhancer in theory (Hart et al. 1999). To confirm whether 3×BD affects BmVg promoter stage-specific expression, we firstly analyzed its effects on promoter activity in cells and found the 3×BD element could inhibit promoter activity (Fig. 5C). So, the 3×BD element may be a boundary blocking the enhancer upstream of this element. Thus, we choose the 1.7-kb BmVg promoter to examine the effects of 3×BD CRE in transgenic individuals. The transgenic vector VgP1.7K-3×BD (Supp Fig. S2A [online only]) was injected into B. mori embryos and obtained stable heritable transgenic individuals (Supp Fig. S2B [online only]). Similarly, the single-insertion transgenic individuals were selected for the subsequent analyses (Supp Fig. S2C [online only]). RT-PCR revealed that the stage and tissue expression profiles of DsRed driven by VgP1.7K-3×BD were consistent with endogenous BmVg (Supp Fig. S2D and E [online only]). Thus, it retained the BmVg promoter expression characteristics even after the 3×BD element was deleted.

Fig. 5.

Effects of 3×BD CRE on BmVg promoter activity. (A) Position of 3×BD CRE in BmVg promoter. (B) Conservative core motif of DREF and BEAF CRE. (C) Effect of 3×BD CRE on BmVg promoter activity in BmE-SWU1 cell. (D) qPCR of DsRed expression trend in BmVgP1.7K-3×BD transgenic B. mori. (E) Comparison of DsRed expression on day 3 after wandering in female transgenic B. mori. DsRed expression in W3 of BmVgP1.7K female transgenic B. mori was normalized as 1. Significant difference between data sets calculated by two-tailed Student’s t-tests; **P < 0.01.

We ran qPCR to analyze the VgP1.7K-3×BD expression characteristics and found that the expression of DsRed driven by it was consistent with that of endogenous BmVg (Fig. 5D). Therefore, the 3×BD element did not affect BmVg promoter stage specificity. Consistent with cell results, DsRed expression was significantly increased after 3×BD CRE deletion in transgenic B. mori (Fig. 5E). Thus, the transcription factor binding 3×BD CRE was not related to DREF. 3×BD CRE does not affect BmVg promoter stage specificity, but only inhibited BmVg expression. The stage specificity and the activity of the 1.0-kb BmVg promoter were greater than those of the 0.8-kb BmVg promoter. These results suggest that in this sequence interval, there were other elements influencing BmVg promoter activity and stage specificity. Nevertheless, these elements remain to be identified. However, physiological significance of the element inhibiting BmVg expression during vitellogenesis is obscure.

Conclusion

The present study compared the activity of BmVg promoters of different length and examined the effects of certain elements on BmVg promoter stage specificity and activity in transgenic B. mori. This study indicated that the elements that affect the stage-specific BmVg expression were basically localized to the 1.0-kb BmVg promoter and the E-box element could affect the stage-specific BmVg expression, while the 3×BD element could not. This information forms the theoretical basis for the transformation and application of the BmVg promoter.

Click here for additional data file.

Click here for additional data file.