Draft Genome Sequences of Five Carnobacterium sp. Strains Isolated from Freshwater Ponds in Belgium.

Strains belonging to the genus Carnobacterium are Gram-positive bacteria that are widely distributed in the environment. Here, we report the draft genome sequences of five Carnobacterium strains isolated from freshwater ponds located in Flanders, Belgium, and sequenced on an Illumina HiSeq 4000 platform.

ANNOUNCEMENT

Bacteria from the genus Carnobacterium have previously been isolated from various food sources (1–3), such as meat (4) and milk (5), and grow in a pH range of 5.5 to 9.1 (1, 3, 6). Fewer reports exist of isolates of this genus from aquatic environments (1, 6–8). To date, 11 species have been reported to belong to the genus (3, 4, 9–13). Here, we present draft genome sequences of five Carnobacterium sp. strains isolated from five different freshwater ponds located in Belgium within the scope of experimental work. These ponds were small (<1 ha), shallow (<3 m), and man-made. Table 1 includes the geographic coordinates of the ponds and some water quality variables.

TABLE 1

Genome sequence statistics summary, pond water quality characteristics, and pond geographic coordinates for the five isolated Carnobacterium strains

Variable	Data for Carnobacterium sp. 1290 strain:
	PL12RED10	PL26RED25	PL17RED31	PL24RED07	PL17GRE32
Genome characteristics
Total length (bp)	1,976,998	1,974,582	1,957,158	1,975,794	1,996,575
GC content (%)	39.34	39.46	39.48	39.46	39.42
No. of CDSa	1,812	1,741	1,800	1,790	1,832
No. of tRNAs	51	51	51	51	52
No. of rRNAs	4	3	3	3	3
No. of reads	6,095,916	6,238,674	5,210,544	5,894,490	6,301,572
Final coverage (%)	457.353	468.178	396.568	444.213	471.107
SRA accession no. for raw reads	SRX7894432	SRX7894431	SRX7894430	SRX7894429	SRX7894428
No. of scaffolds	43	72	42	71	49
Scaffold N50 (bp)	151,666	74,489	168,268	74,489	119,417
GenBank accession no. for assembled genomes	WVES00000000.1	WVEP00000000.1	WVEQ00000000.1	WVER00000000.1	WVEO00000000.1
Pond water quality data
pH	10.14	7.16	6.93	8.91	7.39
Oxygen (mg/liter)	12.495	3.905	2.755	8.94	1.00
Chlorophyll-a (μg/liter)	72.87	59.52	97.92	219.04	41.90
Pond geographic coordinates	51°7′1.7796ʺN, 4°28′30.4392ʺE	51°10′18.39ʺN, 4°24′53.9496ʺE	50°59′27.6684ʺN, 3°59′50.0604ʺE	50°56′5.784ʺN, 4°51′30.8304ʺE	51°1′2.7984ʺN, 3°56′36.3012ʺE

CDS, coding sequences.

Water (50 ml) from each pond was filtered using a 0.22-μm filter and cryopreserved in glycerol at −80°C before the isolates were cultured on King agar B medium at 24°C. For DNA isolation, five isolates were cultivated at 24°C on King agar B medium for 48 h. Bacterial DNA was isolated using a Qiagen DNeasy UltraClean microbial DNA extraction kit (Qiagen). Initial identification was done by sequencing the 16S rRNA gene using primers 27F and 1492R (14).

The DNA concentration of the samples was measured using a Quant-iT PicoGreen kit (Thermo Fisher Scientific); DNA integrity and purity were determined by electrophoresis (1% agarose gel with Midori Green [Nippon Genetics Europe]) and spectrophotometry (A260/A280; Infinite M Nano+ [Tecan]). Library preparation and sequencing were performed at BGI (Shenzen, China). DNA was fragmented using a Covaris ultrasonicator. Fragmented DNA was combined with end repair mix (Agilent, USA) and purified with an AxyPrep Mag PCR cleanup kit (Thermo Fisher Scientific). Adapters (adapter 1, GATCGGAAGAGCACACGTCTGAACTCCAGTCAC; adapter 2, AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA) were added, and adapter-ligated DNA was purified with an AxyPrep Mag PCR cleanup kit. Adapter-ligated fragments (insert size, 300 bp) were enriched by PCR amplification (95°C for 2 min; 6 cycles at 98°C for 15 s, 62°C for 30 s, and 72°C for 30s; 72°C for 5 min), and the PCR products were purified with an AxyPrep Mag PCR cleanup kit. Sequencing libraries were quantified using an Agilent Technologies 2100 bioanalyzer and an ABI StepOnePlus real-time PCR system. The resulting libraries (<800 bp) were sequenced on an Illumina HiSeq 4000 platform (150-bp paired ends) at BGI.

Trimmomatic v0.38 (15) was used for quality trimming of raw sequences with a Phred quality score cutoff of 33 and a minimum read length of 40. Unicycler v0.4.8 (16) software was used for de novo assembly of the genomes. Functional annotation and genome quality assessment were performed using the NCBI Prokaryotic Genome Annotation Pipeline (PGAP). Genome coverage was assessed with BBMap v38.72 (https://sourceforge.net/projects/bbmap/). The sequence statistics of the genomes are summarized in Table 1.

Pairwise comparison analysis using JSpeciesWS (17) (http://jspecies.ribohost.com/jspeciesws/) showed that all investigated strains belong to the same species (average nucleotide identity, >95%) and have highest similarity (>97.39%) to Carnobacterium sp. 1290. Based on ResFinder (https://cge.cbs.dtu.dk/services/ResFinder/) (18), no resistance genes were found. No intact phages were found using PHASTER (19) (http://phaster.ca/). Default parameters were used for all software.

Data availability.

This genome sequencing project has been deposited in the NCBI Sequence Read Archive (SRA) under BioProject number PRJNA551600 and BioSample numbers SAMN12161540 to SAMN12161544. The accession numbers for the individual strains are given in Table 1.